HBVdb

Dataset for nucleotide sequence Genomes of genotype D

[Download (right click)] [Alignment] [Repertoires]

1259 sequence(s)

>gnl|hbvnuc|AB119253_FT00000_P-D Feature FT:source AB119253_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggctactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctttcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccactccttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctcaagacttctttcctgccgtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgtacatatcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgtctctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctatctttaacccttattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB555501_FT00000_P-D Feature FT:source AB555501_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-TA65). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaacttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgatgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctct
aattccaggatcttcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttatgtctttgggtattcatataaaccctaacaaaacaaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtccttgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggtttcgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctatcgtcccctcctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactcggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttatat
aagaattggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctttgtatcgggaagccttagagtctcctgagcattgtacacctcaccataccgcactcaggcaagcaattctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccatcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcagttattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagagtatatggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacaattaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcacctttttcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccacctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875335_FT00000_P-D Feature FT:source KC875335_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV44). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaccgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaacgttaccaaatatttacccttggataagggtattaaaccttattatccagaacatctagtt
aatcattactttcaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcctcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ562309_FT00000_P-D Feature FT:source FJ562309_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I200). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaaaatcccggagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaacctgttcccactactgtctctcacatatcgkcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacctgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
aaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaacataagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatttttgtattaggaggctgtaggcataaattggwctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccatataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaatgactctagccacctgggtgggtggtaatttagaagatccagtatccagggacctagtagtcag
ttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcttaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattggttatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggaccattcgggccggggttcactccaccacacggcaatcttttgg
ggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctcctcctgcctccaccaatcggcagtcagga
agacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JF754629_FT00000_P-D Feature FT:source JF754629_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK176). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcaacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgatgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcttgctcaaggaacctctatgtatccct
cctgttgttgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggcattcccccac
tgcttggcttttagctatatggatgatgtggtattgggggccaagtctgcttcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattaccacaagatcacatcagacagaaacttaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctctaatgcccttgtatgcatgtattcagtccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aagatatttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccattcgactttttcacctctgcctaatc
acctcttgttcatgtcctactattcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagcatctgtggagttactctcgtttttgccttctgacttttttccttcagttcgagatcttctagataccg
cctcagctttgtatcgggacgctttagagtctcatgagcattgctcacctcaccatactgcactcaggcaagcaattctg
tgctggggggatctaataactctatctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcaa
ttatgtcaactctaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagacctccaaatgcccctatctta
tcaacgcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccgtggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgaaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataaaggtattaaaccttattatcccgaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcaggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccacctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM524348_FT00000_P-D Feature FT:source KM524348_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK129_EP-CHB). Complete genome. [Hepadnaviridae] (length=3182 residues).
atccctgaccttccaccaaactctgcaagatcttgtagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cattaaaccctgttccgactactgtctctcacatatcgtgaatcttatccaggattggggaccctgcgctgaacatggag
aacatgtcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaccctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gttatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgtactctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaccctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatcctt
tgctggggggaactaatgactctagccacctgggggggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagagtatttggtgtcttttggagtgtggattcccactcctccagcttatagaccaccaaatgcccctatctta
tcaactcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaagatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcagttaattatgc
ctgctaagttttacccaaatgttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcacgctctgggcatactacacaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcaacctaccactctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456646_FT00000_P-D Feature FT:source GU456646_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T77). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaggttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggccttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttatatgcatgtattcagtcgaagcaggcttttaccttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
gctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgatgcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgttgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccagcaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatataccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|HM750151_FT00000_P-D Feature FT:source HM750151_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSD-8). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaacttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctgaattttatgg
gttatgtcattggatgttatgggtcattgccacaagaacacattatacaaaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccgacaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggaccgataactctgttgtactctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcgcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcatttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtaaatgagaaaagaagattgcagttgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgaaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggcctgttgg
ggtggagccctcaggctcagggcatattacaaactttgccagcaaatccgcctcctgtctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN688712_FT00000_P-D Feature FT:source JN688712_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV163). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccct
cttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagattcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagamtgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgcattgtgggtcttttgggttttgytgccccttttactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtataaacaatrcctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggggaccaccgtgaacgcccaccatgtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacccttataa
agaatttggagcttctgtggagttactctcgtttttaccttctgacttctttccttccatacgagatcttctagatacag
ccgcagctctgtatcgggatgccttagaatctcctgaacattgttcacctcaccatactgcaatcaggcaagcaattctt
tgctggggggaactaatgaacctagctacctgggtgggggttaatttggatgatccaacatctagggaagcaataaccag
ttatgtcaacactaatatgggcctaaagtttcggcaactcttgtggtttcacgtttcttgtctcacttttggaagagaca
cagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttattagaagacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaactctcgggactctcaatgttagtataccttggactcataaggtggggaac
tttactgggctctattcttctacggtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacaactggccagacgccaacaaggtaggagctggagcattcgggctgggkttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgycagtcagga
agacagcctactccgctgtctccacctttgagaaacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|JN040762_FT00000_P-D Feature FT:source JN040762_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919007). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagcaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtgttgggggccaagactgagcagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcagacagaaactcaaagactgttttcgaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgcctatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggcctttctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagatta
caggtgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttccgtacgagatcttctagataccg
cctcagctctgtatcggggtgccttagagtcttctgagcattgttctcctcaccatactgcactcaggcaagcggttctt
tgctggggggatctaataaatttatccacctgggtgggtggtaatttggaagatccaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcgtatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacgcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacacctacttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcactgtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttctatcccaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattatttccaaaccagacattatttacacactctatggaaggcgggcatattatataagagagaaacaacacgtag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcttctaccaatcgccagtcagga
aggcaacctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040767_FT00000_P-D Feature FT:source JN040767_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919019). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacattccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctggacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccaccagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttatccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacgtttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctagggcatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacccccacttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattagataagggcattaaaccttattatccagaacatctggtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707692_FT00000_P-D Feature FT:source JQ707692_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_26). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctacaaaaccttccaccaaactctacaagatcccaaagtgagtggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatagcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcctgcactcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgtagttctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagtacgagatcttcttgataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacaatgcaaaccttgccagcaaatccgcctcctgtatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcaccctcaggccatacagtggaa
>gnl|hbvnuc|AB674407_FT00000_P-D Feature FT:source AB674407_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD35). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaagccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaactcaaagaatgttttagaaaacttcct
gtcaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtmctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaaaacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaacaagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664921_FT00000_P-D Feature FT:source JN664921_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN47_IC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcgtcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaagacaaaaagatggggttattctctacacttcatgg
ggtatgtcattggttcttggggatcattaccacaagaacacattatacacaagctgaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttaatgcccttgtatgcatgtattcaatccaaacaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttgatcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaacattatcgggactgacaactctgttgtcctatcccgcaaat
atacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggacattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattgcaattgattatgc
ctgctaggttttatcctaaggtaaccaaatatttgccattggataagggtattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ470895_FT00000_P-D Feature FT:source KJ470895_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8120). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgwatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaacaaaacaaagagatggggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaagatcacattatacttaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggccttttgggttttgctgcccctttcactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgycaacttacaaaacctttc
tgcgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgataactctgttgttctttcccgcaagt
atacatcgtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacccttgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttgctgtcgtttttgcctactgacttctttccttccgtccgagatctactagataccg
caacagcgctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaattaatgactctagctacctgggtgggtactaatttagaagatcaatcatccagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcagacaactattgtggtatcacacttcttgtctcatgtttggaagagaaa
cggttcaagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtggggagt
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcctaatatacatttaca
ccaaaatattattgaaaaatgtgaacagtttgtgggccccctcacagtcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttaccctaatgttaccaaatatttacccttggacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgttttatataagagggaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaattccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccgccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatcatacaaaccttgccagcaaatccacctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB109479_FT00000_P-D Feature FT:source AB109479_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttccaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaactcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcaatcaggcaagctatcctt
tgctggggggagttaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU787447_FT00000_P-D Feature FT:source EU787447_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W46). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgagtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cttgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgccgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
tctagcagcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
atggtctttgtattaggagactgtaagcataaattggtctgcgcacctgcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642166_FT00000_P-D Feature FT:source JN642166_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb35). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
agcgtcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaccatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggaaccacagtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcctgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaccgcccaccagttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagatgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttcggacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagaatctcctgaccattgttcacctcaccatactgcactcaggcaagcaattctc
tgctggggggatctaatgactctagccacctgggtgggtggtaatttggaagatccaatttccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccttagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ304548_FT00000_P-D Feature FT:source DQ304548_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgacaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaacaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagaatagatta
atgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcaccgctgcctaatc
atctcttgttcatgtcctattgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcctttttgccttctgacttctttccgtcggtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgaacattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactttagccacctgggtgggaggtaatttgcaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccgccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactctctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttggagggccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggtaacaaataatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgtcagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccacgaagtggaa
>gnl|hbvnuc|GQ183479_FT00000_P-D Feature FT:source GQ183479_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4607). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgcgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgg
gctacgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaatttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagccacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttccactgtacctgtttttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagtaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH724216_FT00000_P-D Feature FT:source MH724216_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR5). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatctcctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggaaggaaattgcacctgtattctcatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactttctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggtacgacatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcakacgaag
atctcaatcgccgcgtcgcagaakatctcaatctcgggaatctcaatgttaktattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccrctcacagtcawtgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaracactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664922_FT00000_P-D Feature FT:source JN664922_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DH01_IC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcaccgaatatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgggtgtcttggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggatcctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacatcatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtctgttcgagatctcctcgataccg
cctctgctctgtatcgggaggccttagagtctcctgagcattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggggaggtgacgaatctggccacctgggtgggaagtaatctggaagaccaagcatccagggaattagtagtaag
ctatgtcaatactaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctgctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttgtctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX196226_FT00000_P-D Feature FT:source KX196226_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0111). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaaattgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK618430_FT00000_P-D Feature FT:source MK618430_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh18). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagtgtgagaggcctttatttccctggtggtggctccagttcaggaa
cagtaaaccctgttccgagtactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcaatcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctggggcttcggaaaattccca
tgggagtgggccacagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttcgaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtggaaacaatacctgaacctttaccccgttccccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctcccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcgggggcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctttgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacacccacttttcctaatatacatttaca
ccaagacattattaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccatcttatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgataaacactcatcctcatgccatgcagtggaa
>gnl|hbvnuc|AB270547_FT00000_P-D Feature FT:source AB270547_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL295F). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaacatgcagaacctgcacgacccctgctcgcggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactccgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatttttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccatataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagaatctcctgagcattgttcacctcatcatactgcactcaggcaagcaattctt
tgctggggggatctaataactctatccacctgggtgggtggtaatttagaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggackcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaacccgacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB674427_FT00000_P-D Feature FT:source AB674427_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD54). Complete genome. [Hepadnaviridae] (length=3182 residues).
ytccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcttcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttcgaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtcaaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgtaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgatgcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacmttgatccttataa
agaatttggagctwctgtggagttactctcgtttttgcctcttgacttctatccttcagtacgtgatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcaccacatcatactgcactcaggcaagcaattcta
tgctggggggacttaatgaatctagctacctgggtgggtagtaatttggaagatccagtatccagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttccggcaactattgtggtttcacatttcttgtctcacttttggaaaagaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttaatattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcgtttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtrtattatataagagagaaacaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctccggcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN310705_FT00000_P-D Feature FT:source MN310705_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BG_41_2010). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaagcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctggacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacraratcttctarataccg
cctcagctctgtatcgggaagccttaragtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgyacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcarttgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaacctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagccttcgggcygggattcaccccaccgcacggaggccttttag
ggtggagccctcaggctcagggcatactacamaccttgccagaaaatccgyctcctgcctctaccaatcgccagtcaggg
aggcagcctaccccgctgtctccaccwttgagaaacactcatcctcaggcaatgcagtggaa
>gnl|hbvnuc|AB246347_FT00000_P-D Feature FT:source AB246347_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcattcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttacccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ304549_FT00000_P-D Feature FT:source DQ304549_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatcttcctgctggtggctccagttaaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaacaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagaatagatta
atgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcctttttgccttctgacttctttccgtcggtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgaacattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactttagccacctgggtgggaggtaatttgcaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactctctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaagtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgtcagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccacgaagtggaa
>gnl|hbvnuc|JN642158_FT00000_P-D Feature FT:source JN642158_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb57). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctatatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatatggtattgggggccaagtctgtgcaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgttattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgtttcgctcgcagcaggtctggagcgaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcctgggactctatcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccagttcttgcccaaggtcttacataagaggactcttggactctctgtat
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
ccacagctctatatcgggaggccttagagtctcctgaacattgttcacctcaccatacggcactcaggcaagcaattcta
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacttccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcatgtttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgctaccaaatatttaccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagcgggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgccgcctgcctctaccaatcgccagtcagga
aggcagcctacccctccgagtccacctttgagaaacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|FJ904426_FT00000_P-D Feature FT:source FJ904426_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B4). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcatcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tatgtaaacaatacytgcacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aagatctttgtattgggaggctgtaggcataaattggtctgcgcaccagcaccatgcacctttttcacctctgcctaatc
agctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaatacta
tgctggggggaactaatgactctagccacctgggtgggtgctaatttggaagatccaacatctagggacctagtagtcag
ttatgttaacaataatatgggcgtaaagttcaggcaactattgtggtttcacatttcttgtctaacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccaccatatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacaacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgctagtattccttggactcataaggtgggaaac
tttacggggctttattcttccactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatattcatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacacctagtt
aatcattacttccaaaccagacattatttacatactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcacccctcctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|JQ707520_FT00000_P-D Feature FT:source JQ707520_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C24). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttctctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttcttgataccg
cttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH724242_FT00000_P-D Feature FT:source MH724242_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR34). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcacagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgtattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaagcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcactacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagttag
ttatgtcaacactaatatgggcataaagttccggcaactcttgtggtttcacatttcttgtctcacttttggaagagata
cagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggacccataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttacccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904421_FT00000_P-D Feature FT:source FJ904421_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A71b). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcargatccmagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcatcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatcttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggatggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcatccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttgcataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattcta
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggatgatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcatatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctactcctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875312_FT00000_P-D Feature FT:source KC875312_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV22). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgcgttaatgccattgtatgcctgtattcaatctaagcaggctttcactttctcgccaccttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctgtgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccaggttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU736925_FT00000_P-D Feature FT:source KU736925_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Sudan_15). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaagactaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtctattgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaaattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctgaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtaatagagtacttggtttctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttactaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ464174_FT00000_P-D Feature FT:source DQ464174_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT6). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggtccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttctgtctttgggtatacatttaaaccctaacaaaacaaaacgatggggttattctttaaattttatgg
ggtatgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaacgtgg
ttatcctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttcttgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatctgcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cccagccgcttgttttgctcgcagcaggtctggggcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctttgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctatccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctcgctacctgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtggggagc
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgataatgc
ctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX196212_FT00000_P-D Feature FT:source KX196212_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL097). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccctccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttggggacctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacatccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaacttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT114169_FT00000_P-D Feature FT:source MT114169_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1745). Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccatcaaactctgcaagaccccagagtgagaggcctgtatttccctgctggtggctccagttcaggga
cagtaaaccctgttccgactactgtatctcacatatcgtcaatcttctccaggattggggaccttgcgacgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
tcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcgaggtatgttgcccgtttgtcctct
acttccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgcttggctttcagttatatggatgatgtggtattgggggccaagaatgtacaacaccttgagtccctttataccgctgt
taccaattttcttatgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgtcagggttcattgccacaagatcacatcatacagaaaatcaaagattgttttaggaaacttcct
gtcaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccctttacgcaatgtgg
ttatcctgctttaaagcctttgtacgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattatcgggacagataactctgtcgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcgtttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcaaccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgaatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagcttagatta
aaggtgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccattcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgatccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccgtacgagatcttctagataccg
ccgcagctctgtatcgggatgccttagagtctcctgaacattgttcgcctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcac
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccatcaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacaacgaggcaggtccactagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatccatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactacaattgattatgc
ctgctaggttctatccaaaagttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccacaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccatcaactggatccagctttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagcgggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccaacaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagcctactcctctgactccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF471660_FT00000_P-D Feature FT:source KF471660_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-2). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
tgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccggccttgaggcatacttcaaagactgtttgcttaaagactgggaggagttgggggaggagagtagactt
tgtctatttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttcttcccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttctcctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattctgtgggtcaccatattcttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccaccgttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF584165_FT00000_P-D Feature FT:source KF584165_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Da). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctracaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgracctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacraratcttctarataccg
cctcagctctgtatcgggaagccttaragtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgyacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaacctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagccttcgggcygggattcaccccaccgcacggaggccttttag
ggtggagccctcaggctcagggcatactacaaaccttsccagaaaatccgcctcctgcctctaccaatcgccagtcaggg
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggcaatgcagtggaa
>gnl|hbvnuc|MK541688_FT00000_P-D Feature FT:source MK541688_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 12/16/0148). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttatgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgttttcgaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtcctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctgatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccgtctgacttctttccttcagtacgagatcttctagataccg
cctcagctttgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattcta
tgctggggggacttaatgaatctaggtacctgggtgggtgttaatttgcaagatgaagcatctagggaccgagtagtcag
ttatgttaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagacaaa
cagtagtagaatatttggtgtctttcggagtgtggattcgcactcccccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaagattttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggcaggctggtatattatataagagagaaacaacacacag
cgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttctgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcaaga
aggcagcctaccccactgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU414140_FT00000_P-D Feature FT:source EU414140_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcycatatcgtcaatcttctcgaggattggggaccctgtgccgaacatggag
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactmccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcytgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactmtcaaggtatgttgcccgtytgtcctct
aattccaggatcwtcaaccaccagyrygggaccmtgcmraacctgcacgactmytgytcaaggaacctctatgtwtccct
cmtgttgctgtwcmaaaccttcggacggaaattgcacytgtattcccatcccatcatcmtgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgymgggctttcccccac
tgtytggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacccyaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggatcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaatgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccktgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaatcatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtac
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700480_FT00000_P-D Feature FT:source HQ700480_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_RA37_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatrgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactatctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctatctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875306_FT00000_P-D Feature FT:source KC875306_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV71). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttggggacctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccacgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB330370_FT00000_P-D Feature FT:source AB330370_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ6HBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttgtgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gctatgtcattggatgttatgggtcattgccacaagagcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaatagacctattgattggaaagtgtgtcaacgaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
ttatcctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtcctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagttag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgcgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaacccgacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagatgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HM750156_FT00000_P-D Feature FT:source HM750156_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSF-12). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactccgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccaccagcacgggtccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacacaaagatggggttactctttacatttcatgg
ggtatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtttgtcaacgtattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttcccgccaacttacaaggcatttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcgaagactgtttgtttaagaactgggaggagtcgggggaggagattagatta
aaggtttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagatactg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctt
tgttggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MW601302_FT00000_P-D Feature FT:source MW601302_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggtccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
attaacaggccgattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctt
tgctggggggacttaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaaggctgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcaggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacaactggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183456_FT00000_P-D Feature FT:source GQ183456_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4572). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctat
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456659_FT00000_P-D Feature FT:source GU456659_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T24). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatccaagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctcacacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacagctgt
taccaattttcttttgtctttgggtatacatttaaatcctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgcgtaaacaatacctggacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
atgatttttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgttttcgcctcatgacttctttccttcagtacgagatcttctagataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaataaatttatccacctgggtgggtggtaatttggaagatccaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctgaagttcagacaactattgtggtttcacctttcttgtctcacttttggaagagaaa
cggtcattgagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatcctaaggttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgatcaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggcctgttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacgaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM577668_FT00000_P-D Feature FT:source KM577668_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NIR-6). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgaccactgcctcttccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaaggtggggttactctttaaatttcatgg
gctatgttattggatgttatgggtccttgccacaagatcacatcatacagaaaatcaaagactgttttcgaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgcacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtgggtcctttctggatcctctgccgatccatactgcagaact
cctagccgcttgttttgctcgcagcaggtctggagcaaatattatcgggacggacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctcgcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcgccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctgatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggaccaagtagtcag
ttatgtcaacaataatatgggcctgaagtttaggcaactattgtggtttcacatttcttgtcttacttttggaagagaag
tggttttagagtatttggtgtctttcggagtgtggatccgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttgtactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacacttaca
ccaagatattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccctattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaatcatcacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ167302_FT00000_P-D Feature FT:source GQ167302_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM4521). Complete genome. [Hepadnaviridae] (length=3188 residues).
ctccacaactttccaacaaactctgcaagatcccagagtgagaggcctgaatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccacatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgcgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactatcgaggtatgttgcccgtttgtccggt
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggcctttagttatacggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgtttcaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtaggtcttttgggttttgctgcaccttttacacaatgtgg
ttatcctgctttaatgcccttgtacgcctgcattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctgggcgttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatgggcatggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactct
ctgtaatgtcaacgatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaat
aggttaatgatctctgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgc
ctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgatcc
ttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatcttctag
ataccgcctcagctctatttcgggacgccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagca
attctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaggatccaacatccagggacctagt
agtcacttatgttaacaccaatatgggcataaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaa
gagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaaccttatagaccaccaaatgcccct
atcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctgttttcctaatataca
tttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagactgcaattgg
ttatgcctgctaggttttatccaaaggttaccaaatatttgccatgggataagggtattaaaccttattatccagaacat
ctagtttatcattacttccagaccagagattatttacacactctatggaaggcgggtatattatataagagagaaacaac
acatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaat
cctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcc
caacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggcc
ttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccag
acgggaaggcagcctacccctctgtctccacctttgagagacactcatcctcaggccgtgcagtggaa
>gnl|hbvnuc|GU456658_FT00000_P-D Feature FT:source GU456658_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T114). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgagtgtcttggccaaaattcgcagtgcc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaggatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctattgagttactctcgtttttgcctactgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaacccttggagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggaaatctacaagatccaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggggtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatattccttggactcataaggtgggaaac
tttacagggctttactcttctactgttcctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaaagaagactgaaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagcgggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccaccgctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH724228_FT00000_P-D Feature FT:source MH724228_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR19). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccttatcatcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gatatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttttttccttcagtacgagatcttctagattccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttagaagatccagcatctaaggaccaagaatccag
ttatgttaacactaatatgggcctaaagttcaggcaactcttggggtttcacatttcttgtctcacttttggaaaagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttacccttggataagggtattaaaccttattatccagaacatatagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183474_FT00000_P-D Feature FT:source GQ183474_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4594). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttgacaggcctattgattggaaagtctgtcaacgtattgggggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttccactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacccgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX357622_FT00000_P-D Feature FT:source KX357622_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GD104ETH). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaagccctgttccgactactgcatctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggtccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaactgcacatgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacaccaacaaaaccaagagatggggttattctctacatttcatgg
gttatgtcattggaagttggggatcattgccacaagatcatatcattcttaaaatcaaagaatgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgcattgtgggtcttctgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcggaactgacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctatcgtccccttctctgcctgccgttccgcccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgcag
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aagatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
acctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcggctcgagatcttctagataccg
ccgcagccctgtatcgggatgccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagccattctt
tgctggggggaattaatgaatctagctacctgggtgggtgtaaatttggaagatcaaacatctagggaccaggtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttctctcacttttggaagagaaa
ctgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttgatattccttggactcataaggtgggaaat
tttactgggctttattcttctactgcacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacagtcaatgaaaaaagaaggttgaaattgattatgc
ctgctaggttttatccaaagtttaccaaatatttgcccttggacaagggtattaaaccgtattatccagacaacctagtt
aatcattacttccaagctagacactatttacacactctatggaaggcgggtattttatataggagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccacacatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcataatccaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctactccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MF925366_FT00000_P-D Feature FT:source MF925366_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV10). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccaccacattccaccaaactctgcaagatcccagagtgagaggcctgtactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctcacaagacgaaaagatggggttattctctacactttatgg
ggtatgtcattggttgttggggatcattaccacaagatcacattatacacaagctaaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttatatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgccgcagactggaagctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgtccccttctccgtctgccgtaccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcgactgtggagatactctcatttttgccttctgatttctttccgtctgtacgagatcttctagacaccg
ccgcagctctatttcgggatgcgttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaattaatgactctagctacctgggtgggtactaatttggaagatccagcatctagggacctagtggtcag
ttatgtcaacactcacatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcatgtttgggagagaaa
cggtttcggagtttttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacaaaatgcccctatctta
tctacacttccggagacttgtgttgttagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccaacttttcctaatatacatttaca
ccaagacatcatcaacaaatgtgaacaatttgtaggccctcttactgtcaatgagaaaagaagattgaaattgattatgc
ctgctaggttttaccctaactttaccaaatatttacccctagataagggtattaaaccttactatccagaacatctagtt
aatcattactttcaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatatacatgggaacaaaagctacagcatggggcagaatctttccaccagcaatcccctg
ggattctttcccgaccatcagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggattgctggccagcggccaacaaggtaggagtgggatcattcgggccagggttcacccctccccatgggggccttttgg
ggtggagccctcaggctcagggcatactacaaaccgtgccagcagcacctcctcctgcctccaccaatcggcagtcagga
agacagcctaccccactctctccacctctaagggacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183477_FT00000_P-D Feature FT:source GQ183477_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4604). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaatatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtcttgactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgacaactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttactcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgattgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaga
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttccactgtacctgtttttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagtaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH724221_FT00000_P-D Feature FT:source MH724221_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR11). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
attaacagacctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcacctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcacacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccataccgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttccggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaagatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttcaaaactagacactatttacacactctatggaaggcgggtatattatataagcgagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MW601303_FT00000_P-D Feature FT:source MW601303_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtctaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatttcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccagtatccagggatctagtagtcag
ttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtgcctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttcctaaccaggcattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgactccacctttgagagacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY796032_FT00000_P-D Feature FT:source AY796032_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NA1.11). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagacaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggatttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaaccattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacatcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgaatctagccacctgggtgggtagtaatttggatgatccaacatccagggaccaagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagagg
tagttttagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattctactactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacttggccagacgcccacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707699_FT00000_P-D Feature FT:source JQ707699_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_35). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctacaaaaccttccaccaaactctacaagatcccaaagtgagtggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgtactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatagcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcctgcactcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccacgtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgtagttctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagtacgagatcttcttgataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacaatgcaaaccttgccagcaaatccgcctcctgtatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcaccctcaggccatacagtggaa
>gnl|hbvnuc|MK052972_FT00000_P-D Feature FT:source MK052972_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137Q-12). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcaacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggga
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggaa
aacatcacatcaggattcctaggactcctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgccttggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aatcccaggatcatcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttatcgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaagatggggttactctcttaatttcatgg
gatatgtcatcggaagttatggttcattgccacaagaacacatcagacataaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcagcgaattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtccgtgcctcctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttagagactgggaggagttgggggaggagactaggtta
aaggtctctgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgcctgctgacttctttcctacagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgtctctagctacctgggtgggcgctaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctctgttttggaagggata
cggtcgtagcttatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaggttactgttgttagaggacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattacaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctttggaaggcgggtgtattatataagagagaaacaactcatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattccttcccgaccaccagttggacccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacaactggccagacgccaacaaggtaggagccggagcattcgggctgggtctcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707698_FT00000_P-D Feature FT:source JQ707698_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_32). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctacaaaaccttccaccaaactctacaagatcccaaagtgagtggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatagcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcctgcactcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattgtcgggacggataactctgtagttctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagtacgagatcttcttgataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttata
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacaatgcaaaccttgccagcaaatccgcctcctgtatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcaccctcaggccatacagtggaa
>gnl|hbvnuc|MK052947_FT00000_P-D Feature FT:source MK052947_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcaacaaccttccaccaaactctacaagatcccagggtgaggggcctgtatttccctgctggtggctccagttcaggga
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcttggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aatcccaggatcctcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccgtcgtcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcatagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgctcagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaagatggggttactctcttaatttcatgg
gatatgtcattggaggttatggttcattgccacaagaacacatcatacacaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtgtgtcagcgaattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgcccgcagccggtctggagcaaacattctcgggactgataactctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcataatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgactcctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgtctctagctacctgggtgggcgctaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctctgtttcggaagggata
cggtcgtagcttatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaggttactgttgttagaggacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatcacaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaagaagattacaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
gatcattacttccaaactagacactatttacacattctttggaaggcaggtgtattatataagagagaaacaactcatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacactgcaaatccagattgggatttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagccggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
agtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK355500_FT00000_P-D Feature FT:source MK355500_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ahvaz30). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggataggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcccgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctcg
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaactttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
agggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcctgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcattcagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaacc
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttctcctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacctttgggagagaaa
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaaacacacatag
cgcctcattttgtgggtcaccatatttctgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttgggtccggccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttga
agaggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB330367_FT00000_P-D Feature FT:source AB330367_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ14HBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacgaccttccaccaaactctgcaagattccagagtaagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctaacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgcttgatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgccctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggtcactctctacatttcatgg
gctatgtcattggatgttatgggtccttgccacaagatcacatcagacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacatacaaggcctttt
tgtgcaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgattgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aagctgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
acctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttccgacttctttccttcagcacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtcttctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacacacttgatctagccacctgggtgggtggtaatttggaagatcaagcatccagggacctagtagtcaa
ttatgttaacactaagatgggcctaaagttcaggcaactattatggtttcacgtttcttgtctcacttttggaagacaaa
ttgtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaatgcttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaagc
tttacggggctttattcttctaatgttcctgtctttaaccctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcaggtatcttatataagagagaaacagcacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctctccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcgggg
aggcagcctactcctctgtctccgcctttgagagtcactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040796_FT00000_P-D Feature FT:source JN040796_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919018). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtccttgccacaagatcacatcatacagaaaattaaagattgctttagaaaacttcct
gttaacaggcccattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactctcggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcatctttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgatccttataa
agaattgggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagtgtactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacgtag
cgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040797_FT00000_P-D Feature FT:source JN040797_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919021). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaaccggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaagacctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctttcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttgtctcacttttggaagagaca
cagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctctattcttctacggtacctgtctttaaccctcattggaaaacaccctcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacactttgtaggcccacttacagtcaatgagaaaagaagactgcaattgatcatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183484_FT00000_P-D Feature FT:source GQ183484_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4598). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacattccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgactttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggaagttatgggtcattgccacaaaatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggtctctttcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgtcaatttggaagatccagcatctagagacctagtagttag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccgtggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggcgcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700471_FT00000_P-D Feature FT:source HQ700471_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO70_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggctgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccatcccggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaacgttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT603392_FT00000_P-D Feature FT:source MT603392_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 3288). Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactcttcaggatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtccttgccacaagatcacatcaaacagaaaatcacagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccaccagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgttctctcccgcaaat
atacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcgaggcaggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcatcgattcttgcccaaggtcttatataagagaactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagatta
aagatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcaatacgmgatcttctagataccg
cctcagctctgtatcgggacgccttagagtctcctgaacattgttcacctcaccatactgcaatcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtgtgaatttggaagatccaggatctagggaccaagtagtcaa
ttatgtcaacactaatatgggcctaaagttyagacaattattgtggtttcacatttcttgtatcacttttggaagagata
cggtcttagaatatttggtgtctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcacaaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaattcgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacacactatggaaggcgggcatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB116266_FT00000_P-D Feature FT:source AB116266_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgaggagcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggcaaagctgctccatttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
gttgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtcgtccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccatcaa
ggacacctggccagacgccaagaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggaccagccctcaggctcagggcataatagaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ205389_FT00000_P-D Feature FT:source GQ205389_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1667). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacgaaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataagacgaaaagatggggttattctctacacttcatgg
gttatgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacccaatgtgg
ttatcctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttagtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaa
tgtcaacgaccgatcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccgtcagtacgagatcttctagataccg
cctcagctctatatcgggaagcgttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagcatctagggacctagtggtcag
ttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcccaatatacatttaca
ccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatccagaacatctagtt
aatcattactttcaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccgcttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccccaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749821_FT00000_P-D Feature FT:source KT749821_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FL20). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttcgcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcctcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaactaaaagatggggttactctttacagttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctaggcaacggccgggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagatccaacatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagaactccatctcgggaatctcaatgttagtattccttggactcataaagtgggtaac
tttacggggctttattcttctactgcacctgtctttaaccctcattggaaaacaccctcgtttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggccctctcacagtaaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatgtagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggcctgttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctactccgctgtctccgcctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183467_FT00000_P-D Feature FT:source GQ183467_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4705). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtgtgctgcgcggcatcata
ttactcttcctcttgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgt
taccaattttcttttttctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700445_FT00000_P-D Feature FT:source HQ700445_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_BU12_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccatcaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccaattcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggctgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactttctcgtccccttctacgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU668447_FT00000_P-D Feature FT:source KU668447_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV191). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccatttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataagacgaaaagatggggttattctctacacttcatgg
gttatgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccgcaa
tgtcaacgaccgatcttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtcttcgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctcagcttaatc
atttcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagttactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB078031_FT00000_P-D Feature FT:source AB078031_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FH1-YS). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatccaagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctggcaacgtaatgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcgctacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggacaccaaatatttgccattagattagagtatttaaacttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatcttatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaaccctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaactccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagccgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594425_FT00000_P-D Feature FT:source EU594425_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctgkttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtytgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagagctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatccagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtctgttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaagcattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagtagttag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacatggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF471650_FT00000_P-D Feature FT:source KF471650_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-25). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcttgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaatcctaacaaaacaaaaagatggggttattctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctaaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatctgctagataccg
cctcagctctatatcgggacgccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatctagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttagtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgtcagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477452_FT00000_P-D Feature FT:source GQ477452_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P32). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggggaccctgtgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
gattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcaaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagcagcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aagatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctttcgggatgccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaatgactctagctacctgggtgggagctaatttggaagatccagcatctagggatctagttgttag
ttatgtcaacactaatgtgggcttaaaatttaggcaacttttgtggtttcacatttcttgtctcacttttggaagagata
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaatcatgc
ctgctaggttttatccaaaagttaccaaatatttgccattagataagggtatcaagccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707486_FT00000_P-D Feature FT:source JQ707486_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C24). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttatctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gttatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttcttgataccg
cttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MW601329_FT00000_P-D Feature FT:source MW601329_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactggtgccctttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtttcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcaaacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcgatgcctgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagataaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttccgtacgagatcttctagataccg
ctacagctctgtatcgggatgccttagagtctcctgagcattgtactcctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaattaatttatccacctgggtgggtggtaatttggaagatccaacatccagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaacccagattgggacttcaatcccaacaa
ggacacttggccagacgccaacaaggtaggagctggagcgttcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcaaggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB222709_FT00000_P-D Feature FT:source AB222709_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZBV34). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgygctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccgggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtctttgcctcaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactcagttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacttgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttccaaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacaatcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagagcatgtagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcattctacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcaaga
aggcagcctacccctctgtctccacctttgcgaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904439_FT00000_P-D Feature FT:source FJ904439_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B34). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctccattttatgg
gttatgtcattggaagttggggatcattgccacaagatcatatcagacacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgcattaatgcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggccgggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggcaataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtggttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggatctctcgtcctcttctctgcctgcggttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccacagctctgtatcgggatgccttagagtctcctgagcattgcacacctcatcatactgcactcaggcaagccatacta
tgttggggggaattaatgactctagctacctgggtgggggtcaatttagaagatcaagcttccagggacctagtagtcag
ttatgttaacaataatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
ccgtcttagaatatttggtgtcttttggagtgtggattcgcactcctccaccttatagaccagcaaatgcccctatctta
tcaacacttccggagactgctgttgttagatcaagaagcaggtcccttagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttccactgtacctgtttttaaccctcattggaaaacaccatcttttcctaatatacatttaca
tcaagacattattaaaaaatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggttaaaattgattatgc
ctgctaggttttatcctaagtttaccaaatatttgcccttggacaagggtatcaaaccctattatcccgaacacatagtt
aatcattacttccaaaccagacactatttacatactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccatcagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcacaccaccccacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctactccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875332_FT00000_P-D Feature FT:source KC875332_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV42). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040829_FT00000_P-D Feature FT:source JN040829_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919089). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtatctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttttagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggacctaatgaatctagctacctgggtgggtagtaatttggaagatccaacatccagggacctagtagtaag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
tagttatagagtatttggtatctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggccctctcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatccgcaggccatgcagtggaa
>gnl|hbvnuc|JN688695_FT00000_P-D Feature FT:source JN688695_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV128). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctcgggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggygtacatttaaaccctaacaaaacaaaaagatggggttactctctacatttcatgg
gctatgttattggatgttatgggtccttaccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtttgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttatatgcttgtattcaatcaaagcaggctttcactttctcgccaacttacaaggcctttc
tgtrtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtaytaggaggctgtaggcataaattggtttgcgcaccagcaacatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcaatacgagatcttttagataccg
cctcagctctgtatcgggawgccttagagtctcctgagcatatttcacctcatcatactgctatcaggcaagcaatcctt
tgctggggggaattaatgactttagccccctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cggtcatagagtatttggtgtctttcggagtgtggattsgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccatagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggccccctcacagtcaatgagaaaagaagactgcaactaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacwacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF471657_FT00000_P-D Feature FT:source KF471657_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-7). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggga
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
actgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcaccttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtattgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcgcctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaataactttatccacctgggtgggtggtaatttggaagatccaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774459_FT00000_P-D Feature FT:source KC774459_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1111). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggatggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaggtctgtcaacgtattgtgggtcttttgggttttgctgccccatttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgttcccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagctgggggaggagattagatta
atggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacgtataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaagggcggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF925393_FT00000_P-D Feature FT:source MF925393_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV38). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gatatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacgtcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaagcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggagagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaggctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcacaccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MW601234_FT00000_P-D Feature FT:source MW601234_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagagggctgtatttccctgctggtggctccagttcaggaa
cagtcaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgtcggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
catgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtgttgggggccaagtctgtgcaacatcgtgaagccctttttaccgctgt
taccaattttcttatgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagactgctttcgaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgtattgtggggcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaataccagaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgacg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgcctgctgacttctttccttcagtacgagatcttctagatactg
cctcagctctatttcgggatgccttagaatctcctgagcattgtacaccgcaccatactgcactcaggcaagccattctt
tgctggggggaattaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaca
tagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccagcaaatgcccctatccta
tcaacacttccggagactagtgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtggggaat
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaccaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatggtaccaaatatttaccattggacaagggtattaaaccttattatccagaacatctagtt
aatcattactttcaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactgtgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctactccgctctctccaccgttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB090268_FT00000_P-D Feature FT:source AB090268_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggacccccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacggcaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactaacaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagtctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF471642_FT00000_P-D Feature FT:source KF471642_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-65). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatattgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactattggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcatcatacgactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcagctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgtctttagccacctgggtgggtggaaatttggaagatccagtatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttgatattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM606752_FT00000_P-D Feature FT:source KM606752_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba100). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgagcatggag
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcatcaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctcttaatttcatgg
gctatgtcattggttgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaaacaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgtcctctcccgcaaat
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgtccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaaaactgggaggagttgggggaggagattagacta
aaggtctttgtactaagaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtgcgagatcttctagataccg
ccgcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgactctagctacctgggtgggcactaatttagaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatctaca
ccaagatattatcaaaaaatgtgaacagtttgtaggcccgctcacagttaatgagaaaagacggttgaaattgattatgc
ctgctaggttttatcctaattttaccaaatacttgcccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagagagtatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattttttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY090453_FT00000_P-D Feature FT:source AY090453_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcattttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcaagacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttcttctggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacagtgtgg
ttatcctgctttaaagcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcagctcatcatacagcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcttaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctgtggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggtcagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagcccacaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgttgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875296_FT00000_P-D Feature FT:source KC875296_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV82). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttaccggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgctacaaaccttgccagcagatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MW601244_FT00000_P-D Feature FT:source MW601244_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaacccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacgaaaaggtggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgccttaaagcctttgtatgcatgtattcaatctaagcaggctttcactttctcaccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcggccgtccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgagcgcccaccaattcttgcccaaggtcttacataagaggactcttggactttctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
cctcagctctgtatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcatttctt
tgctggggggaattaatgactctagccacctgggtgggtggtaatttggacgatccaacatccagggacctagtagtcag
ttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccgtggactcataaggtgggaaac
tttacggggctttactcttctaccgttcctgtctttaatcctcattggaaaacaccctcttttccaaatatacatttaca
ccaagacattattaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcatcctacccctctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ167301_FT00000_P-D Feature FT:source GQ167301_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM452). Complete genome. [Hepadnaviridae] (length=3188 residues).
ctccacaactttccaacaaactctgcaagatcccagagtgagaggcctgaatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactatcgaggtatgttgcccgtttgtccggt
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggcctttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgtttcaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtaggtcttttgggttttgctgcaccttttacacaatgtgg
ttatcctgctttaatgcccttgtacgcctgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctgggggttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatgggcatggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactct
ctgtaatgtcaacgatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaat
aggttaatgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgc
ctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatcc
gtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatcttctag
ataccgcctcagctctatttcgggacgccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagca
attctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagt
agtcacttatgttaatactaatatgggcattaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaa
gagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccct
atcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctgttttcctaatataca
tttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagactgcaattga
ttatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacat
ctagttaatcattacttccagaccagagattatttacacactctatggaaggcgggtatattatataagagagaaacaac
acatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaat
cctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcc
caacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggcc
ttttggggtggagccctcaggctcagggcatactacaaaccttgcaagcaaatccgcctcctgcttctaccaatcgccag
acgggaaggcagcctacccctctgtctccacctttgagagacactcatcctcaggccgcgcagtggaa
>gnl|hbvnuc|JN040793_FT00000_P-D Feature FT:source JN040793_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919083). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagagacctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttctgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaactctaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcaggttccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtgttccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctcgaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642155_FT00000_P-D Feature FT:source JN642155_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb49). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagctcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgctgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttactgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttacgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaggctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccttgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctc
tgctggggggatctaataactttatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttccgaatattcacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacggtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctggggccatgcagtggaa
>gnl|hbvnuc|GQ183448_FT00000_P-D Feature FT:source GQ183448_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4629). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaatcttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctat
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaccctttcgggctctcctgccgatccatactgaggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaact
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggattctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagaccatatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040769_FT00000_P-D Feature FT:source JN040769_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919015). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatccggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctca
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgcatggcttttagttatatggatgatgtggtattgggggccaagtctgtgcagcatcttgagtcgctttttaccgctgt
tactaactttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcaaacacaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggccttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgcgctcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcatctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtggggggtaacttggaagatccagtatccagagacctagtagtcac
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctaacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcacacctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagattactgttgttagacaacgaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgatcatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcaaggcatactgcaaaccttgccagcaaattcgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707696_FT00000_P-D Feature FT:source JQ707696_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_3). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctacaaaaccttccaccaaactctacaagatcccaaagtgagtggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatagcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcctgcactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgtagttctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttctgcctgctgacttttttccttcagtacgagatcttcttgataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggcccgacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacaatgcaaaccttgccagcaaatccgcctcctgtatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcaccctcaggccatacagtggaa
>gnl|hbvnuc|GQ183468_FT00000_P-D Feature FT:source GQ183468_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4632). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaccatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctat
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacgaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040792_FT00000_P-D Feature FT:source JN040792_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919079). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcagacaaaaaatcaaagaatgttttagacaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacgtcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaaattggaagatccaatatccagggacctagtagtcag
ttatgttaactctaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacaacgaggcaggttccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT579902_FT00000_P-D Feature FT:source MT579902_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Nsk-71957). Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgg
gctatgtcattggctgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctctttttccggtgctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcctatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttcttctgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggccccctcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggatttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707695_FT00000_P-D Feature FT:source JQ707695_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_29). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctacaaaaccttccaccaaactctacaagatcccaaagtgagtggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatagcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcctgcactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgtagttctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagtacgagatcttcttgataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctagtgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacaatgcaaaccttgccagcaaatccgcctcctgtatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcaccctcaggccatacagtggaa
>gnl|hbvnuc|MK598675_FT00000_P-D Feature FT:source MK598675_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg75). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggagagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaactaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaataggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgaaattaatcatgc
ctgctaggttttatccaaaggttaccaaatatttaccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatacaaaaaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggatccaccccaccgcacggaggccttttgg
ggtggagccctcaggctctgggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MW601251_FT00000_P-D Feature FT:source MW601251_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaatctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttcgaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgtgatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccacactgcactcaggcaagcaattcta
tgctggggggaactaatgactctagctacctgggtgggtggtaatttgcaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttccggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcagaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatcctaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
gatggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB104709_FT00000_P-D Feature FT:source AB104709_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG64). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgttcttgccttctgacttctttccttcagtacgagatctactagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatctagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacgggactttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattattaaaaaatgtgagcaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875300_FT00000_P-D Feature FT:source KC875300_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV80). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MW601300_FT00000_P-D Feature FT:source MW601300_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaaatctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccactacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatacggcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggacgatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaagatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacaatcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccaccgttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ336690_FT00000_P-D Feature FT:source DQ336690_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaa
cagcaaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggatggggacccttgcactgaacatggag
aacatcacatcaagactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgggtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatgg
ggtatgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttaccaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgcttgctgatgcaaccccc
actggctggggcttggccatgggccatctgcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggggcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttgtcccacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttataaaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtggggagc
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaacatacatttaca
ccaggacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgaaattgattatgc
ctgcaaggttttatccaaatactaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagtactacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggcttgggttcaccccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594416_FT00000_P-D Feature FT:source EU594416_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcgaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccgtttacacaatgtgg
ttatcctgctctaaagcccttgtatgcctgtattcaagctagacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|X80924_FT00000_P-D Feature FT:source X80924_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate patient 4). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtcaaccctgttccgactactgcctctaccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatatcattggatgtcatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatgttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttcagtacgagatcttctagataccg
ccacagctctatatcgggatgccttagaatctcctgagcattgtacacctcatcatactgcactcaggcaagcaattcta
tgctggggggaactaatgactctagccacctgggtgggtggtaatttgcaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaacaaatgcccctatctta
tcaacacttccggagacttgtgttattagacaacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaacatacatttaca
ccaagacattatcaacaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtatcaaaccttattatccggaacatctagtt
aatcattacttccaaacccgacattatttacacacactatggaaggcgggtatattatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccatcagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcatggaggtcttttgg
ggtggagccctcaggctcagggcatgctacaaaccttgccagcaaatccgcctcctgcctccaccaatcgacagtcagga
aggcagcctacccctctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB104711_FT00000_P-D Feature FT:source AB104711_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG104). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctcaaacctgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtcttgggggccaagtctgtgcagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgtcgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgttcttgccttctgacttctttccttcagtacgagatctactagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatctagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacgggactttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattattaaaaaatgtgagcaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY236164_FT00000_P-D Feature FT:source AY236164_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 30). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaatacc
gcagagtctagactcgtggaggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaatctgcacgactcttgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttctttggtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctccgcaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtcgtgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgaattctatccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactctctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtggggagc
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgaaattgattatgc
ctgctagggtttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcacccaaccgcacggaggtcttttgg
ggtggagccctcaggcttagggcatgctacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594421_FT00000_P-D Feature FT:source EU594421_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacgaccttccaccaaactctacaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctagacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgaacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttatggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700473_FT00000_P-D Feature FT:source HQ700473_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PA31_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacaccwcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
amttccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctkggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtygggggaggagattaggtta
awggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcacctttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaayactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcmagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacmcctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040783_FT00000_P-D Feature FT:source JN040783_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919090). Complete genome. [Hepadnaviridae] (length=3182 residues).
caccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacagttcatgg
gctatatcattggatgttatgggtcattaccacaagatcacatcatacagaaactcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagatta
cagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagccacctgggtgggtggtaatttggaagatccagtatccagggacctagtagttag
ttatgttaacactaatgtgggcctaaaattcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgatgcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
gggggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF584162_FT00000_P-D Feature FT:source KF584162_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1b). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcmcatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctggacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgyacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaacctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagccttcgggctgggattcaccccaccgcacggaggccttttag
grtggagccctcaggctcagggcatactacaaaccttgccagaaaatccgcctcctgcctctaccaatcgccagtcaggg
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggcaatgcagtggaa
>gnl|hbvnuc|GQ922005_FT00000_P-D Feature FT:source GQ922005_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B2894). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacacatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgttgtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcgaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cttgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcactttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttattctcttaatttcatgg
gctatgtcattggttgttggggatcattgccacaagatcacatcatacacaaaatcaaagaatgtttcagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgtattgtgggtcttctggggtttgctgcccctttcacacaatgtgg
ttatcctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggtcaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagcaggtctggagcaaacattatcggcactgacaactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggcccctgtcgtcctcttctctgcctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
atgtcgcatggagaccaccgtgagagcccaccgcagcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggaaattaaatta
aaggtctttgtcctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttttttccttccatacgagatcttctagataccg
ccgcagctctgtttcgggatgccttagagtctcctgagcattgttcagctcaccatactgcaatcaggcaagcagttctt
tgctggggagaactgattggtctagctacctgggtgggcactaatttagaagatcaagcatctagggacctagtagtcag
ttatgtcaacaataatatgggcctaaagttcagacaactattgtggtttcacatttcttgtcttacttttggaagagata
cggtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttaatatcccttggactcacaaggtgggaaat
tttacagggctttattcttctactgtacctgtctttaaccctcagtggaaaacaccttcttttcctaatatacatttaca
ccaagatattattaaaaaatgtgaacagtttgtaggcccgctcacagtcaatgaaaaaagacggttgaaattgattatgc
ctgctaggttttatcccaaggttactaaatacttgcccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacacactatggaaggcgggtgttttatataagagagtatcaacacatag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatcccgattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366493_FT00000_P-D Feature FT:source KT366493_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.41). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcaaaacctgcacgactactgttcaaggaacctctatatatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaccaaaactaaaagatggggttactctttaaatttcatgg
gctatgttattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactcggttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactttatcgtccccttcttcgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcctgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcgtttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataaaagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccacctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT603404_FT00000_P-D Feature FT:source MT603404_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 218). Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatgaag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtccagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtccttgccacaagatcacatcaaacaaaaaatcacagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccggttgggactctatcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccttgaaagttcatcaatgcttgcccaaggtcttacataagagaactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgacttgaacggatatgatgcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagtacgggatcttctagataccg
ccacagctctatatcgggacgccttagagtctcctgaacattgttcacctcaccatacagcactcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtgtgaatttggaagatcaagcatctagggaccaagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacgtttcttgtctcatgtttggaagacaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacaacgaggcaggtcccctagaacaagaactccctcgcctcgcagacgaag
gtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtgcctgtctttaatccacattggaaaacgccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaattcgtaggccctctcacagtcaatgagaaaagaagactaaaattggttatgc
ctgctaggttttatccaaatggtaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggcctgttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
agggagccgactccgctgtcaccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904419_FT00000_P-D Feature FT:source FJ904419_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A70). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgtttcaggcggggtgtttcttgttgacaagaatcctcacaatgcc
gcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtccctttttaccgctgt
ttccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgg
gttatgtcattggatgttggggatccttgccgcaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcccattgattggaaagtgtgtcaacgacttgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgcgttaatgcccttatatgcatgtattcaatctaaacaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttctcggaactgacaattctgtggttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagctattctt
tgctggggggaactactgtctctatctacctgggtgggagtaaatttggacaatcaagcatctagggacctagtagtcgg
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagana
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgaagaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
ttaacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttatcctaaacgtaccaaatatttgcccttggacaagggtatcaaaccctattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatcccgattgggacttcaatcccaacaa
ggacacttggccagatgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggcggccttttgg
ggtggagccctcaggctcagggcataattcaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456640_FT00000_P-D Feature FT:source GU456640_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T12). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcccattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtattcagtcaaagcaggcttttaccttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagatgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttccgacttctttccttcagtacgagatcttctagataccg
cctcagctttgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatacta
tgctggggggaactgatgactctagctacctgggtgggtggtaatttggacgatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttagtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtataccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatacaagagagaaactacacatag
cgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccaattggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
gatggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875279_FT00000_P-D Feature FT:source KC875279_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV11). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccgccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccattcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcgggggcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaacgttttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccgtttgg
ggtggagccctcaggctcagggcataatacaaaccttgcgagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcagaccatgcagtggaa
>gnl|hbvnuc|GU456635_FT00000_P-D Feature FT:source GU456635_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T26). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaagcctttatcttcctgctggtggctccagttcaggaa
cagtaacccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctaacaaaacgaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatgggtctttgccacaagatcacatcttacagaaaatcagagattgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
gtatcctgctttaatgcccttgtatgcctgtattcaatccaagcaggcttttactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtaatgggccatcagcgcatgcgtggaaccttttgggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactcggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggacgccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcatttctt
tgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagggagctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattattaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaacgaagattgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacatcacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggctcactacaaaccttaccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642145_FT00000_P-D Feature FT:source JN642145_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb36). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacactgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctggtcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcaaacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcctgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattcta
tgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagacccagtatccagggacctggtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtcgccatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaacccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JX096954_FT00000_P-D Feature FT:source JX096954_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1-3242). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattaccacaagatcacatcatacagaaaatcaaagaatgttttcgaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccttctcggggccgcttgggcctctatcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtcctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagtagttag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttatggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggatttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagcccccaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904424_FT00000_P-D Feature FT:source FJ904424_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A79a). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgacacctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaattaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaggtctgtcaacgtattgtgggtcttctgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aagatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcggctctatttcgggaagccttagagtctcctgagcattgttcwcctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcacccctccagcttatagaccabtaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggacac
tttacggggttttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataggagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgatcaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257205_FT00000_P-D Feature FT:source JN257205_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRYD). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaacaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttctgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcaaacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacgtcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcctgcccaaggtcttacataagaggactcttggactctctgtaa
tatcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaatagatta
atggtttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattcta
tgctggggggaactaatgactctagctacttgggtgggtggtaatttggacgacccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cagtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctagattctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtggatcaccatattcttgggaacaagagctacggcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaacccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctacctctaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT114172_FT00000_P-D Feature FT:source MT114172_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 197). Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttactggcggggtttttctcgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gatatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccgtttacacaatgtgg
gtatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagattgggaggagttgggggaggagattagatta
aaggtcattgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgacatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtcggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataaggggattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagaagccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774462_FT00000_P-D Feature FT:source KC774462_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dxa2047). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gttatgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttctgggttttgccgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgccaaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aatgtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcccaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaatgttaccaaatatttgcctttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaagggcggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgtcaaggc
atggggacgaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggatttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC875314_FT00000_P-D Feature FT:source KC875314_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV2). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgcgctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcgctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcggagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttcctccagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaaatctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaatgaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaacgttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcagggcatgcagtggaa
>gnl|hbvnuc|MK507912_FT00000_P-D Feature FT:source MK507912_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 012/14/0562). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggatggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttggggatctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagaccttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacttagtagtcag
ttatgtcaacactaatatgggcctaaagttccggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagtaatagaatatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaacgaagattgcaattgattatgc
cttctaggttttatccaaatgttactaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagccttcgggctgggtttcaccccaccgcacggaggccttttag
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AM422939_FT00000_P-D Feature FT:source AM422939_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate X28). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctcaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgaggtcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagggaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaaccctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ927384_FT00000_P-D Feature FT:source JQ927384_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KM2109). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccactaccttccaacaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggatattctctacatttcatgg
gttatgtcattggatgttggggatcattgccacaagatcatatcgtccacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaagcgggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacgtgcttgggactgacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcgaggccgcttgggactctaccgtcccctkctacgcctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaatagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttcrgcacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcactgttcacctcaccatactacactcaggcaagccattctt
tgctggggggaacttatgaatctagctacctgggtgggtgcaaatttgcaagatcaagcatctagggatctagtagtcaa
ttatgtcaacactaatatgggcctaaagtttagacaactattgtggtttcacacttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccatcaaatgcccctatctta
tcaacacttccggagacttgtgttrttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttgatattccttggactcataaggtgggaaat
tttacggggctttattctactactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcgacaaatgtgaacaatttgtaggcccgctaacagtcaatgaaaaaagaaggctgaaattgattatgc
ctgctaggttttttccaaagtgtaccaaatatttgcccttggacaagggtattaaaccgtattatccggaacatctagtt
aatcattactttcaaactagacactatttacacactctatggaaggcgggtattttatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattccttcccgatcaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcattctacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagagayactcaycctcaggccatacaktggaa
>gnl|hbvnuc|KF584161_FT00000_P-D Feature FT:source KF584161_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1a). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctggacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacraratcttctarataccg
cctcagctctgtatcgggaagccttaragtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgyacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaacctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagccttcgggctgggattcaccccaccgcacggaggccttttag
grtggagccctcaggctcagggcatactacaaaccttgccagaaaatccgcctcctgcctctaccaatcgccagtcaggg
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggcaatgcagtggaa
>gnl|hbvnuc|AB078032_FT00000_P-D Feature FT:source AB078032_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AH1-SY). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatccaagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctggcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcgctacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggacaccaaatatttgccattagattagagtatttaaacttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatcttatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaaccctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaactcagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagccgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttcccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JF754632_FT00000_P-D Feature FT:source JF754632_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK186). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcatcaatcttcttgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
aattccaggatcctcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccatcttgagtccctttataccgctgt
taccaattttcttgtgtctttgggtatacatttaaatcctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaggttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttcgaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgtacctctctttacgcggactccccgtctgtgccttcacatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagactagactg
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccctgcgactttttcacctctgcctaatc
accttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccgtataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagtacgtgatcttctagataccg
ccacagctctgtatcgggacgccttagagtctcctgagcattgtacaccgcaccatactgcactcaggcaagcaattcta
tgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagattcaacatccagggacctagtagtcag
ttatgtcaacactaatatgggccttaagttccggcaactattgtggtttcacatttcttgtctcatgtttggaagagata
tagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccagcaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacgcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaccaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattagttatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtatcaaaccttattacccagaacatctagtt
aatcattacttccaaaccagacattatctacacactctatggaaggcgggtatcttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggtcttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgtcagtcagga
aggcagcctaccccgctgtctccgcctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598641_FT00000_P-D Feature FT:source MK598641_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg26). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtgtctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccagaatcttcaaccaccagcacgggaccttgcagaacatgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtttgtcaacgtattgtgggtcttttgggttttgccgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcacggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctatga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctaacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccactggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatcggcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY796030_FT00000_P-D Feature FT:source AY796030_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FC1.9). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctgacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttcgaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
ccgtcgcatggagaccaccgtgaacgcccaccgagtcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcagttctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttccggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtatcaaaccttattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacccatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456665_FT00000_P-D Feature FT:source GU456665_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T76). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatctcctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctggtcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactggtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaaatctgtgcaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaagaagatgggggtactctttacagttcatgg
gctatgtcattggaggttatggttcattgccacaagatcacatcagacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
gtatcctgctttaaagcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcctgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaatcattgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
atgatctttgtagtaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggcgcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaatttta
tgctggggggagctaataactctaagcacctgggtgggtggtaatttggaagatccaacatccagagagctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcactttcggaagagaaa
cagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggcattaaaccctattatccagaacatctagtt
aatcattacttccaagccagacattatttacacactctatggaaggcaggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcaaggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctactccactgtctccacctctgagagacactcatcctcaggctatgcagtggac
>gnl|hbvnuc|JF754621_FT00000_P-D Feature FT:source JF754621_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK161). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaagtctgcaagatcccagggtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactastgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
gaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtccttgccacaagatcatatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggtttcgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctaggcaacgaccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
cagatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctgtttcgggatgccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgctaatttgcaagatccagcatctagggaccaagtagtcag
ctatgttaacactaatatgggcctaaagttcaggcaactattgtggttccacgtttcttgtctcacttttggaagagaaa
cagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaagtgggtaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctactatacatttaca
ccaagacattatcaaaaagtgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccggaacatttagtt
aatcattacttccacgccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaagctcagggcataatgcaaaccctgccagcaaatccgcctcctgcatctaccactcgccagtcagga
agacagcctacaccactgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642143_FT00000_P-D Feature FT:source JN642143_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb33). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtccttaccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattgtcgggacggacaactcggttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctcacgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctccgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctgatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagcactgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctgaagttcagacaaatattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttcttctgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactacaattaattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattagataagggtattaaaccctactatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctactccgctgtctccacctttgagagaaactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK052973_FT00000_P-D Feature FT:source MK052973_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137Q-14). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcaacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtctc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtccact
aattccaggatcatcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaagatggggttactctcttaatttcatgg
gatatgtcattggatgttatggttcattgccacaagaacacatcatacacaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtgtgtcagcgaattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgcaaacaatacatgagcccttaccccgttgctcggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgataactctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ccgaatccggcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcaatacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcaatcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggcactaatttggaagatccagcatctagggacctaatagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagata
cggtcttaaattatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaggttactgttgttagaggacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattacaattgattacgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacattctttggaaggcaggtgtattatataagagagaaacaactcatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcgaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggccggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccactcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK516278_FT00000_P-D Feature FT:source MK516278_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HEP-108). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccttgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaataggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctctaatgcccttgtatgcctgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcctgcccaaggtcttacataagaggactcttggactctctataa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacatgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtttctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattttttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700451_FT00000_P-D Feature FT:source HQ700451_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GI11_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgcgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccacctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ833467_FT00000_P-D Feature FT:source HQ833467_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB27). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagaatctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaycaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttctkttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgccgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacgtcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgyaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
atgatttttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagccattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttcggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggatccgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaactccctcttttcctaatatacacttaca
ccaagacattatcaacaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgccagtcagga
aggcaacctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN688713_FT00000_P-D Feature FT:source JN688713_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV173). Complete genome. [Hepadnaviridae] (length=3185 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggawgttatgggtccttaccacaaccgcacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggtttcgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctcgcagcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgc
atcatgtcgaatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactctkggactctctg
caatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtaga
ttaatgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccattcaactttttcacctctgccta
atcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgaccctta
taaagaatttggagctaccgtggagttactctcgtttttgcctrctgacttctttcctwccgtacgagatcttctagata
ccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaatt
ctgtgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatcaatcctctagagacctagtagt
cagttacgtcaacaataatatgggcmtaaagttcaggcaactcttgtggtttcacatttcttgtcttacttttggaagag
aagtagtaatagagtatttggtgtyttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatc
ctatcaacacttccggagactactgttgttagacgagaaggcaggtcccctagaagaagaactccctcgcctagcagacg
aaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggg
aactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacattt
acatcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaagaagattgcaattgatta
tgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatcta
gttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatatcagagagaaacaacaca
tagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcct
ctgggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaatccagattgggacttcaatcccaa
caaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccgccgcacggaggccttt
tggggtggagccctcaggctcagggcatactgcaaactttgccagcaaatccacctcctgcctccaccaatcgccagtca
ggaaggcagccgaccccgctatctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM524354_FT00000_P-D Feature FT:source KM524354_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-058_HIV-HBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttattctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgcacctttaccccgttgcccggcaacggcaaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
acacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagttaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcgtatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggcaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctgatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttatgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccaacaaatccacctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaaaactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366496_FT00000_P-D Feature FT:source KT366496_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.46). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgacaactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749827_FT00000_P-D Feature FT:source KT749827_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FL14). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagggtgagaggcctatattcccctgctggtggctccagttcaggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtttgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttctcctggactatcaaggtatgttgcccgtctgtcctct
gattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtctgttgggttttgctgccccttttactcaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcgcggggccgcttgggactctttcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcattcctt
tgctggggggaattaatgactctagctacctgggtgggtactaatttggaagatcaagcatctagggacttagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaagtgggtaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggaccactaacaacaaatgagaaacgaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccggaacatttagtt
aatcattacttccaaaccagacattatttacacactctgtggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccatcagctggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggatacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataacgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcgggg
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JF754614_FT00000_P-D Feature FT:source JF754614_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK6). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaraggcctgtattcccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgaatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aagatctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcgtgtctcacttttggaagagata
cggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaacaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcacaccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040766_FT00000_P-D Feature FT:source JN040766_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919046). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcgcatatcgtcaatcttctcgaggattggggaccctgctctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcgaggtatgttgcccgtttgtcctct
acttccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgttcctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacgttatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcaaccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgt
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgccaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
agctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatagatccttataa
agaatttggcgcttctgtggagttactctcgtttttgcctggtgacttctttccttccgtacgcgatcttctagataccg
cctcagctctgtatcgggaagccttagagtctccggagcattgtactcctcatcatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaacttggaagatccgacatccagagacctagtagtcac
ttatgttaacactaatatgggcataaaattcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgcctcgtcgcagaagatctcaatctagggaagctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataggagagaaactacacacag
cgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU736924_FT00000_P-D Feature FT:source KU736924_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Sudan_14). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggytttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaagactaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtctattgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaaaattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctgaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtaatagagtacttggtttctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttactaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagaygccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594432_FT00000_P-D Feature FT:source EU594432_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccactaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatattcatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcgattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257188_FT00000_P-D Feature FT:source JN257188_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMLL2). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgaatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggwccctgcactgaacatggag
aacatcacatcaggrttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaycatgcagaacctgcacgactcctgctcaaggaacctctatgtmtccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcaggcagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccattacttcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatytttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgayccktataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagartctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcmtagagtatttggtgtctttcggagtgtggattcgcactcccccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaakgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggaatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaacaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggcygggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacmwaccktgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacmccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366494_FT00000_P-D Feature FT:source KT366494_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.42). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggggccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcacgtttgtcctct
aattccaggatcttcaaccaccagcgaggaaccatgcagaacctgcacgactactgttcaaggaatctctctacagccct
cctgttgctgtaccaaacgttcggaaggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatattgcggaact
cctggccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaacatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700512_FT00000_P-D Feature FT:source HQ700512_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_182089_2001). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggttgttatgggtcgttaccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtatacaatctcggcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcctcttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagrtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaggatccagcatctagggacctagtagtcag
ctatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagacctccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaacaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctagattttatccaaatgttaccaaatatttgcccttagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggtcttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707476_FT00000_P-D Feature FT:source JQ707476_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggatttcaatcccaacaa
ggacccctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX196235_FT00000_P-D Feature FT:source KX196235_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0120). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttaccggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttattgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactattgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagttgactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttacccccttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttctttcagtacgagatcttctagataccg
ccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaacctcattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccaaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcagatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ304550_FT00000_P-D Feature FT:source DQ304550_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatcttcctgctggtggctccagttcaagaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaacaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagaatagatta
atgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcatctctgccgaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcctttttgccttctgacttctttccgtcggtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgaacattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactttagccacctgggtgggaggtaatttgcaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgtcagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccacgaagtggaa
>gnl|hbvnuc|JN040777_FT00000_P-D Feature FT:source JN040777_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919017). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaaacacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacgaaaagatggggctactctttacatttcatgg
gctatgtcattggatgtgatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gtcaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaatattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccatttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcctactattcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatctactagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcac
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtggggaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaagatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttacaaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgccgctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875288_FT00000_P-D Feature FT:source KC875288_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV56). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttaccggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgctacaaaccttgccagcagatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ336677_FT00000_P-D Feature FT:source DQ336677_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatgg
ggtatgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagtacgagatcttctagataccg
cctcagctctgtttcgggacgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtggggagc
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KP322600_FT00000_P-D Feature FT:source KP322600_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H2812). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatattacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU736926_FT00000_P-D Feature FT:source KU736926_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Sudan_18). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttkcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcycatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccccaacaaaacaaagagatggggctactctctaaatttcatgg
gctatgtcattggatgttatgggtcactgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgcgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgtaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagcggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttrgagtctyctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcractcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagaatatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtttttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggcygggattcaccccaccacacggaggccttytgg
ggtggagccctcaggctcagggcatactacaatccctgccaacaaatccgcctccggcctctaccaaycgccagtcagga
aggcagcctaccccgctgtctccacctttgagaracactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB205126_FT00000_P-D Feature FT:source AB205126_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-IF714-1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggagcctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ562338_FT00000_P-D Feature FT:source FJ562338_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I192). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccytgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgacttctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttactgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgctttggaaaacttcct
gttaacaggcctattgattgggaagtctgtcaacgaattgtggggcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccctgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggaccgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcgaggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgtacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacctaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcgtttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagtaaatgagaaaagaagattgcagttgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgaaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggcctgttgg
ggtggagccctcaggctcagggcatattacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183462_FT00000_P-D Feature FT:source GQ183462_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4567). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctat
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700510_FT00000_P-D Feature FT:source HQ700510_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_128225_2003). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggttgttatgggtcgttaccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccgattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtatacaatctcggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcctcttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcgtgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcaatacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacatcaccatactgcamtcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaggatccagcatctagggagctagtagtcag
ctatgtcaacaytaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagacctccaaatgcccctatctta
tcaacacttccggagactactgttgttagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaacaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctagattttatccaaatgttaccaaatatttgcccttagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaycaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggtcttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagacagga
aggcagcctacaccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JF754634_FT00000_P-D Feature FT:source JF754634_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK12). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatccaagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatrcc
gaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttacatttcatgg
gttatgtcattggaagttatgggtcattgccacaagatcacatcaaacagaaaatcaaagattgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctmcgtctgccgtttcgaccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggattgggaggagttgggggaggagactagatta
atgatttttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggatattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctactgacttctatccttcagtacgagatcttctagatactg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcagctcatcatactgcactcaggcaagcaattctt
tgctggggggacctaatgaatctagccacctgggtgggtggtaacttggaagatccagtatccagggacctagtagtcag
ttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcgtagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaaaacattatcgaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattactttcaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacttggccagatgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcccactcctctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM606744_FT00000_P-D Feature FT:source KM606744_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba9). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcatcaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaagagatggggttattctcttaatttcatgg
gctatgtcattggttgttggggatcattgccacaaaatcacatcatacacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaaacaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgtcctctcccgcaaat
atacatcattcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttgggaccctctcgtcctcttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtgcgagatcttctagataccg
ccgcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgactctagctacctgggtgggtactaatttagaggatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatctaca
ccaagatattatcaaaaaatgtgaacagtttgtaggcccgctcacagttaatgagaaaagacggttgaaattgattatgc
ctgctaggttttatcctaatgttaccaaatacttgcccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagagagtatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642135_FT00000_P-D Feature FT:source JN642135_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb24). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgttcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcaatggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgccgttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tatataaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagaccgtttgtttaaggactgggaggagttgggggaggagcttagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctgatc
atctcttgttcatgtcctactgttcaagcctccaagttgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgtgcagttactctcgtttttgccttctgacttttttccttccgtacgagatcttctagataccg
cctcagctctatatcgggacgccttagagtctcctgagcattgtacatatcatcatactgcactcaggcaagcaattcta
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggacgatccaacatccagggacctagtagtcag
ttatgtcaataataatatgggcctaaaattcaggcaactattgtggtttcacatttcttgtctcacttttggaagagcaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacaacaacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttcttctgttcctgtctttaatcctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
gatggagccctcaggctcagggcacactacagaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcaacctacccctctgactccacctttgagaatcactcatcctcacaccatgcagtggaa
>gnl|hbvnuc|KC875275_FT00000_P-D Feature FT:source KC875275_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV39). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctgctggctccagttcaggaa
cagtcaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgctagtcggga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX196219_FT00000_P-D Feature FT:source KX196219_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0104). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtacaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggac
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcattaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtcggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggactcctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875323_FT00000_P-D Feature FT:source KC875323_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV53). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaatccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagacaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatccta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccaaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcagatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM524344_FT00000_P-D Feature FT:source KM524344_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK070_EP-CHB). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aaaatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcaaaacctgcacgactcctgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gatatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtcctctg
ttgtgtcaaccctaatatgggcctaacgttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttattgaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagatatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcatttaattatgc
ctgctaagttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
agatacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN507839_FT00000_P-D Feature FT:source MN507839_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1976_ocHBVd_GC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactcccttgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagatatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcatttaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaagataggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040770_FT00000_P-D Feature FT:source JN040770_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919087). Complete genome. [Hepadnaviridae] (length=3182 residues).
cttcacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcctcttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagttcgagatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgttcagctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctaacttttggaagagaaa
cggtcttagagtatttggtatctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcggtctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257176_FT00000_P-D Feature FT:source JN257176_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFRJ1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctmcacaaccttccaccaaactctgcaagatcccagagtgagaggcctgwmtttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacayatcgtcaatcttctcgaggattggggaccytgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccracttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcraggtatgttgcccgtttgtcctcw
amttccarrmtcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccay
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacmgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttwtgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttccy
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcmtgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgcgtaaacaatacctgracctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttygrctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccatgtcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaattgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcmcctctgcctaktc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtgcagttactctcgtttttgccgyctgacttctttccttcagtacgagatcttctagataccg
cctcggctctrtttcgggaacccttagagtctactgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgamtctagccacctgggtgggtggtaatttgsaagatccaacatccagggacctagtagtcac
ttatgttaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacgtgaatgttagtattccttggactcataaggtgggatcc
tttacggggttttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctmatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggyatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacakcatgggtcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacamctggccagacgccaacaaggtaggagctggagcattcgggcygggaytcaccccaccgcacggaggccttttgg
ggwggagccctcaggctcagggcatactacamaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaracactcatcctcaggcyatgcagtggaa
>gnl|hbvnuc|MK598655_FT00000_P-D Feature FT:source MK598655_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg39). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacattccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcagatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaatttcatgg
gctatgtcattggatgttatgggtcattaccacaagaacacattacacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggccttttgggttttgctgcaccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttataggccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgcctttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacag
ggacgccttgccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggacttttgg
gctggagccctcaggctcagtgcataatacaaactttgccagcaaatccgcctcctgccttcatcaatcgtcagtcagga
aggcaggccaccccgctgtctccacctttgcgagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700479_FT00000_P-D Feature FT:source HQ700479_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_RA11_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattcttgggacggataactctgttgttctctcccgaaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacgggactttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366509_FT00000_P-D Feature FT:source KT366509_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.26). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttccactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT603396_FT00000_P-D Feature FT:source MT603396_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 101161-498572). Complete genome. [Riboviria] (length=3182 residues).
ctccamaaycttccaccaaactctgcaagatcccagagtgagaggcctgtattyccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggam
aacatcacatcaggattcctargacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggraactaccgtgtgtcktggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgttyctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
tacyaattttcttttgtctttgggtgtacatttaaaccctmacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtccttgccacaagatcacatcaaacagaaaatcacagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccggttrggactctctcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcatcgattcttgcccaaggtcttacataagagractcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagamtgggaggatttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggacgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggamctaatgactctagctacctgggtgggtgtgaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagaatatttggtgtctttcggagtgtggattcgcactcctcmwkcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctyttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaattcgtaggccctctcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgwctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY721611_FT00000_P-D Feature FT:source AY721611_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SK1.7). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccgcaaccttccacgaaactctgcaagatcccagagtgagaagcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaataggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttatccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatctactagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccagtatccagggacctaatagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtcgttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattgtcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaaggagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtatcaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggcctgttgg
gatggagccctcaggctcagggcatgctacacaccgtgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EF103280_FT00000_P-D Feature FT:source EF103280_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ran100). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtggccctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gttatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gtcaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaggttcttgctgacgcaaccccc
actggctggagcatggtcataggccatcagcgcatgcgtggaacttttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgcgacggataactctgttgttctctcccggaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ccgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaga
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttacccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggaccattccaggtgggattcaccccaccgcacggaggccttttgg
gggggagccctcaggctcagggcatactacaaaccttgccaacgaatcatcctcctgcctctaccagtcgtcactcagga
agggagccgacccctctgtctccacctttgagagacactcctgctctggccatgcagtgaaa
>gnl|hbvnuc|JN040785_FT00000_P-D Feature FT:source JN040785_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919022). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcaccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgcggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaacaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagagcatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaacctgccagaaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875322_FT00000_P-D Feature FT:source KC875322_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV54). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaatccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagacaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatccta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattactttcaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccaaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcagatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875334_FT00000_P-D Feature FT:source KC875334_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV47). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcgagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgcacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagacaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttacccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataccacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MF618342_FT00000_P-D Feature FT:source MF618342_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV053). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataagacgaaaagatggggttattctctacacttcatgg
gttatgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaa
tgtcaacgaccgatcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgactttcgctacctgggtgggtactaatttggaagatccagcatctagggacctagtggtcag
ttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttttggagtatttggtgtctttcggagtgtggattcgcactccgccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcccaatatacatttaca
ccaagacatcatcaacaaatgtggacagtttgtaggccctcttactgtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatccagaacatctagtt
aatcattactttcaaaccagacactatttacacactctatggaaagcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggac
>gnl|hbvnuc|GQ477459_FT00000_P-D Feature FT:source GQ477459_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P127). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcaaacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggtttcgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagactgcaattgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggaatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagccttcgggctgggattcaccccaccgcacggaggccttttag
ggtggagccctcaggctcagggcatactacaaaccttgccagaaaatccgcctcctgcctctaccaatcgccagtcaggg
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707705_FT00000_P-D Feature FT:source JQ707705_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_7). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctacaaaaccttccaccaaactctacaagatcccaaagtgagtggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatagcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcctgcactcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgtagttctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagtacgagatcttcttgataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaagctcagggcacaatgcaaaccttgccagcaaatccgcctcctgtatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcaccctcaggccatacagtggaa
>gnl|hbvnuc|KT366507_FT00000_P-D Feature FT:source KT366507_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.24). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctatcacttatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
agcatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctctgaattttatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcagagaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcccattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
tctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagcggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagctattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaagacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ336686_FT00000_P-D Feature FT:source DQ336686_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgctcgcggcgttttatcatc
ttcctcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagcacgggaccatgccggacctgcacgactcttgctcaaggaacctctatgtatcctt
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattctttaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaaccgccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aagggctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttccgtggagctactctcgtttttgccttctgacttctatccttcagtacgagatcttctagataccg
cctcagctctgtttcgggacgccttagagtcttccgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttgggctcataaggtggggagc
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257185_FT00000_P-D Feature FT:source JN257185_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHZYD). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcacgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccatgtcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttacaaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM606755_FT00000_P-D Feature FT:source KM606755_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba139). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttcccacaaactctgcaagatcccagagtgagaggcctgtatgtccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcatcaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggaacctctatgaatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctaacaaaacaaagagatggggttattctcttaatttcatgg
gctatgtcattggttgttggggatccttgccacaagatcacatcatacacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaaacaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgtcctctcccgcaaat
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtctcttgggaccctgtcgtcctcgtctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atatgttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtgcgagatcttctagataccg
ccgcagctctgtatcgggatgccttagagtcttctgagcattgttcacctcaccatacagcactcaggcaagcaattctt
tgctggggagacctaatgactctagctacctgggtgggtactaatttggaagatccgacatctagggacctagtagtcag
ttatgtcaacactaatgcgggcctaaagttcagacaactattgtggtttcacatttcttgtcttacatttggaagagaaa
cggtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatgtcgggaatctcaaggttagtatcccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatctaca
ccaagatattatcaaaaaatgtgaacagtttgtacgcccgctcacagttaatgagaaaagacggttgaaattgattatgc
ctgctaggttttatcctaattttaccaaatacttgcccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagagagtttcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagaaacactcatcctcatgcaatgcagtggaa
>gnl|hbvnuc|HQ700553_FT00000_P-D Feature FT:source HQ700553_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PE09_1999). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcstggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaaacaactctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggctgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtctcttgggttttgctgccccttttacacaatgtgg
gtatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcagctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttattagacaacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatgtagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccrcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707513_FT00000_P-D Feature FT:source JQ707513_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C11). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggattgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttctctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttcttgataccg
cttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM524355_FT00000_P-D Feature FT:source KM524355_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-092_HIV-HBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttatatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcatacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacgaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacgggactttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcattgaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagaatacaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagaggccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttag
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904399_FT00000_P-D Feature FT:source FJ904399_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A18). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggttcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcacatattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtatttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagtacgagatgttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacatcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctcaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagaatatttggtgtctttcggagtgtggattcgcactcctccagcatatagaccatcaaatgcccctatctta
tcaacacttccggagacttctgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagwcgaag
gtstcaatcgscgcgtcgcagaagatctcaatctcgggaatctcaatgtaagtattccttggactcataaggtgggaaac
cttacggggctttattcttmtactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacatggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875291_FT00000_P-D Feature FT:source KC875291_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV58). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcaccttctcgccaccttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatccgcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgacgcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtgaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaatcttattatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366465_FT00000_P-D Feature FT:source KT366465_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.49). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggga
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaagatcttcaaccaccagcgtgggaccatgcaaaacctgcatgactactgttcaaggaacctctatgtatccct
actgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttccactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatcttatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcagtctcagggcataatacaaacctcgccagcaaatccgcctcctgcatctaccaatcgtcagtcagga
aggcatcctaccccactgtctccacctttgagaaactctcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT603403_FT00000_P-D Feature FT:source MT603403_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 5180). Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtccttgccacaagatcacatcaaacagaaaatcacagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcatcgattcttgcccaaggtcttacataagagaactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggacgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaattcgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaakgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MW601269_FT00000_P-D Feature FT:source MW601269_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctg
tgctggggggacttaatgtctctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcaggccgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatagtacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagttaaga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MW601308_FT00000_P-D Feature FT:source MW601308_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctctaaattttatgg
gttatgtcattggatgttatggatcattgccacaggaacacatcatacaaaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggccttttgggttttgctgcaccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtaccgaccgacgac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttttatccttcagtacgagatcttctagataccg
cctcagctctgtgtcgggatgccttagagtctcctgaacatgtttcacctcaccatactgcactcaggcaagctattctt
tgctggggggaactaatgactctagctacctgggtgggcggtaatttggaagatcaagcatctagggacctagtagtcgg
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacctttcttgtctcacttttggaagagata
cagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaacaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatccaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaagttactaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctctccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtcgccacctttgcgaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183470_FT00000_P-D Feature FT:source GQ183470_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4639). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgactggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
gtatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtggcaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactccgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagtacgagatcttctagataccg
cctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttcggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcaacctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875295_FT00000_P-D Feature FT:source KC875295_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV81). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttggggacctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgctacaaaccttgccagcagatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK693108_FT00000_P-D Feature FT:source MK693108_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ahvaz29). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctgt
aattccaggatcttcaaccaccagcacgggaccatgccggacctgcacgaatcctggtcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgaagtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcattcagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgttcccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctccttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaggccaccgtgaacgcccaccaattcttgcccaaggtctcacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtttgttaaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttctcctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacctttgggagagaaa
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagaactacagcatggggcagaatcttttcaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JF754612_FT00000_P-D Feature FT:source JF754612_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK148). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccaccttgagtccctttacaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactccttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaggaatgttttcgaaaacttcct
gtcaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttaggatttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaaacatttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggcgcttctgtggagttactctcttttttgccttctgacttctttcctgcagtacgagatcttctagataccg
ccaccgctctatatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacttagtagtcag
ttatgttaacactaatatgggcataaagttcagacaactattgtggtttcacatttcttgtctcatgtttggaagagata
cggtcgtagagtttttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttgtgttattagacaacgaagcaggacctctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagacgatctcaatctcgggactctcaatgttagtattccctggactcacaaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaactctcattggaaaacaccctcttttcctaatatacatttaca
tgaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgaaattgattatgc
ctgctaggttttatccaaaggctaccaaatatttgccattggacaagggtattaaaccgtattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatatagaagagaaaccacacatag
cgcctcattctgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccaacaaatccgcctcctgcttctaccaatcgccagtcggga
aggcagcctacccctctgtctccacctttgagagacacccatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707704_FT00000_P-D Feature FT:source JQ707704_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_5). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctacaaaaccttccaccaaactctacaagatcccaaagtgagtggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatagcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcctgcactcactctaagcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgtagttctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagtacgagatcttcttgataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtttcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacaatgcaaaccttgccagcaaatccgcctcctgtatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcaccctcaggccatacagtggaa
>gnl|hbvnuc|KM524356_FT00000_P-D Feature FT:source KM524356_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-123_HIV-HBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacattacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctttatgtttccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctgaattttatgg
gctatgtcattggatgttatggatcattgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttaccctgctttaatgcctttatatgcatgtattcaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggagct
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtgcagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctttgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttacaaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccaaacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700442_FT00000_P-D Feature FT:source HQ700442_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN12_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacataatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagacccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccacctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN688711_FT00000_P-D Feature FT:source JN688711_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV161). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagactgataggcctggatgtctctgctggaggctcaagttcaggaa
cagtaaaccctgttcccactacagcgtctcccttatcgtcgatcgtctcgaggattgtgaaccctgcgatgaacatggag
aacttccaatcaggattcctaggaccccttctcgtgttacaggcggggttttttttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagcgatggggttactctctaaattttatgg
gatatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgtttccgaaaacttcct
attaataggcctattgattggaaagtgtgtcagcgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctttacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtttgcgcaccagtaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactctagagttactttcttttttgccktctgacttctwtccttcggtacgagatcttctagataccg
cctcagctctgtrtcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattttt
tgctggggggaamtaatgactctagctacctgggtgggtgbtaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtcttacttttggaagagaaa
cagttgtagagtatttggtgtttttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccgtagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacacttaca
ccaagatattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccactggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccatcagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtytcaccccaccgcatggaggcctgttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366508_FT00000_P-D Feature FT:source KT366508_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.25). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gttatatcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagattgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatacatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaccaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatgtctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaaatgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaacttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257177_FT00000_P-D Feature FT:source JN257177_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFRJ2). Complete genome. [Hepadnaviridae] (length=3185 residues).
ctmcacaaccttccaccaaactctgcaagatcccagagtgagaggcctgwmtttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacayatcgtcaatcttctcgaggattggggaccytgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccracttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcraggtatgttgcccgtttgtcctcw
amttccarrmtcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccay
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacmgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttwtgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttccy
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcmtgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgcgtaaacaatacctgracctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttygrctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccatgtcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaattgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcmcctctgcctaktc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtgcagttactctcgtttttgccgyctgacttctttccttcagtacgagatcttctagataccg
cctcggctctrtttcgggaacccttagagtctactgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgamtctagccacctgggtgggtggtaatttgsaagatccaacatccagggacctagtagtcac
ttatgttaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacaacatcaatgttagtattccttggactcataaggtggga
tcctttacggggttttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctmatatacattt
acaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgatta
tgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatcta
gttaatcattacttccaaaccagacattatttacacactctatggaaggcgggyatattatataagagagaaacaacaca
tagcgcctcattttgtggatcaccatattcttgggaacaagagctacakcatgggtcagaatctttccaccagcaatcct
ctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaa
caaggacamctggccagacgccaacaaggtaggagctggagcattcgggcygggaytcaccccaccgcacggaggccttt
tggggwggagccctcaggctcagggcatactacamaccttgccagcaaatccgcctcctgcctctaccaatcgccagtca
ggaaggcagcctacccctctgtctccacctttgagaracactcatcctcaggcyatgcagtggaa
>gnl|hbvnuc|KM524338_FT00000_P-D Feature FT:source KM524338_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV136_EP-CHB). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggtccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttgttgttgcttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactcctgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatggatcattgccacaagagcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcatttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctcttctccgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactttctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atcacttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccagtatcccgggacctagtagtcag
ttatgttaacactactgcgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctgatatacacttaca
ccaagacattattaaaagatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgaaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgatcaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcagggaggccttttgg
ggtggaaccctggagctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagccgaccccgctgactccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK618426_FT00000_P-D Feature FT:source MK618426_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh3). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcacgaa
cagtaaatcctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacacagtgtgg
ttatcctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccgccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaga
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggacacataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtagggccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctggtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccaccaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456649_FT00000_P-D Feature FT:source GU456649_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T57). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactggtggtggacttctctcaattttttagggggaacccccgtgtgtcttggccaaaattcgcagtccc
caacttccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctatttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagtacgagatcttctagataccg
cctcagctttgtatcgggaagccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggatctaataactctaagtacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggcccagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagtctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598663_FT00000_P-D Feature FT:source MK598663_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg31). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgtttcaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttctctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaataccaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacatactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagcgggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcaaggcatactacaaaccttgccagcaaatccgcctcctgcttccaccaatcgccagtcagga
aggcagcctaccccgttgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN310714_FT00000_P-D Feature FT:source MN310714_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BG_99_2010). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggggtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctctaaattttatgg
gctatgtcattggatgttatgggtccttgccgcaagaacacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgactggaaagtttgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcccgcgttaatgcctttgtatgcctgtattcaagctaaacaggctttcaccttttcgccaacttacaaggcctttt
tgtgtcaacaatccctgaacctttaccccgttgcccggcaacggccaggtctgcgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatccgcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
tctagccgcttgttttgttcgcaggaggtctggagcaaactttgatgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcctaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaaytttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaacatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcrcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgcgaacagtttgtaggcccactcacagttaatgaaaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcttcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccamtcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040774_FT00000_P-D Feature FT:source JN040774_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919088). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggcgaagtctgttcagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaaccaaaagatggggttactctttacacttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcacacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aagttgtttgttttaggaggctgtaggcataaattggtctgcgcaccagcaccatgcatctttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcttttttgcctactgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgtacgcctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggcaatttggacgatcccacatctagggacctagtagtcag
ttatgttaacactcatatgggcctaaagttcagacagctattgtggtttcacgtttcttgtctcacttttggaagagata
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccatcaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtggggaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagatgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcaacctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774437_FT00000_P-D Feature FT:source KC774437_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1009). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcacgtatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggatccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctgaattttatgg
gttatgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgcgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgctttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttatggtttcatatttcttgcctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaac
tttacgggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaagaagattgcaattgattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataagggcattaaaccttattatccggaacatctagtt
aatcattacttccaaactagacattatttacacactctatggcagggcggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacccctggccggacgccaacaaggtaggagctggagcattcgggc
cggggttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctctgagaaacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MH724249_FT00000_P-D Feature FT:source MH724249_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR42). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccctgccgaacctgcacgacaactgctcaaggaacctctatgtatccct
actgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtgtgtcaacgaattgtgggccttttgggttttgctgcccctttcacacagtgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattcttgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcctgtggtttcacatttcttgtcttacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttccgaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaancactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN688708_FT00000_P-D Feature FT:source JN688708_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV142). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacscaatgtgg
ttatccrgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaataccagaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttktggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcmggtctggagcaaacattatcggractgayaactctgttgtcctctcccgyaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccytctcggggycgcttgggactytctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaycaaatcytgcccaaggtcttayataagaggactcttgaactctttgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagntta
ttgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgcctactgacttctttccttcagtacgagatcttctagataccg
cctcagccctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagctattctt
tgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatccaacatctagagacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaca
tagttatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagaccaaacaatgcccctatccta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttgca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatcctaaggttactaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagcattcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggcctgttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM577671_FT00000_P-D Feature FT:source KM577671_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NIR-9). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctcaagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttacatggatgatgtggtattgggggccaagtctgtctcgcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggaagctatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattatcggaacggacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctcgcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactaggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagcttctgttgagttactctcgtttttgcctgctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggagggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacaccaatatgggcctgaaattcaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cggttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgccccaatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccctattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatcttatataagagagaaacaacacgtag
cgcttcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattcttccccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagcgggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgtcaatcagga
agacagcctaccccgctgtctccacctttgagagacactcatcctcaagcaatgcagtggaa
>gnl|hbvnuc|MK618419_FT00000_P-D Feature FT:source MK618419_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh16). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctggtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgccttcaccaaccgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257165_FT00000_P-D Feature FT:source JN257165_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHLL1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgaggggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttcagactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgtcctmt
gattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccay
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtwtcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaggttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tacgtcaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggaacctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcgatccttataa
agaatttggagcctctgtggagttactctcatttttgccttccgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggatgccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgactttagccacctgggtgggtggtaatttggaagatccaacatccagggatctagtagtcag
ttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacctttggaagagata
tagtcgtagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttcttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaatgtcaccaaatatttgccattggataagggtatcaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataggagagaaacaacacatag
cgcctcattctgtgggtcaccatattcttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttktgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacacccatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707703_FT00000_P-D Feature FT:source JQ707703_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_45). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctacaaaaccttccaccaaactctacaagatcccaaagtgagtggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtcygtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatagcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcctgcactcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgtagttctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctgtcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagtacgagatcttcttgataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacaatgcaaaccttgccagcaaatccgcctcctgtatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcaccctcaggccatacagtggaa
>gnl|hbvnuc|MH724217_FT00000_P-D Feature FT:source MH724217_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR7). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgctctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtgggacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctagggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatccagggacctagttgttag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB210821_FT00000_P-D Feature FT:source AB210821_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggagcctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagctatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366506_FT00000_P-D Feature FT:source KT366506_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.18). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttccactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK618429_FT00000_P-D Feature FT:source MK618429_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh46). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagtgtgagaggcctttatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcaatcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctggggcttcggaaaattccca
tgggagtgggccacagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttcgaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgcaaacaatacctgaacctttaccccgttacccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctttgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacacccacttttcctaatatacatttaca
ccaagacattattaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccatcttatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgataaacactcatcctcatgccatgcagtggaa
>gnl|hbvnuc|HQ700441_FT00000_P-D Feature FT:source HQ700441_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN10_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF679993_FT00000_P-D Feature FT:source KF679993_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-76). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctatcacttatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
agcatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctctgaattttatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcagagaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcccattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
tctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagcggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagctattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaagacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MW601271_FT00000_P-D Feature FT:source MW601271_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Riboviria] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtgttggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgtaggtctttcccccac
tgtttggctttcagttatatggatgatatggtattgggggccaaatctgtgcaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaactaaaagatggggatactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggggtctttcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaatgtttgccaaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtgcagttactctcatttttgcctgctgacttctttccttcggtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagaatcttctgagcattgttcacctcaccatactgcactcaggcaagcaacactt
tgctgggtggaactaatgtctctagctacctgggtgggtgctaatttggaagatcaaggatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaagtgggtaac
tttacggggctttattcttctaatgtacctgtctttaatcctcattggaaaacaccctcttttcctaagatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtaaatgagaaacgaagactacaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccggaacatgtagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacagcacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaactcagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcgtcaaccaatcgccaatcagga
aggcagcctaccccgctgtctccaccgttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664937_FT00000_P-D Feature FT:source JN664937_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN45_LC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttctatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KR905423_FT00000_P-D Feature FT:source KR905423_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-36). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactttgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgttattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcttgtattcaatcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactcggttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctgcgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagattgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtgggtccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgcgaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MW601312_FT00000_P-D Feature FT:source MW601312_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccgggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatttggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gatatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtaggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacatcctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccatccattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaacaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgagtcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctccatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaacatacatttaca
ccaagacattattaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagccttcgggctgggattcaccccaccgcacggaggccttttgg
gctggagccctcaggctcagggcatactacacaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|AY721606_FT00000_P-D Feature FT:source AY721606_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AT1.2). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggatttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccctcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccgtctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ464182_FT00000_P-D Feature FT:source DQ464182_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S4). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggcttcagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaagggatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgacttttgctcaaggaacctctatgaatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacttcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcagttctt
tgctggggggaactaatgactttagccacatgggtgggtggtaatttggaagatccaacatctagggacctagtagtcag
ttatgttaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatctccgcgtcgcagaagatctcaatctcgggaatctcaatggtagtattccttggactcataaggtgggaact
tttacggggctttattcttctactgttcctgtctttaacccgcagtggaaaacaccctcttttcctaatatacatttgca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaaggtcaccaaatatttgccattggataagggcattaaaccttattacccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcactatattcttgggaacaagagctacagcatggggcggaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacaactggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagcctactcctctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN507851_FT00000_P-D Feature FT:source MN507851_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2530_ocHBVd_GC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
gtatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccgacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccatataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctccgctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccattctt
tgctggggggaactaatgactctggccacctgggtgggtggtaatttggaagatccaatatccagggacctggtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctggtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707478_FT00000_P-D Feature FT:source JQ707478_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C12). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggctgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366500_FT00000_P-D Feature FT:source KT366500_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O-EICI.18). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaggatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcattcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaattcgtaggcccactcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttacccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX196220_FT00000_P-D Feature FT:source KX196220_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0105). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcacgaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcggagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctccgggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaacattgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HM750154_FT00000_P-D Feature FT:source HM750154_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XGW-23). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cttgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtatcgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgtatgcgtgggacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattggatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccatcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcttaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggcgctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707500_FT00000_P-D Feature FT:source JQ707500_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C40). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccacaagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT114173_FT00000_P-D Feature FT:source MT114173_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 051). Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gctgagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaggatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
gtatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgcctactgacttctttcctgcagtacgagatcttcttgataccg
cctcagctttgtttcgggaggccttagagtctcccgagcattgcacacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgaacctagctacctgggtgggtgctaatttggatgatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagata
cggtcatagagtatttggtgtctttcggggtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactgctgttgttagatcacgaggcaggtcccttagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactacaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacattctatggcaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatgaggcagaatctttccaccagcaatcctccg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccggacaaga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456682_FT00000_P-D Feature FT:source GU456682_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T42). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccgaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttaggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggtgttcccccac
tgtttggcttttagttacatggatgatgtggtattgggggctaaatccgtttcacatcttcagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattccttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgtttccgaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctccactgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacggctaccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggaattgggggaggagcttagatta
aagctgtttgtattaggaggctgtaggcataaattggtctgcgcaccagtcccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccgtataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatcttctagataccg
cctcagctctatatcgggatgccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcatttctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcatgtttggaagagata
cggtcatagagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccatcaaatgcccctatctta
tcaacacttccggagactactgttattagacaacgaagcaggtcctctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacccataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgcaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagcgagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacactgcaaatccagattgggacttcaaccccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcggactgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875292_FT00000_P-D Feature FT:source KC875292_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV21). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaataggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccagcttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctg
tgctggggggacttaataaccctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcattgagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttacccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctctgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MF925363_FT00000_P-D Feature FT:source MF925363_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV07). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattctctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgaatactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacttgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaacatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664914_FT00000_P-D Feature FT:source JN664914_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN48_IC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatccatcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctgaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN310712_FT00000_P-D Feature FT:source MN310712_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BG_107_2010). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggcttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtttccct
cctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtccacgaattgtgggtcttttgggttttgctgcccctttyacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatrggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
awgrtctttgtactgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagcacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatggatctagctacctgggtgggtggtaatttggaagatcaaggatctagagaactagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacgtttcttgtctcacgtttggaagagaag
tagttatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MW601266_FT00000_P-D Feature FT:source MW601266_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttaggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatagagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AJ627215_FT00000_P-D Feature FT:source AJ627215_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 06115). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacgaccttccaccaaactctgcaagatcccagggtgaggggcctgtatttccctgctggtggctccagttcgggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtgtgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtcgctttttaccgctgt
taccaattttcttatgtctctgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaattttatgg
gatatgtcattggaagttatgggtcattgccacaagatcacatcatacaaaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcctgtattcaatcgaagcaggctttcaccttctcgctgacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgtccgtccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctataa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggcgcttctgtggagttactctcgtttttgccttctgacttttttccttccgtacgagatcttctagataccg
cctcagctctgtttcgggatgccttagagtcttctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgtccctaggtacctgggtgggtggtaatttggaagatcaagcatctagggacctagtagtcaa
ttatgtcaactctaatatgggcttaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctccatcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaagtgggtaac
tttactgggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaacgaagactgaaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatcccgaacatctagtt
aatcattacttccaaacyagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggttaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaagctcagggcatgatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700477_FT00000_P-D Feature FT:source HQ700477_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PE09_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccay
tgtttggctttcagttatatggatgatgtggtattgggggccaagwctgtacagcatcttgagtccctttttaccgctgt
gaccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggctgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttatattaggaggctgtaggcataaattggtctgcgcaccaccaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggamcttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatrtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT579903_FT00000_P-D Feature FT:source MT579903_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Nsk-71958). Complete genome. [Riboviria] (length=3182 residues).
ctccacgaccttccaccaaactctacaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagattggggaccctgcgctgaacatggag
aaaatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtctgtcctct
acttccaggacctgcaaccaccagcgggggaccctgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaagattccta
tgggggtgggccttagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttactgctgt
taccaattttcttttgtctttggggatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgcgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatacggcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgaacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcattttccggtgctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccttcagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477457_FT00000_P-D Feature FT:source GQ477457_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P118). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgttattggatgttatgggtccttgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaaacaggctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatacctgaacctttaccccgttgctaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggggtctttcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgccaaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccgtcggtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactt
tgctggggggacttaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaagtgggtaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtaaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccggaacatttagtt
aatcattacttccaagccagacattatttacacactctatggaaggcgggtatcttatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ833465_FT00000_P-D Feature FT:source HQ833465_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB6). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactccttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagctcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaaa
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcaaactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642131_FT00000_P-D Feature FT:source JN642131_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb16). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtagaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggagtggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
ggcaagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctcgaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttttgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttcgaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttccacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagcgaactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ349220_FT00000_P-D Feature FT:source FJ349220_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H144). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaaggtggggttactctttacattttatgg
gctatgttattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctattcttgcccaaggtcttacataagaggactcttggactttctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagacta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcaatcaggcaagcaattctt
tgctggggggaactaatgaatctagccacctgggtgggtggtaatttggatgatccaacatcccgggacctagtagtcag
ttatgtcaacaataatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaagatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcgattgattatgc
ctgctaggttttatccaaatggtaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK355501_FT00000_P-D Feature FT:source MK355501_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ahvaz34). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgttggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatctcctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcggtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttacccgtttgtcctct
aattccgggatcttcaaccaccagcacgggaccatgcagaacctgcacgaatcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccctttctcctggctcagtttactagtgccatttgttcagtggttcgtagggcattcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggaggttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttcgaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagttgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtgaagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcatgtttctcctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaacatccagagatctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttgtctcatgtttgggagagaga
cgattctagagtatttggtttctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaaggagattgcaactgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaacaggacattatttacacactctatggaaggcgggtatattatataagagagaaacaacccatag
cgcctcattttgggggtcaccatattcttggaaacaagaactacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccggccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagaggccaacaaggtaggagctggagcattcgggctgggattccccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|V01460_FT00000_P-D Feature FT:source V01460_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JF754617_FT00000_P-D Feature FT:source JF754617_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK131). Complete genome. [Hepadnaviridae] (length=3182 residues).
caccataaacttccatcaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacgcatcgtcaatcttatcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctaggggggactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
tgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcagcatcttgagtccctttttaccgctgt
taccaattttcttatgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaggttatggatcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcccattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaaacaagctttcactttttcgccaacttacaaggcctttc
tgtgcaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
atgatttttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatctgctggataccg
ccgcaggcctatatcgggaagccttagagtctcctgagcattgctcagctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaattaatttatccacctgggtgggtagtaatttagaagatccaacatccagggacctagtagtcag
ttatgttaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcctagagtatttggtgtcttttggggtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaatgcttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatccaaaaatgtgaacaatttgtaggcccactcacagtaaatgagaaaagaagactgaaattgattatgc
ctgctaggttttatccaaatgttacaaaatatttgccattggataagggtattaaaccttattatccggaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
agacacttggccagacgccaacaaggtaggagctggagcattcgggatgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccgcctttgagggacacccatcctcaggctatgcagtggaa
>gnl|hbvnuc|JN257169_FT00000_P-D Feature FT:source JN257169_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAFF). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcctgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacatcaccatactgcactcaggcaagcaattcta
tgctggggggaactaatgactctagctacctgggtggggggtaatttggaagacccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttgtctcacttttggaagagaaa
cagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaacccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU668446_FT00000_P-D Feature FT:source KU668446_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV183). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AJ627216_FT00000_P-D Feature FT:source AJ627216_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17707). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacgaccttccaccaaactctgcaagatcccagggtgaggggcctgtatttccctgctggtggctccagttcgggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtgtgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacaacatcttgagtcgctttttaccgctgt
taccaattttcttwtgtctctgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaattttatgg
gatatgtcattggaagttatgggtcattgccacaagatcacatcatacaaaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcctgtattcaatcgaagcaggctttcaccttctcgctgacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatrggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgtccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctataa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggcgcttctgtggagttactctcgtttttgccttctgacttttttccttccgtacgagatcttctagataccg
cctcagctctgtttcgggatgccttagagtcttctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgtccctaggtacctgggtgggtggtaatttggaagatcaagcatctagggacctagtagtcaa
ttatgtcaactctaatatgggcttaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctccatcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaagtgggtaac
tttactgggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaacgaagactgaaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatcccgaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggttaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaagctcagggcgtgatrcaaaccttgccagcaaatccgcctcctgcatctaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ349206_FT00000_P-D Feature FT:source FJ349206_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttcgcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctaggcaacggccgggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatctttcgtccccttctccgcctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaatagatta
aaggtttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagatccaacatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctccatctcgggaatctcaatgttagtattccttggactcataaagtgggtaac
tttacggggctttattcttctactgcacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggccctctcacagtaaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccggaacatgtagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggcctgttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccgcctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ236014_FT00000_P-D Feature FT:source HQ236014_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RS1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagcctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctcaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcgtactaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcaccttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacgttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagtatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattattaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttactaaatatttaccattggataagggtattaaaccttactatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccaacaaatccgcctcctgcatccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ336688_FT00000_P-D Feature FT:source DQ336688_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgctcgcggcgttttatcatc
ttcctcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagcacgggaccatgccggacctgcacgactcttgctcaaggaacctctatgtatcctt
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattctttaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaaccgccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aagggctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttccttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtcccacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtggggagc
tttactgggctttattcttctactgtacctgtctttaatccccattggaaaacaccatcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgcaggcccactcacagttaatgagaaaagaagattgaaattgattatgc
ctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgactaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagccttcgggctgggtttcaccccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664932_FT00000_P-D Feature FT:source JN664932_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T2235_CHB). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacttgcataaccactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaagacgaaacgttggggttattctctacacttcatgg
ggtatgtcattggttgttggggatcattaccacaagagcacattatacacaagctaaaagaatgttttagaaaactccct
gttaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgcgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgtgcgggatcttctcgacaccg
ccgcagctctgtatcgggatgcgttagaatctcctgaacattgttcacctcaccatactgcactaaggcaagcaattctg
tgctggggagagttgatgactctagctacctgggtgggtagtaatttggaagatccagcatctagggacctagtggtcag
ttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttgggagagaaa
cggttttggagtatttggtgtctttcggagtgtggattcgcactcctaccgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacccatggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875294_FT00000_P-D Feature FT:source KC875294_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV70). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttggggacctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664926_FT00000_P-D Feature FT:source JN664926_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN63_CHB). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatctccctgctggtggctcaacttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgccgcacttgcatgactactgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaagacaaaaagatggggttattctctacatttcatgg
ggtatgtcattgattgttggggatcattaccacaagagcacattatacacaagctgaaagaatgttttcgaaaactccct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tctgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaactccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaacattctcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaagatcttacataagaggactcttggactctccacaa
tgtcaacgatcgatcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgttcgagatcttctagataccg
ccgcagctctatatcgggatgcgttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaatcctt
tgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagcatctagggacctagtggtcag
ttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttgggagagaaa
cggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcgtctactgtacctgtctttaaccctcattggaaaacaccaactttccctaatatacatttaca
ccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaacgaagattgcaattgattatgc
ctgctaggttttaccctaacgttaccaaatatttacccttagataagggtattaaaccttactatccagaacatctagtt
aatcattactttcaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctctgagagacacccatcctcaggccatgcagtggac
>gnl|hbvnuc|JQ707479_FT00000_P-D Feature FT:source JQ707479_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C13). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgaccactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgtcaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KP090179_FT00000_P-D Feature FT:source KP090179_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR6). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccgtgttggtggatccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttgggtttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcgtacacaaaatcaaagactgttttagaaaacttcct
attaaccggcctattgattggaaagtatgtcaacgaattgtaggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactttctcgtccccttctccgtcggccgttccgaccgcccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagacctccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagccctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtccccaggaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttgca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttactaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatccccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggacatggggaggaa
>gnl|hbvnuc|EU787437_FT00000_P-D Feature FT:source EU787437_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtcagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggatcctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgccgccccttttacacaatgtgg
gtatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctctgtctaccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtgttaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattattaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MF618349_FT00000_P-D Feature FT:source MF618349_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV165). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacagccttccaccaagttctgcaagatcccagggtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gatatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaaatctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtttggagcaaacgttctcgggactgacaactctgttgttctctcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactcatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cacctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggtataatacaaaccttgccagcaaatccgcctcctgcatctaccactcgccagtcagga
atgcaacctaccccactgcctcctcctttgagaatcactcttcctcaagccatgcagtggaa
>gnl|hbvnuc|MN310713_FT00000_P-D Feature FT:source MN310713_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BG_90_2010). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
gtgaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagatctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattacaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttcaaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ833471_FT00000_P-D Feature FT:source HQ833471_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB97). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgccgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgcaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctcccatttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcactggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaacaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccmacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664917_FT00000_P-D Feature FT:source JN664917_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SKR_IC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaagctcctgcagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875326_FT00000_P-D Feature FT:source KC875326_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV37). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccacttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgcacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gctatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaccgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagacaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccc