HBVdb

Dataset for nucleotide sequence Genomes of genotype D

[Download (right click)] [Alignment] [Repertoires]

1069 sequence(s)

>gnl|hbvnuc|AB210822_FT00000_P-D Feature FT:source AB210822_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggagcctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagctatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB222711_FT00000_P-D Feature FT:source AB222711_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNV24). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggtctttctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacaatcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB674405_FT00000_P-D Feature FT:source AB674405_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraHCCA12). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaacccaaacaaaacaaaaagatggggttactctttacatttcatgg
gctataycattggatgttatgggtcattgccacaggatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatygatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctaacttttggaagagaaa
cggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagattgcaatggattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattttttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB674406_FT00000_P-D Feature FT:source AB674406_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB23). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattcccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaagatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggagccaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcttcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcrtcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaaggtggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggycttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcmtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactccgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccagtatctagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaacatacatttaca
ccaagacattatcaaaagatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaaatgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaacaagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattctgtgggtcaccttattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacaactggccagatgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggcccagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AF043594_FT00000_P-D Feature FT:source AF043594_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1/91). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaaccggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtgcagttactctcttttttgcctcatgacttctttccttcagtacgagatcttctagataccg
cctcagctctctttcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagctaatttgcaagatccagcatctagggagctagttgttac
ttatgtcaacattaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctcaagcctatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccttattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AF121242_FT00000_P-D Feature FT:source AF121242_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV/1218). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaaaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctagtaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcacacagaaaatcaaagaatgtttcagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccatttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttataggccaccaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacccccttttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY161157_FT00000_P-D Feature FT:source AY161157_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
cagcctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagaatgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttccg
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtttgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttagggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaacttcttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacactgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatctcctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctggccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaccactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaaaatacatttaca
ccaagacattatcaaaagatgtgaacaatttgtaggcccacttacagttaatgagaagagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY161158_FT00000_P-D Feature FT:source AY161158_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcaatccc
cagcctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagaatgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttccg
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
acacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtttgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaa
tgtcaacgaccgaccctgaggcatgcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aagttgtttgtattaggtggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgtttaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatctcctagataccg
cctcagctctatatcgggaagctttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtggtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccgccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagagctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaaaatacatttaca
ccaagacattatcaaaagatgtgaacaatttgtaggcccacttacagttaatgagaagagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY721605_FT00000_P-D Feature FT:source AY721605_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AK1.1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccgggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctggtaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatcttctagataccg
cctcagctctataccgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaatgactctagccacctgggtgggcggtaatttggaagatccaatatccagagacctagtagtcag
tcatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtttctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY721607_FT00000_P-D Feature FT:source AY721607_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HIY1.3). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacaactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgcccacatacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcgtctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctggtaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctttcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatgtgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttactaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatacttcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY741794_FT00000_P-D Feature FT:source AY741794_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-50). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccgtcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactccttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
acgggctggggcttggtcatgggccatcagcgcatgcggggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactatctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatccagagacctagtagtcag
ttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcacaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtggggaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagacaagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctccgtctccacctttgagaaacacgcaccctcaggccatgcagtggaa
>gnl|hbvnuc|DQ336676_FT00000_P-D Feature FT:source DQ336676_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatgg
ggtatgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtggggagc
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU414135_FT00000_P-D Feature FT:source EU414135_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaaratcccaragtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctaacaaaacaaaaagatggggttactctttacatttcatgg
gctacgttattggawgttrkgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttracaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagacygtttgtttaaagactgggaggagttgggggaggagattagatta
aagrtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccatataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttagaagacccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttkkwggsscmcttacagtcaatgaaaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccagaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
grtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU414143_FT00000_P-D Feature FT:source EU414143_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcgcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctactatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgcacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctcaattttatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaataggcctattgattggaaagtatgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctccgctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctc
tgctggggggaactaatgactctagctacctgggtgggtgttaatctggaagacccagcatctagggacctagtagtcag
ctatgtcaacactaatatgggcctaaagttcagacaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttataraccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcrtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggactcataaggtggggaat
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgaaattgattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccccacggaggccttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccacctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594396_FT00000_P-D Feature FT:source EU594396_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacytgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcacggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgattcatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctatga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctaacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagacagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594405_FT00000_P-D Feature FT:source EU594405_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaaccctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctggtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594415_FT00000_P-D Feature FT:source EU594415_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacgaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctagacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgaacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594425_FT00000_P-D Feature FT:source EU594425_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctgkttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtytgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagagctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatccagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtctgttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaagcattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagtagttag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacatggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ349228_FT00000_P-D Feature FT:source FJ349228_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C11). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacattccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtacgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtacgggatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgttggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactattcctgtctttaaccctcattggaaaacacccacttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggcaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ692507_FT00000_P-D Feature FT:source FJ692507_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_50158). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactattgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcca
actaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccgacaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcgtatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttacg
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagctctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904399_FT00000_P-D Feature FT:source FJ904399_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A18). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggttcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcacatattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtatttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcagtacgagatgttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacatcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctcaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagaatatttggtgtctttcggagtgtggattcgcactcctccagcatatagaccatcaaatgcccctatctta
tcaacacttccggagacttctgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagwcgaag
gtstcaatcgscgcgtcgcagaagatctcaatctcgggaatctcaatgtaagtattccttggactcataaggtgggaaac
cttacggggctttattcttmtactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacatggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904402_FT00000_P-D Feature FT:source FJ904402_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A26). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagraa
cagcaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccytgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagattgttttcgaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggccsggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccattcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcatttttgccggctgacttctttccttctgtacgagatcttctagataccg
cctcagctctatatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaataactctatccacctgggtgggtggaaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcatatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctagcagacgaag
gtgtcaatcgccgcgtcgcagaagatctcaatctcgggaatcscaatgttagtattccttggactcataaggtgggaaac
tttgcggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaaaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904412_FT00000_P-D Feature FT:source FJ904412_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A56). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcaggcagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttgcataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcactttgggaagagaca
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccatatagacctccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatcctaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacacctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaagctcagggcatactacaaaccttgccagcaaatccgcctccttcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183453_FT00000_P-D Feature FT:source GQ183453_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4574). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctat
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183454_FT00000_P-D Feature FT:source GQ183454_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4582). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctat
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183464_FT00000_P-D Feature FT:source GQ183464_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4703). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctat
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctacggtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183469_FT00000_P-D Feature FT:source GQ183469_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4602). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcgtacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ctatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggtaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183474_FT00000_P-D Feature FT:source GQ183474_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4594). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttgacaggcctattgattggaaagtctgtcaacgtattgggggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttccactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacccgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183483_FT00000_P-D Feature FT:source GQ183483_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4566). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccct
cttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagtaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ922003_FT00000_P-D Feature FT:source GQ922003_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2B3225). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacacatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccgggatcatcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttattctcttaatttcatgg
gctatgtcattggttgttggggatcattgccacaagatcacatcatacacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctggggtttgctgcccctttcacacaatgtgg
ttatcctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggtcaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggtcatgggccatcagcgcatgcgtggaacctttctggatcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacrtcctttgtttacgtcccctcagcg
ctgaatcccgcggacgacccrtctcggggccgcttgggcccctgtcgtcctcttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
atgtcgcatggaraccaccgtgagcgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggaatgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctcaagacttttttccttccgtacgmgatcttctagataccg
ccgcagctctgtatcggaatgccttagagtctcctgagcattgttcacctcaccatactgcaatcaggcaagcaattctt
tgctggggagaactcatgarcctagctacctgggtgggtgctaatttagaagatcaagcatctagggacctagtagtcag
ytatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacgtttcttgtcttacttttggaagagata
cggttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tccacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatatcccttggactcacaaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcagtggaaaacaccctcttttcccaatatacatttaca
ccaagatattattaaaaaatgtgaacagtttgtaggcccgctaacagtcaatgaaaaaagacggttgaaattgattatgc
ctgctaggttttatcctaattttactaaatacttgcccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagagagtatcaacacatag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcaaggcataatacaaactttgccagcaaatccgcctcctgcctctaccgatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagagtcacttatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456683_FT00000_P-D Feature FT:source GU456683_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T101). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcaacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcaccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcccctgccgatccatactgcggagct
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcacaaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaagatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcgttcggactgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagccaacccctctgtctccacctttgagaaacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|HM750152_FT00000_P-D Feature FT:source HM750152_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate QHN-99). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacacaaagatggggttactctttacatttcatgg
ggtatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtttgtcaacgtattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccgacaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctactcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaaaaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctactatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagccaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HM750153_FT00000_P-D Feature FT:source HM750153_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XJW-12). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagcaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaatcttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacctcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgccgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggtataaattggtctgcgcatcagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctagtatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccactaggtaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagatgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700447_FT00000_P-D Feature FT:source HQ700447_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_CH02_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgcggacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattgtcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700466_FT00000_P-D Feature FT:source HQ700466_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MI26_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggctgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
tctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaagtgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaaaaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ833470_FT00000_P-D Feature FT:source HQ833470_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Xinjiang HB80). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtcagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaataccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgccgccccttttacacaatgtgg
ttatcctgctttactgcccttgtatgcatgtgttcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctctgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattattaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaakgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggcatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JF754617_FT00000_P-D Feature FT:source JF754617_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK131). Complete genome. [Hepadnaviridae] (length=3182 residues).
caccataaacttccatcaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacgcatcgtcaatcttatcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctaggggggactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
tgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcagcatcttgagtccctttttaccgctgt
taccaattttcttatgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaggttatggatcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcccattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaaacaagctttcactttttcgccaacttacaaggcctttc
tgtgcaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
atgatttttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtaagagatctgctggataccg
ccgcaggcctatatcgggaagccttagagtctcctgagcattgctcagctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaattaatttatccacctgggtgggtagtaatttagaagatccaacatccagggacctagtagtcag
ttatgttaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcctagagtatttggtgtcttttggggtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaatgcttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatccaaaaatgtgaacaatttgtaggcccactcacagtaaatgagaaaagaagactgaaattgattatgc
ctgctaggttttatccaaatgttacaaaatatttgccattggataagggtattaaaccttattatccggaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
agacacttggccagacgccaacaaggtaggagctggagcattcgggatgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccgcctttgagggacacccatcctcaggctatgcagtggaa
>gnl|hbvnuc|JF754631_FT00000_P-D Feature FT:source JF754631_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK193). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatattgtcaatcttctcgaggattggggaccctgcgctgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgggtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggtgcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcaccttgagtccctttatactgctgt
ttccaattttcttatgtctgtgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatggatcattgccacaagatcacatcatacagaaaatcaaagaatgttttcgcaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatcgaagcaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatacctgcacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgcctactgacttctatccttccgtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattatt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttgtctcacttttggaagagaaa
cggtcttagagtttttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttcaaatgttcctgtctttaaccctcatgggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgcacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagcattcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcctacgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagccaaga
aggcagcctacccctcagtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JF754633_FT00000_P-D Feature FT:source JF754633_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK128). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtctgtcaacgtattgtaggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccattctgcagaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatccattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccgtctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttatagaccacaaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacacccttttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagattacaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
agaaagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040753_FT00000_P-D Feature FT:source JN040753_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919064). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaaaatcccagagtgaaaggcctgtatatccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgaatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctcactctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcatcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
atggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggatgccttagagtctcctgaacattgttcacctcaccatactgcgctcaggcaagcaattctt
tgctggggggacctaatgactctagccacctgggtgggtagtaatttggaagatccagtatccagggacctagtagtcag
ttatgttaacactaatgcgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccttcagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattattaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccgaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacacctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccgccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcttccaccaggcgccagacagga
aggcagcctacccctctgactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040757_FT00000_P-D Feature FT:source JN040757_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919056). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgacccctgctcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgttgtattgggggccaagtctgtacaccatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtccttgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgccgccccttttacacaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtacacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaccattctcgggacggacaattctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagcggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccctataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggacgatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgaaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtccgga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040766_FT00000_P-D Feature FT:source JN040766_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919046). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcgcatatcgtcaatcttctcgaggattggggaccctgctctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcgaggtatgttgcccgtttgtcctct
acttccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgttcctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacgttatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcaaccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgt
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgccaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
agctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatagatccttataa
agaatttggcgcttctgtggagttactctcgtttttgcctggtgacttctttccttccgtacgcgatcttctagataccg
cctcagctctgtatcgggaagccttagagtctccggagcattgtactcctcatcatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaacttggaagatccgacatccagagacctagtagtcac
ttatgttaacactaatatgggcataaaattcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgcctcgtcgcagaagatctcaatctagggaagctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataggagagaaactacacacag
cgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040782_FT00000_P-D Feature FT:source JN040782_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919041). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgaatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcgcatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacaacacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggttgacttctctcagttttctaggggagaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggcgaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtccttgccacaagatcacatcgtacaaaaaatcaaagaatgtttcagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccctcatccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacacaagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagaatgggaggaattgggggaggagaatagatta
atggtgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtagtaatttggaagatccagtatccagggacctagtagtcag
ttatgttaacactaatgcgggcctaaagttcagacaactgttatggtttcacatttcttgtctcacttttggaagagaaa
cggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttctgttattagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctagggaatccagatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaacaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggcattaaaccttattatccggaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagcgggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040786_FT00000_P-D Feature FT:source JN040786_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919035). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
taacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaccaaaacaaaaagatggggttactctttacatttcatgg
gctatgtaattggatgttatgggtcattgccacaagaacacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaagcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttcgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctgtgcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtatctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatgtagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagctttcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040802_FT00000_P-D Feature FT:source JN040802_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919074). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagtacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtcttgcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcctgtattcagtcgaagcaggcttttgctttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactttctcgtcctcttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgagcgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagattgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggacctaataactctatctacctgggtgggtggtaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagaggacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaacgagaaaagaacactacaattgattatgc
ctgctaggttttatcctaaggtcaccaaatatttgcctttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacgcctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaccactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040811_FT00000_P-D Feature FT:source JN040811_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919048). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccggatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataca
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtcattgccacaagatcacatcaaacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcccattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctctgtattcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactccgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacccccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaatagatta
catttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctattgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttttttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattcta
tgctggggggacttaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcgg
ttatgtcaacactactgtgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttgtagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgagcaatttgtaggcccactcacagtcaatgagaaaagaagactgaaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatgtagtt
aatcattacttccaaaccagacattatttacacactctgtggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040813_FT00000_P-D Feature FT:source JN040813_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919025). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaaccctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gatatgtcattggatgttatggatcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttcttcgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttggggggttttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattcta
tgctggggggacttaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggcaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaaccccaacaa
ggacacctggccagatgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040814_FT00000_P-D Feature FT:source JN040814_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919032). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacattccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaagattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggggtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtcaaagcaggcttttactttctcgccaacttacaaggcctttc
tatgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagatgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
tgttggggagacctaatgactctagctacctgggtgggtggtaatttggaagatccagtatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccggcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040822_FT00000_P-D Feature FT:source JN040822_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919044). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagagacctgtatttccctgttggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctgggtatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagttttctagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgt
taccaattttcttgtgtctttgggtatacatttaaaccctcacaaaacaaaaagatgggggtattctttacatttcatgg
gatatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgcattcagtcgaagcaggcttttaccttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgtttcggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttcaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactcggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcgcctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggacgatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggcctgttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257181_FT00000_P-D Feature FT:source JN257181_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHNDA). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagactgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggatggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccttcggtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctc
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagtttagacaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagattgcaattgattatgc
ctgccagattttatccaaaggttaccaaatatttaccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaaaaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtccgga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642135_FT00000_P-D Feature FT:source JN642135_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb24). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgttcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcaatggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgccgttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tatataaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagaccgtttgtttaaggactgggaggagttgggggaggagcttagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctgatc
atctcttgttcatgtcctactgttcaagcctccaagttgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgtgcagttactctcgtttttgccttctgacttttttccttccgtacgagatcttctagataccg
cctcagctctatatcgggacgccttagagtctcctgagcattgtacatatcatcatactgcactcaggcaagcaattcta
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggacgatccaacatccagggacctagtagtcag
ttatgtcaataataatatgggcctaaaattcaggcaactattgtggtttcacatttcttgtctcacttttggaagagcaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacaacaacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttcttctgttcctgtctttaatcctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
gatggagccctcaggctcagggcacactacagaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcaacctacccctctgactccacctttgagaatcactcatcctcacaccatgcagtggaa
>gnl|hbvnuc|JN642159_FT00000_P-D Feature FT:source JN642159_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb52). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatggatcattgccacaagatcacatcagacagaaaatcaaagactgttttagaaaacttccc
gttaacaggcctattgattggaaggtctgtcaacgtatcgtgggtcttttgggttttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcggtacggacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatctcacgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctggtgacttctttccttcaatacgagatcttctagataccg
cctcagctctgtttcgggatgccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctgaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttcttctgtgcctgtctttaaccctcattggaaaacaccttcttttcctaatattcacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccctattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggactcctggccagacgccaacaaggtaggagctggagcattcgggatgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcaacctacaccgctgtctccacctctgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664911_FT00000_P-D Feature FT:source JN664911_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB47_IC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664917_FT00000_P-D Feature FT:source JN664917_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SKR_IC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaagctcctgcagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN688708_FT00000_P-D Feature FT:source JN688708_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV142). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacscaatgtgg
ttatccrgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaataccagaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttktggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcmggtctggagcaaacattatcggractgayaactctgttgtcctctcccgyaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccytctcggggycgcttgggactytctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaycaaatcytgcccaaggtcttayataagaggactcttgaactctttgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagntta
ttgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgcctactgacttctttccttcagtacgagatcttctagataccg
cctcagccctgtatcgggaagccttagagtctcctgagcattgctcacctcaccataccgcactcaggcaagctattctt
tgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatccaacatctagagacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaca
tagttatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagaccaaacaatgcccctatccta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttgca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatcctaaggttactaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagcattcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggcctgttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN792907_FT00000_P-D Feature FT:source JN792907_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 312000473). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaggacttgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtccttgccacaagatcacatcaaacagaaaatcacagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcatcgattcttgcccaaggtcttacataagagaactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggacgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagaccaag
gtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttgatattccttggactcacaaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatagaaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
agacagcctaccccgctgtctccccctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707488_FT00000_P-D Feature FT:source JQ707488_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C26). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagagaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707500_FT00000_P-D Feature FT:source JQ707500_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C40). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccacaagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707502_FT00000_P-D Feature FT:source JQ707502_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C42). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707515_FT00000_P-D Feature FT:source JQ707515_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C13). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttctctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttcttgataccg
cttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgtctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707518_FT00000_P-D Feature FT:source JQ707518_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C17-3). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttctctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707523_FT00000_P-D Feature FT:source JQ707523_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C36). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttctctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttcttgataccg
cttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactatacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774462_FT00000_P-D Feature FT:source KC774462_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dxa2047). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gttatgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttctgggttttgccgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgccaaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aatgtctttgtattaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcccaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaatgttaccaaatatttgcctttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaagggcggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgtcaaggc
atggggacgaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggatttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctccaccaatcgccagtcaggaaggcagcctacccctctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC875280_FT00000_P-D Feature FT:source KC875280_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV20). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacctgccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaccctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactccaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875291_FT00000_P-D Feature FT:source KC875291_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV58). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcaccttctcgccaccttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatccgcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgacgcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtgaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaatcttattatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875295_FT00000_P-D Feature FT:source KC875295_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV81). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttggggacctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgctacaaaccttgccagcagatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875325_FT00000_P-D Feature FT:source KC875325_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV60). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccctccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgcacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaccgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggggagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacttttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875328_FT00000_P-D Feature FT:source KC875328_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV83). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagattccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaccgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatgctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagacaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagaccaccaaatgcccctatccta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattactttcaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcagatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcattctcaggccatgcagtggaa
>gnl|hbvnuc|KC875335_FT00000_P-D Feature FT:source KC875335_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV44). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaccgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaacgttaccaaatatttacccttggataagggtattaaaccttattatccagaacatctagtt
aatcattactttcaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcctcctcaggccatgcagtggaa
>gnl|hbvnuc|KF061168_FT00000_P-D Feature FT:source KF061168_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RST_PAK_3a). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtagaccgtgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
gacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaycttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gttatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcatttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactccgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttayataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggargagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataattgggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggrcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaasccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggahctaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatattcatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactrcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacckcacggaggccwtttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaamactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF471646_FT00000_P-D Feature FT:source KF471646_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-37). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggaagttacggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaagcaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttactatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggacgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtaag
ttatgttaacactaatatagccctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaaggagactgaaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggcattaaaccgtattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgtaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgtcagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF471657_FT00000_P-D Feature FT:source KF471657_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-7). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggga
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
actgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcaccttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtattgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcgcctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaataactttatccacctgggtgggtggtaatttggaagatccaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF584161_FT00000_P-D Feature FT:source KF584161_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1a). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctggacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacraratcttctarataccg
cctcagctctgtatcgggaagccttaragtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgyacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaacctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagccttcgggctgggattcaccccaccgcacggaggccttttag
grtggagccctcaggctcagggcatactacaaaccttgccagaaaatccgcctcctgcctctaccaatcgccagtcaggg
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggcaatgcagtggaa
>gnl|hbvnuc|KM524339_FT00000_P-D Feature FT:source KM524339_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EHBV064_EP-CHB). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgagcatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaactttctggctccactgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactcggttgttctctcccgcaaat
acacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctatctcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttagtattccttggactcataaggtgggaaac
tttacggggctctattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggtcccctcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtatcaaaccttattatccagaacatctggtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtggttcactatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacatggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM577669_FT00000_P-D Feature FT:source KM577669_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NIR-7). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacgaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgcttgatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttttgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaataggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctctaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctcgcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctgatc
atctcttgatcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacccttataa
agaatttggagcttctgtggagttactctcttttttgcctggcgactactttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggaacaagtagtcag
ttatgtcaacactaatatgggcctgaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagagtatttagtgtctttcggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggaaattactgttgttagacaacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaaccccaatgttaatattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacacttaca
ccaagatattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactgcaattaattatgc
cagctaggttttatccaagggttaccaaatatttgccattagataagggtattaaaccctattatcctgaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacagcacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagcgggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacacacatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM606755_FT00000_P-D Feature FT:source KM606755_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Cuba139). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttcccacaaactctgcaagatcccagagtgagaggcctgtatgtccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcatcaaccaccagcacgggaccctgcaggacctgcacgactcctgctcaaggaacctctatgaatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctaacaaaacaaagagatggggttattctcttaatttcatgg
gctatgtcattggttgttggggatccttgccacaagatcacatcatacacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaaacaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggttggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgtcctctcccgcaaat
atacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtctcttgggaccctgtcgtcctcgtctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atatgttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttccgtgcgagatcttctagataccg
ccgcagctctgtatcgggatgccttagagtcttctgagcattgttcacctcaccatacagcactcaggcaagcaattctt
tgctggggagacctaatgactctagctacctgggtgggtactaatttggaagatccgacatctagggacctagtagtcag
ttatgtcaacactaatgcgggcctaaagttcagacaactattgtggtttcacatttcttgtcttacatttggaagagaaa
cggtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatgtcgggaatctcaaggttagtatcccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatctaca
ccaagatattatcaaaaaatgtgaacagtttgtacgcccgctcacagttaatgagaaaagacggttgaaattgattatgc
ctgctaggttttatcctaattttaccaaatacttgcccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtgttttatataagagagtttcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagaaacactcatcctcatgcaatgcagtggaa
>gnl|hbvnuc|KP322600_FT00000_P-D Feature FT:source KP322600_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H2812). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatattacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749827_FT00000_P-D Feature FT:source KT749827_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FL14). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagggtgagaggcctatattcccctgctggtggctccagttcaggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtttgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttctcctggactatcaaggtatgttgcccgtctgtcctct
gattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtctgttgggttttgctgccccttttactcaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcgcggggccgcttgggactctttcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcattcctt
tgctggggggaattaatgactctagctacctgggtgggtactaatttggaagatcaagcatctagggacttagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaagtgggtaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggaccactaacaacaaatgagaaacgaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccggaacatttagtt
aatcattacttccaaaccagacattatttacacactctgtggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccatcagctggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggatacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataacgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcgggg
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU668433_FT00000_P-D Feature FT:source KU668433_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV071). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacattatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagcaactgtggagttactctcgtttttgccttctgatttctttccgtctgtccgagatcttctagataccg
ccgcagcgctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgactttcgctacctgggtgggtactaatttggaagatccagcatctagggacctagtggtcag
ttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttttggagtatttggtgtctttcggagtgtggattcgcactccgccagcttatagaccaccaaatgcccttatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcccaatatacatttaca
ccaagacatcatcaacaaatgtggacagtttgtaggccctcttactgtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatccagaacatctagtt
aatcattactttcaaaccagacactatttacacactctatggaaagcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU668442_FT00000_P-D Feature FT:source KU668442_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV175). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatgctccactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagaagaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagatatcatcaaaaaatgtgaacagtttgtaggtccactcacagtcaatgagaaacgaagattgcaattaattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcatccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX196210_FT00000_P-D Feature FT:source KX196210_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL095). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctgacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcaccttctcgccaccttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatccgcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgacgcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtgaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaatcttattatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX196226_FT00000_P-D Feature FT:source KX196226_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0111). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaaattgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX196227_FT00000_P-D Feature FT:source KX196227_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0112). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttggggacctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggactgctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgctacaaaccttgccagcagatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX196229_FT00000_P-D Feature FT:source KX196229_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0114). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaggtctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacgcctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcatggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataagacgaaaagatggggttattctctacacttcatgg
gttatgtcattggttgttggggatccttagcacaagagcacattatacacaagctgaaagaatgttttagaaaactccct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttatatgcatgtattcaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacgaaatcttgcccaagatcttatataagaggactcttggactctccacaa
tgtcaacgaccgatcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcctaatc
atcttttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcatctgtggagttactctcatttttgccttccgatttctttccgtctgtccgagatcttctagataccg
cctcagcgctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgaatttagctacctgggtgggtactaatttggaagatccagcatctagggacctagtggtcag
ttatgtcaacactaacatgggcctaaagttcaggcaactattgttgtttcacatttcttgtctcacttttggaagacaaa
cggttctggagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagaccaccaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaccctcaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcccaatatacatttaca
ccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatacaagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggac
>gnl|hbvnuc|KX196232_FT00000_P-D Feature FT:source KX196232_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0117). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcggagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctccgggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaacattgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX276856_FT00000_P-D Feature FT:source KX276856_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaggatcccagrgtgagrggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcaycctgctgctatgcctcaycttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtrcakcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaactaaaagatggggttactctttacakttcatgg
gctatgttattggaggttatgggtcattaccacaagatcacattagacataaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcggggaaccttttcggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtag
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctytgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcamctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccgagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttcttcccgtcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgcacacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagttaatgactctagctacctgggtgggtgctaatttggaagaccaaccatctagggacttagtagtcgg
ttatgtcaacactaatatgggcgtaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcctggagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagaccacctaatgcccctatctta
tcaacacttccggagtgtactgttgttagacaacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctaaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttaytcttctactgtacctgtctttaatcctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaagttaccaaatatttgccactagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatacaagagagaatcaacacgtag
cgcctcattttgtgggttaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagcattcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggatacgtggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccaccaatcgycagtcagga
aggcagcctactccgctgtctcctcctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX357637_FT00000_P-D Feature FT:source KX357637_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK20ETH). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcgcgggaccatgcagaacctgcacgaccactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctgaaaagactaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcaaacagaaaatcaaagaatgttttcgaaaacttcct
gttaacaggcctattgattggaaagtttgtcaacgtattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctttccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcacggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctatgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaattctt
tgctggggggacctaatgactctagctacatgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctgaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtaatagagtacttggtttctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtgcctgtctttaaccctcattggaaaacaccctcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggtccactcacaatcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatccaccaatcgccaggcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX357638_FT00000_P-D Feature FT:source KX357638_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AA95ETH). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcgcgggaccatgcagaacctgcacgaccactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaagactaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtctattgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttatacgcctgtattcaatctaagcaggctttcattttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctcgcagcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactgtctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcacgtaattctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctgaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtaatagagtacttagtttctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaacattcatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatattaccaaatatttgcccttagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccaggcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KY382414_FT00000_P-D Feature FT:source KY382414_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D1_wt). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctggacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaacctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagccttcgggctgggattcaccccaccgcacggaggccttttag
ggtggagccctcaggctcagggcatactacaaaccttgccagaaaatccgcctcctgcctctaccaatcgccagtcaggg
aggcagcctaccccgctgtctccaccwttgagaaacactcatcctcaggcaatgcagtggaa
>gnl|hbvnuc|MF618341_FT00000_P-D Feature FT:source MF618341_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV011). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgcgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MF618349_FT00000_P-D Feature FT:source MF618349_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HIV165). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacagccttccaccaagttctgcaagatcccagggtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gatatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaaatctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtttggagcaaacgttctcgggactgacaactctgttgttctctcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactcatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cacctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggtataatacaaaccttgccagcaaatccgcctcctgcatctaccactcgccagtcagga
atgcaacctaccccactgcctcctcctttgagaatcactcttcctcaagccatgcagtggaa
>gnl|hbvnuc|MH724217_FT00000_P-D Feature FT:source MH724217_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR7). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgctctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtgggacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctagggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatccagggacctagttgttag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH724250_FT00000_P-D Feature FT:source MH724250_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR43). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccctgccgaacctgcacgacaactgctcaaggaacctctatgtatccct
actgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctctacattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtgtgtcaacgaattgtgggccttttgggttttgctgcccctttcacacagtgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattcttgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcctgtggtttcacatttcttgtcttacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttccgaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccgccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598641_FT00000_P-D Feature FT:source MK598641_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg26). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtgtctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccagaatcttcaaccaccagcacgggaccttgcagaacatgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtttgtcaacgtattgtgggtcttttgggttttgccgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcacggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctatga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctaacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccactggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatcggcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598647_FT00000_P-D Feature FT:source MK598647_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg55). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatacgagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctggaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgccacatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacacttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacataagatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggagttaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacaccctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccaccgttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598663_FT00000_P-D Feature FT:source MK598663_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg31). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgtttcaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttctctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaataccaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacatactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagcgggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcaaggcatactacaaaccttgccagcaaatccgcctcctgcttccaccaatcgccagtcagga
aggcagcctaccccgttgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598678_FT00000_P-D Feature FT:source MK598678_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg14). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccataacgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacaccaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaaccggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtgcagttactctcttttttgcctcatgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttgcaagatccagcatctagggagctagttgttac
ttatgtcaacattaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctcaagcctatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccttattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgcagtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK618421_FT00000_P-D Feature FT:source MK618421_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh43). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcacgaa
cagtaaatcctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgcgatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctggtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK618434_FT00000_P-D Feature FT:source MK618434_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh37). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcggtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagtttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacactcatcctcaggccgtgcagtggaa
>gnl|hbvnuc|MN507836_FT00000_P-D Feature FT:source MN507836_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1037_ocHBVd_GC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaggaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttatatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggacaactcggttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggaatgggaggagttgggggaggagattagatta
cagttgtttgtattgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctaaccacctgggtgggtggtaatttggaagatccagtatccagggacctagtagtcac
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttcttctgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatcctaatgctaccaaatatttgcccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB109477_FT00000_P-D Feature FT:source AB109477_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cggtcttagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB119254_FT00000_P-D Feature FT:source AB119254_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacattatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggccgattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcatatcatcatactgcactcaggcaagctatcctt
tgctggggggagttaatgactctagctacctgggtgggtggtaatttggacgatccaacatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcgtagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
cttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgggggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagccgaccccactgtcaccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB205127_FT00000_P-D Feature FT:source AB205127_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU313-2). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttctcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccaccagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggacaactctgttgttctctcccgcaaat
atacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctgaagttcaggcaactattatggtttcacatttcttgtctcacttttggaagagaaa
cggtcattgagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcacaaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctactatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttctatcccaatgttaccaaatatttgccattagataagggtattaaaccctattatccagaacatctggtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatcgaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatccacaggccatgcagtggaa
>gnl|hbvnuc|AB205128_FT00000_P-D Feature FT:source AB205128_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV-RU316-1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggttccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcttcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaagtaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttccccttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcctccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctccgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccttctcggggccgcttgggcctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaatgcttgcccaaggtcttgcataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctaggggcctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttatggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttagtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaaggcattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattaattatgc
ctgctaggttttatcctaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattcttccccgaccaccagttggatccagccttcagagcaaacaccgcacatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB222709_FT00000_P-D Feature FT:source AB222709_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZBV34). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgygctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccgggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtctttgcctcaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactcagttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacttgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttccaaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacaatcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagagcatgtagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcattctacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcaaga
aggcagcctacccctctgtctccacctttgcgaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB222713_FT00000_P-D Feature FT:source AB222713_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate UZNVC6). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tatgtaaccaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttcttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactcggttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtatttgttttaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ctatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacctttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttacc
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB270539_FT00000_P-D Feature FT:source AB270539_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL200F). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccatgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctcaatttcatgg
gctatgtcattggatgttatgggtcattgccacaggaacacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgctctaatgcccttgtatgcatgtattcaatctaaacaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactcggttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaaatattgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtactaatttggaagatccggcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB270541_FT00000_P-D Feature FT:source AB270541_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL47F). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgaccactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagaatgwrcagcatcttgagtccctttttaccgctgt
kaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgtttcgctcgcagcaggtctggggcgaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaatgtttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccatataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcgctcaggcaagcaattctt
tgctggggggatctaatcaatctatccacctgggtgggtggtaatttagaagatcaaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcactttcggaagagata
cggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttgatattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaagaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatcttatataagagagaaacaacacatag
cgcctcattttatgggtcatcatatccttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccaatcagga
aggcagccgacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AJ131956_FT00000_P-D Feature FT:source AJ131956_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatccagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AJ627216_FT00000_P-D Feature FT:source AJ627216_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 17707). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacgaccttccaccaaactctgcaagatcccagggtgaggggcctgtatttccctgctggtggctccagttcgggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtgtgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacaacatcttgagtcgctttttaccgctgt
taccaattttcttwtgtctctgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaattttatgg
gatatgtcattggaagttatgggtcattgccacaagatcacatcatacaaaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcctgtattcaatcgaagcaggctttcaccttctcgctgacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatrggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgtcgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgtccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctataa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggcgcttctgtggagttactctcgtttttgccttctgacttttttccttccgtacgagatcttctagataccg
cctcagctctgtttcgggatgccttagagtcttctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgtccctaggtacctgggtgggtggtaatttggaagatcaagcatctagggacctagtagtcaa
ttatgtcaactctaatatgggcttaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctccatcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaagtgggtaac
tttactgggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaacgaagactgaaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatcccgaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggttaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaagctcagggcgtgatrcaaaccttgccagcaaatccgcctcctgcatctaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY236162_FT00000_P-D Feature FT:source AY236162_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 23A). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatcttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagaatagatta
atgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcctttttgccttctgacttctttccgtcggtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgaacattgctcacctcaccatactgcactcaagcaagcaattctt
tgctggggggaattaatgactttagccacctgggtgggaggtaatttgcaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacgtttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcccccagcttatagaccgccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtggggaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgtcagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccacgaagtggaa
>gnl|hbvnuc|AY721606_FT00000_P-D Feature FT:source AY721606_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AT1.2). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagtacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggatttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccctcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccgtctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY741795_FT00000_P-D Feature FT:source AY741795_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-Hi). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccgtcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactccttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
acgggctggggcttggtcatgggccatcagcgcatgcggggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactatctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatccagagacctagtagtcag
ttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcacaaaatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagacaagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctccgtctccacctttgagaaacacgcaccctcaggccatgcagtggaa
>gnl|hbvnuc|AY945307_FT00000_P-D Feature FT:source AY945307_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttgggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttatatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcctgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtgttaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcaaacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaagatgtgaacaatttgtaggcccactcacagttaatgagaaaagacgactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ315776_FT00000_P-D Feature FT:source DQ315776_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EI00615). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatagacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ315778_FT00000_P-D Feature FT:source DQ315778_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EI0388). Complete genome. [Hepadnaviridae] (length=3212 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcctgcgtggaacctttccggctccactgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccctgcaactttttcacctctgcctgatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcttttcgagatcttctcgataccg
cctctgctctgtatcgggaggccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagctattctg
tgctggggggacttgataaatctatctacctgggtgggaagtaatttggaagatccagcatccagggacttagtagtcag
ctatgtcaatactaacatgggcctaaagctcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctctattcttctactgtacctgtctttaaccctcattggaaaacacccacttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggccccctcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtatcaaaccttattatccagaacatctggtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgc
aaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgg
gattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccatgccagcaaatccg
cctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggc
catgcagtggaa
>gnl|hbvnuc|DQ329356_FT00000_P-D Feature FT:source DQ329356_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacttgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctccgcaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggtttgggcgtcgtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcccttgggactctctcgtccccttctccggctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgggcacttcgcttcacctctgc
gcgtccgatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttagggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctatccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggagagatctaatgactctagctacctcggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtgccttcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgctagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcggcggagaagatctaaatctcgggaatctcaatgttagaattccttggactcataaggtggggagc
tttactgggctttattcttctactggacctgtctttaatcctaattggaaaacaccatcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgaaattgattatgc
ctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattcttgcccgaccaccagttggatccagccttcagagcaaacaccggaaatccagattgggacttcaatccaaacaa
ggacacctggcaagacgccaacaaggaaggagctggagcattcgggctgggtttcacccaaccgcacggaggccttttgg
ggtggagccctcaggttcagggcatgctacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgttgtctcaacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ336690_FT00000_P-D Feature FT:source DQ336690_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaa
cagcaaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggatggggacccttgcactgaacatggag
aacatcacatcaagactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgggtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatgg
ggtatgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttaccaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgcttgctgatgcaaccccc
actggctggggcttggccatgggccatctgcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggggcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttgtcccacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttataaaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtggggagc
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaacatacatttaca
ccaggacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgaaattgattatgc
ctgcaaggttttatccaaatactaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagtactacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggcttgggttcaccccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU414136_FT00000_P-D Feature FT:source EU414136_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacgcaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaaggtggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgtgctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgtacgagatctgctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctattttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatattaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggsgggtatattatataagagagaaacaacacatag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccattcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU414140_FT00000_P-D Feature FT:source EU414140_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcycatatcgtcaatcttctcgaggattggggaccctgtgccgaacatggag
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactmccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcytgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactmtcaaggtatgttgcccgtytgtcctct
aattccaggatcwtcaaccaccagyrygggaccmtgcmraacctgcacgactmytgytcaaggaacctctatgtwtccct
cmtgttgctgtwcmaaaccttcggacggaaattgcacytgtattcccatcccatcatcmtgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgymgggctttcccccac
tgtytggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacccyaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggatcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaatgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccktgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaatcatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtac
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU414141_FT00000_P-D Feature FT:source EU414141_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctctaaattttatgg
gttatgtcattggawgttrkgggtcattgccacaagaacacatcatacaaaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggccttttgggttttgctgcaccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttatccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
awgrtstttgtactaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcarctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggcgtaaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagawa
carttataraatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcrcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaay
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtatyaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacacactatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggcygggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaactktgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgcgaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594382_FT00000_P-D Feature FT:source EU594382_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctctaaattttatgg
gttatgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggccttttgggtttcgctgcaccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatacctgaacctttaccccgttgtccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggcgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagccaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgttgtctccacctttgcgaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU787436_FT00000_P-D Feature FT:source EU787436_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 165). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagagcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagattg
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatactgcactaaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtagtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatattcatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccacaagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ349216_FT00000_P-D Feature FT:source FJ349216_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H113). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaaggtggggttactctttacattttatgg
gctatgttattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtcttgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctattcttgcccaaggtcttacataagaggactcttggactttctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagacta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccagtatcccgggacctagtagtcag
ttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaagatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattctgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ349232_FT00000_P-D Feature FT:source FJ349232_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C51). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgacttctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gctatgttattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtatccaatataagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaacatgggcctaaagttcaggcaactcttatggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcactggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccgaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccaaacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccacctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904426_FT00000_P-D Feature FT:source FJ904426_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B4). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcatcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tatgtaaacaatacytgcacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aagatctttgtattgggaggctgtaggcataaattggtctgcgcaccagcaccatgcacctttttcacctctgcctaatc
agctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaatacta
tgctggggggaactaatgactctagccacctgggtgggtgctaatttggaagatccaacatctagggacctagtagtcag
ttatgttaacaataatatgggcgtaaagttcaggcaactattgtggtttcacatttcttgtctaacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccaccatatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacaacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgctagtattccttggactcataaggtgggaaac
tttacggggctttattcttccactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatattcatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacacctagtt
aatcattacttccaaaccagacattatttacatactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcacccctcctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|FJ904443_FT00000_P-D Feature FT:source FJ904443_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B46). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatgcagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttgcataagaggactcttggactctctgtga
tgtcaacgtccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcatatagacctccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183451_FT00000_P-D Feature FT:source GQ183451_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4588). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctat
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183461_FT00000_P-D Feature FT:source GQ183461_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4586). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctcgggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaaaatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183466_FT00000_P-D Feature FT:source GQ183466_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4577). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctat
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183472_FT00000_P-D Feature FT:source GQ183472_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4691). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcgcccatatcgtccatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgacaactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gatatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttctgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcgctcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggatttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ184322_FT00000_P-D Feature FT:source GQ184322_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM4522). Complete genome. [Hepadnaviridae] (length=3188 residues).
ctccacaactttccaacaaactctgcaagattccagagtgagaggcctgaatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtccctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgtccggt
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggcctttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcacacaaaaaatcaaagactgtttcaggaaacttcct
gtcaacaggcctattgattggaaagtctgtcaacgtattgtaggtcttttgggttttgctgccccgtttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcagactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatgggcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatatcagaggactcttggactct
ctgtgatgtcaacgatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaat
aggttaatgatttttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgc
ctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggcttaaggacatggacattgatcc
gtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatcttctag
ataccgcctcagctctatttcgggacgccttagaatctcctgagcattgtacacctcaccatactgcactcaggcaagca
attctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagt
agtcacttacgttaatactaatatgggcattaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaa
gagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccct
atcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcgatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttatccttctactgttcctgtctttaaccctcattggaaaacaccctgttttcctaatataca
tttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagactgcaattga
ttatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacat
gtagttaatcattacttccagaccagagattatttacacactctatggaaggcgggtatattatataagagagaaacaac
acatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaat
cctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcc
caacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggcc
ttttggggtggagccctcaggctcagggcatactacaaaccttgccaccaaatccgcctcctgcttctaccaatcgccag
acgggaaggcagcctacccctctgtctccacctttgagagacactcatcctcaggccgtgcagtggaa
>gnl|hbvnuc|GQ205380_FT00000_P-D Feature FT:source GQ205380_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1245). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcacggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagagcacattatacacaagctgaaagaatgttttagaaaactccct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaa
tgtcaacgaccgatcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcccaatatacatttaca
ccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctctgagagacactcatcctcaggccatgcagtggac
>gnl|hbvnuc|GU456646_FT00000_P-D Feature FT:source GU456646_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T77). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaggttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggccttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttatatgcatgtattcagtcgaagcaggcttttaccttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
gctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgatgcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgttgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccagcaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatataccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|GU456654_FT00000_P-D Feature FT:source GU456654_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T39). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgagccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttatgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gtcaacaggcctatcgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctactgacttctttcctgcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatactgcactcaggcaagcaatcctt
tgctggggggaactaatgtctctagccacctgggtgggtggtaatttggaagatcaacaatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcactttcggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagacccccaaatgcccctatctta
tcaacacttccggagactactgttattagacaacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactcccaatgttagtattccttgcactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgaatttgattatgc
cagctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatgtagtt
aatcattacttccaaacaagacattatttacacactctatggcaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgccgctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456656_FT00000_P-D Feature FT:source GU456656_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T9). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccccatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatctcacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcaccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtacgagatctgctagataccg
cctcagctctatatcgggaagccttagagtctcatgatcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaatgactctagccacctgggtgggtggtaatttggaagatccagtatccagggacctagtagtcag
ttatgttaacaccaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttataggccatcaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgagtcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcgtttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgaaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctctccaccagcaatcctctg
ggattctttcccgaccatcagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagatgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcaagc
aggcagcctacccctctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456663_FT00000_P-D Feature FT:source GU456663_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T86). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctctacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggaagttatggttcattgccacaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgaccccaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatacta
tgttggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatctagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgctagtattccttggactcataaggtgggaaac
tttacggggctttactcttccactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactacaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggcattaaaccctattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggccgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctacctctaccaatcgccagacagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700440_FT00000_P-D Feature FT:source HQ700440_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AD05_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggctgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaagrcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaccgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaagtgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700449_FT00000_P-D Feature FT:source HQ700449_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GE06_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcyacaaccttccaccaaackctgcaagatcccagagtgagrggcctgtatttycctgctggtggctccagttcaggaa
caktaaaccctgttccgactactgyctctcacatatcgtcaatcttctcgaggattggggaccctgcrctgaacatggag
arcaymacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggarctaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatctcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccacctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700459_FT00000_P-D Feature FT:source HQ700459_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HE55_1993). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagctccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700470_FT00000_P-D Feature FT:source HQ700470_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO59_1999). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattcttgggacggataactctgttgttctctcccgaaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactttctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatcttatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatagccctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700474_FT00000_P-D Feature FT:source HQ700474_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_PA31_1999). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctcttggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggaatcgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcacctttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcatcacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JF754599_FT00000_P-D Feature FT:source JF754599_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK173). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccat
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcggagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaatcctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcccctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccatcaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacacccttttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040796_FT00000_P-D Feature FT:source JN040796_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919018). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtccttgccacaagatcacatcatacagaaaattaaagattgctttagaaaacttcct
gttaacaggcccattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactctcggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcatctttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgatccttataa
agaattgggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagtgtactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacgtag
cgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040808_FT00000_P-D Feature FT:source JN040808_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919011). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccgcaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagaatctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtgcc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgcctttatatgcatgtattcagtcgaagcaggcttttaccttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactatctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccagtaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcatcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040823_FT00000_P-D Feature FT:source JN040823_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919005). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttacatttcatgg
gttatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaaacctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctaacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagaaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctccgtctccacctttgagaaacacgcaccctcaggccatgcagtggaa
>gnl|hbvnuc|JN257165_FT00000_P-D Feature FT:source JN257165_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHHLL1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgaggggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttcagactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgtcctmt
gattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccay
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtwtcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaggttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tacgtcaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggaacctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacatcgatccttataa
agaatttggagcctctgtggagttactctcatttttgccttccgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggatgccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgactttagccacctgggtgggtggtaatttggaagatccaacatccagggatctagtagtcag
ttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacctttggaagagata
tagtcgtagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttcttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctacggttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaatgtcaccaaatatttgccattggataagggtatcaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataggagagaaacaacacatag
cgcctcattctgtgggtcaccatattcttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttktgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacacccatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257171_FT00000_P-D Feature FT:source JN257171_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHKML). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgacctggaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaaattcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccatcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagagaagaagactgcaattgattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagctttcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257176_FT00000_P-D Feature FT:source JN257176_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFRJ1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctmcacaaccttccaccaaactctgcaagatcccagagtgagaggcctgwmtttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacayatcgtcaatcttctcgaggattggggaccytgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccracttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcraggtatgttgcccgtttgtcctcw
amttccarrmtcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccay
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacmgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttwtgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttccy
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcmtgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgcgtaaacaatacctgracctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttygrctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccatgtcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaattgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcmcctctgcctaktc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtgcagttactctcgtttttgccgyctgacttctttccttcagtacgagatcttctagataccg
cctcggctctrtttcgggaacccttagagtctactgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgamtctagccacctgggtgggtggtaatttgsaagatccaacatccagggacctagtagtcac
ttatgttaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacgtgaatgttagtattccttggactcataaggtgggatcc
tttacggggttttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctmatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggyatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacakcatgggtcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacamctggccagacgccaacaaggtaggagctggagcattcgggcygggaytcaccccaccgcacggaggccttttgg
ggwggagccctcaggctcagggcatactacamaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaracactcatcctcaggcyatgcagtggaa
>gnl|hbvnuc|JN257177_FT00000_P-D Feature FT:source JN257177_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHFRJ2). Complete genome. [Hepadnaviridae] (length=3185 residues).
ctmcacaaccttccaccaaactctgcaagatcccagagtgagaggcctgwmtttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacayatcgtcaatcttctcgaggattggggaccytgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccracttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcraggtatgttgcccgtttgtcctcw
amttccarrmtcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccay
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacmgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttwtgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttccy
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcmtgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgcgtaaacaatacctgracctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttygrctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccatgtcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaattgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcmcctctgcctaktc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtgcagttactctcgtttttgccgyctgacttctttccttcagtacgagatcttctagataccg
cctcggctctrtttcgggaacccttagagtctactgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgamtctagccacctgggtgggtggtaatttgsaagatccaacatccagggacctagtagtcac
ttatgttaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacaacatcaatgttagtattccttggactcataaggtggga
tcctttacggggttttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctmatatacattt
acaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgatta
tgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatcta
gttaatcattacttccaaaccagacattatttacacactctatggaaggcgggyatattatataagagagaaacaacaca
tagcgcctcattttgtggatcaccatattcttgggaacaagagctacakcatgggtcagaatctttccaccagcaatcct
ctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaa
caaggacamctggccagacgccaacaaggtaggagctggagcattcgggcygggaytcaccccaccgcacggaggccttt
tggggwggagccctcaggctcagggcatactacamaccttgccagcaaatccgcctcctgcctctaccaatcgccagtca
ggaaggcagcctacccctctgtctccacctttgagaracactcatcctcaggcyatgcagtggaa
>gnl|hbvnuc|JN257183_FT00000_P-D Feature FT:source JN257183_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHKSH). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatytccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttatcgaggattggggaccytgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcarttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctttaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctttcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaacaatgcctgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttcaatacgagatcttctagataccg
ccgcagctctgtatggggaagccttacagtctcctgagcattgctcacctcaccatacagcactcaggcaagcaattctg
tgctggggggacctaatgaatctagctacctgggtgggtggtaatttggaagacccagtatccagggacctaatagtcgg
ttatgtcaacactactgtgggcctaaagttcaggcaactattgtggtttcacatttcctgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccttcttttcctaatatacatttaca
ccaagacattattaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaakgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtatattatatawgagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctccggcctcwaccaatcgccagtcggga
aggcagcccaccccgctgtctccaccgttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257186_FT00000_P-D Feature FT:source JN257186_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHDHM). Complete genome. [Hepadnaviridae] (length=3191 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggktatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctca
aattccaggatcttcaacgaccagcacgggamcatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatrtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttctgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcaaacagaaaatcaaggaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcmggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacgtcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcaaccaatgcctgcccaaggtcttacataagaggactcttggac
tctctgtaatgtcaacaaccgaccttgaggcatacttcaaagaytgtttgtttaaagactgggaggagttgggggaggag
attagattaaaggtttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctc
tgcctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggaccttga
tccttataaagaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttc
tagataccgcctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaa
gcaattctgtgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagacccaacatccagggacct
agtagtcagttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttg
gaagagaaacagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcc
cctatcttatcaacacttccggagattactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcg
cagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataag
gtgggaaactttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccttcttttcctaatat
acatttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaat
taattatgcctgctagattctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaa
catctagttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaac
aacacatagcgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatggggcagaatctttccaccagc
aatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaacccagattgggacttcaa
tcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggag
gccttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgc
cagtcaggaaggcagcctaccccgctgtctccaccgttgagaarcactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642126_FT00000_P-D Feature FT:source JN642126_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb9). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagagacctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgagtcttggcaaaaattcgcagtccc
caacctccaatcactcacaaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcattttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagagcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttccacaaggtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactcggttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagttaagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattcta
tgctggggggatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaaaatattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaaggagactgcaattgattatgc
ctgctaggttttatccaaacgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacatggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaacccgcctcctgcctctaccaatcgtcagtcagga
aggcagcctacccctctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642142_FT00000_P-D Feature FT:source JN642142_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb32). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatctcgtcaatcttctcgaggattggggaccctgtgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgtcatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagccattgtatgcatgtattcagtcaaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaat
acacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaccaatccttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
cagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccatataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggacgccttagagtctcctgagcattgttcacatcatcatactgcactcaggcaagcaattcta
tgctggggggaactaatgactctagctacctgggtgggtggaaatttggatgatccaacatccagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaaatattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccgttggataagggtattaaaccttattatccagaacatacagtt
aatcattacttccaaaccagacattatttacacactctgtggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagccaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctctaagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642143_FT00000_P-D Feature FT:source JN642143_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb33). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtccttaccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattgtcgggacggacaactcggttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctcacgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctccgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctgatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagcactgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctgaagttcagacaaatattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttcttctgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactacaattaattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattagataagggtattaaaccctactatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctactccgctgtctccacctttgagagaaactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664937_FT00000_P-D Feature FT:source JN664937_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN45_LC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttctatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN688711_FT00000_P-D Feature FT:source JN688711_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV161). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagactgataggcctggatgtctctgctggaggctcaagttcaggaa
cagtaaaccctgttcccactacagcgtctcccttatcgtcgatcgtctcgaggattgtgaaccctgcgatgaacatggag
aacttccaatcaggattcctaggaccccttctcgtgttacaggcggggttttttttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagcgatggggttactctctaaattttatgg
gatatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgtttccgaaaacttcct
attaataggcctattgattggaaagtgtgtcagcgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctttacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtttgcgcaccagtaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactctagagttactttcttttttgccktctgacttctwtccttcggtacgagatcttctagataccg
cctcagctctgtrtcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattttt
tgctggggggaamtaatgactctagctacctgggtgggtgbtaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtcttacttttggaagagaaa
cagttgtagagtatttggtgtttttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccgtagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacacttaca
ccaagatattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccactggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccatcagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtytcaccccaccgcatggaggcctgttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN792903_FT00000_P-D Feature FT:source JN792903_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 310000127). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtccttgccacaagatcacatcaaacagaaaatcacagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcatcgattcttgcccaaggtcttacataagagaactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggacgccttaaagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagaatatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaattcgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN792904_FT00000_P-D Feature FT:source JN792904_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 111002943). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtccttgccacaagatcacatcaaacagaaaatcacagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcatcgattcttgcccaaggtcttatataagagaactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagattgggaggatttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggacgccttagagtctcctgaacatgtttcagctcaccatactgcactcaggcaagcaattctg
tgctggggggaattaatgactctagctacctgggtgggtgcgaatttggatgatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacgtttcttgtctcatgtttggaagagata
cggtcctagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaattcgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgtcaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707490_FT00000_P-D Feature FT:source JQ707490_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C29). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagattgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggatccctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707516_FT00000_P-D Feature FT:source JQ707516_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C15). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttctctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttcttgataccg
cttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707686_FT00000_P-D Feature FT:source JQ707686_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_14). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctacaaaaccttccaccaaactctacaagatcccaaagtgagtggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatagcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcctgcactcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgtagttctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagtacgagatcttcttgataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaggcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggatttcaatcccgacaa
ggacacctggccggacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacaatgcaaaccttgccagcaaatccgcctcctgtatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcaccctcaggccatacagtggaa
>gnl|hbvnuc|JQ707703_FT00000_P-D Feature FT:source JQ707703_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_45). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctacaaaaccttccaccaaactctacaagatcccaaagtgagtggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtcygtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatagcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcctgcactcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgtagttctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctgtcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagtacgagatcttcttgataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacaatgcaaaccttgccagcaaatccgcctcctgtatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcaccctcaggccatacagtggaa
>gnl|hbvnuc|JX096954_FT00000_P-D Feature FT:source JX096954_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 1-3242). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattaccacaagatcacatcatacagaaaatcaaagaatgttttcgaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccttctcggggccgcttgggcctctatcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtcctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagtagttag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttatggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggatttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagcccccaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JX898689_FT00000_P-D Feature FT:source JX898689_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P29). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
agcatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacaattaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccagcaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875302_FT00000_P-D Feature FT:source KC875302_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV86). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcatgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaccttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccaaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875334_FT00000_P-D Feature FT:source KC875334_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV47). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcgagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgcacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagacaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttacccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataccacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875337_FT00000_P-D Feature FT:source KC875337_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV46). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcggagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctccgggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaacattgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF061167_FT00000_P-D Feature FT:source KF061167_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RST_PAK_1a). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtagaccgtgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
gacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagwctgtacarcaycttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagwaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcatttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactccgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttayataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggargagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataattgggtctgcgcaccagcaccatgcaactttttcacctctgcctgatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccctataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcmacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactattcctgtctttaaccctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcggrctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggcccagggcatactacaaaccttgccagcacatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF061170_FT00000_P-D Feature FT:source KF061170_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RST_PAK_13a). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcagtcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggccttagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gatatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcatttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactccgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttayataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggargagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccctagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctggccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatatcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgagtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagactacaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccgttggataagggtattaaaccttattatccagamcatctagtt
aatcattacttccaaaccagacattmtttmyacactctatggaaggcgggtmtattmtmtaagagagaaacamcmcmtag
cgcctcattttgtggmtcaccmtmttcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagcctkcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagatgccaacaaggtaggagctggagccttcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF471640_FT00000_P-D Feature FT:source KF471640_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-86). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgaaagacctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttatcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcggagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggaggttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtctcttgggttttgctgccccgtttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtcaaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccctgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgatccttataa
agaatttggagcttctgtgaatttactctcgtttttgcctgctgactactttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtcttctgagcattgcacacctcaccatactgcactcaggcaagcaattctg
tgctggggggacttaataaatctatctacctgggtgggtagtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctcaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaag
tagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggcatattatataagagagaaactacacatag
cgcctcattctgtgggtcaccatattcttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggcccagggcatactacaaaccttgccagcaaatccgcctcctgcctcaaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttaagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF584165_FT00000_P-D Feature FT:source KF584165_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Da). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctracaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgracctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacraratcttctarataccg
cctcagctctgtatcgggaagccttaragtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgyacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaacctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagccttcgggcygggattcaccccaccgcacggaggccttttag
ggtggagccctcaggctcagggcatactacaaaccttsccagaaaatccgcctcctgcctctaccaatcgccagtcaggg
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggcaatgcagtggaa
>gnl|hbvnuc|KF679997_FT00000_P-D Feature FT:source KF679997_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-56). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactttgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttcgaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcttgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgt
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctcaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctgatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagttaatgagaaacgaagactgcatttaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtatcaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ647355_FT00000_P-D Feature FT:source KJ647355_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV247). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatcaacctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattgggggccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccttgccaaacctgcacractcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcgracggaaattgcacctgtattcccatcccatcatcctgggctttcgraaaattccta
tggragtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gctatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtctcttgggttttgctgccccttttactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacctacaagacctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggactgataactctgttgtcctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttgacctctttgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtttgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtgcagttactctcgtttttgcctgctgacttctttccttcagttcgagattttctagataccg
ccaccgctttgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaactctt
tgctggggagaactaatgactctagctacctgggtgggtggtaatttggaagatccagcatctagrgacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctctcttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccgtcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttcaaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM524354_FT00000_P-D Feature FT:source KM524354_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-058_HIV-HBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttattctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgcacctttaccccgttgcccggcaacggcaaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
acacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctctacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagttaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcgtatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacacataaggtgggcaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctgatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttatgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccaacaaatccacctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaaaactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366499_FT00000_P-D Feature FT:source KT366499_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O-EICI.11). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacgcaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacataatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacgcccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccactctacgtctgccctttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366500_FT00000_P-D Feature FT:source KT366500_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O-EICI.18). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaggatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcattcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaattcgtaggcccactcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttacccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU668441_FT00000_P-D Feature FT:source KU668441_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV170). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccagcttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgacaaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaagatcacatcatacttaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcactcaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtttggagcaaacgttctcgggactgacaactctgttgttctctcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgtttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctcgctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaactccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU736926_FT00000_P-D Feature FT:source KU736926_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Sudan_18). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttkcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcycatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccccaacaaaacaaagagatggggctactctctaaatttcatgg
gctatgtcattggatgttatgggtcactgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgcgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgtaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagcggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttrgagtctyctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcractcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagaatatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtttttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggcygggattcaccccaccacacggaggccttytgg
ggtggagccctcaggctcagggcatactacaatccctgccaacaaatccgcctccggcctctaccaaycgccagtcagga
aggcagcctaccccgctgtctccacctttgagaracactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX196209_FT00000_P-D Feature FT:source KX196209_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL094). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccctccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttggggacctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaatgttctagggggcactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaacttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX196219_FT00000_P-D Feature FT:source KX196219_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0104). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtacaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggac
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcattaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtcggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggactcctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX276857_FT00000_P-D Feature FT:source KX276857_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcgggaa
cagtaagccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggtccctgcgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccay
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacmgcatcttgagtccctttttacygctgt
taccaattttcttttgtctttgggtatacatttaaaccctmacaaaacgaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttcgaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccactycttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagaatgggaggagttgggggaggagattagatta
aygrtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctwctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
ccwcagctctgtatcgggaagccttagagtctcctgagcattgtwcacctcatcatactgctctcaggcaagcaatcctt
tgctggggggakytaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacmtttcttgtmtcacttttggaagagaaa
cggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcmgacgaag
gtctcaatcgccgcgtcgcagaagatctmaatctcgggaatcycaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagattgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccatyagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggcaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgctacataccgtgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KY382412_FT00000_P-D Feature FT:source KY382412_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D1_1896). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggyggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttyactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctggacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactmtcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgyacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcarttgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaacctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagccttcgggcygggattcaccccaccgcacggaggccttttag
ggtggagccctcaggctcagggcatactacamaccttgccagaaaatccgyctcctgcctctaccaatcgccagtcaggg
aggcagcctaccccgctgtctccaccwttgagaaacactcatcctcaggcaatgcagtggaa
>gnl|hbvnuc|KY629630_FT00000_P-D Feature FT:source KY629630_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TYM13097). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtcagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaycaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaaccggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgccgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtccccttctctgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtatttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatgtgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccttcttttcctaatattcatttaca
ccaagacattattaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KY629634_FT00000_P-D Feature FT:source KY629634_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KLMY16). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggccttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaacattctcgggacggataactctgttgtcctctcccgcaaat
atacagcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccactgcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggatgagattagatta
atgatttatgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctatccgtcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtggggggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttgtctcacttttggaagagata
tagtcctagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccagcaaatgcccctatctta
tcaacacttccggagactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagacgaactcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagatattatcaaaaaatgtgaacgatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaagccagacattatttagacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagcaggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatacttcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctactcctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MF925358_FT00000_P-D Feature FT:source MF925358_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD-HBV01). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcactttcggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataaggggattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH464854_FT00000_P-D Feature FT:source MH464854_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MA132). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttcgaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaatttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggactgataactcggttgtcctctcccgtaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcagacgacccctctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctccgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgtgaccttctagataccg
cctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagatctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgagnnnnnngcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
gggaactttactgggctttattcttctactatacctgtctttaatcctcattggaaaacaccatcttttcctaatataca
tttacatcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattga
tcatgcctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacat
ctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaac
acatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagc
aaacaccgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcat
tcgggctgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgcca
gcaaatccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|MH724215_FT00000_P-D Feature FT:source MH724215_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR3). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtaagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctaacaaaacaaagagatggggttactctctaaattttatgg
gctatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgtattgtgggtcttttgggttttgctgccccttttactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacatttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttttcggggtcgcttgggactttctcgtccccttctccgtctgccgttccgaccgacaac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttggagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcatatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggccctctcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH724221_FT00000_P-D Feature FT:source MH724221_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR11). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
attaacagacctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcacctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcacacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccataccgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttccggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaagatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttcaaaactagacactatttacacactctatggaaggcgggtatattatataagcgagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK052947_FT00000_P-D Feature FT:source MK052947_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137-1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcaacaaccttccaccaaactctacaagatcccagggtgaggggcctgtatttccctgctggtggctccagttcaggga
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcttggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aatcccaggatcctcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccgtcgtcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcatagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgctcagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaagatggggttactctcttaatttcatgg
gatatgtcattggaggttatggttcattgccacaagaacacatcatacacaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtgtgtcagcgaattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgcccgcagccggtctggagcaaacattctcgggactgataactctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcataatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgactcctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgtctctagctacctgggtgggcgctaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctctgtttcggaagggata
cggtcgtagcttatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaggttactgttgttagaggacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatcacaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaagaagattacaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
gatcattacttccaaactagacactatttacacattctttggaaggcaggtgtattatataagagagaaacaactcatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacactgcaaatccagattgggatttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagccggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
agtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK052973_FT00000_P-D Feature FT:source MK052973_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137Q-14). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcaacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtctc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtccact
aattccaggatcatcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaagatggggttactctcttaatttcatgg
gatatgtcattggatgttatggttcattgccacaagaacacatcatacacaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtgtgtcagcgaattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgcaaacaatacatgagcccttaccccgttgctcggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgataactctgttgtcctttcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ccgaatccggcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcaatacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcaatcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggcactaatttggaagatccagcatctagggacctaatagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagata
cggtcttaaattatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaggttactgttgttagaggacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattacaattgattacgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacattctttggaaggcaggtgtattatataagagagaaacaactcatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcgaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggccggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccactcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK507913_FT00000_P-D Feature FT:source MK507913_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HEP/14/0134). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcgaggaacctctacgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gttatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacgtcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagmttagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK541688_FT00000_P-D Feature FT:source MK541688_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 12/16/0148). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttatgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgttttcgaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtcctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctgatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccgtctgacttctttccttcagtacgagatcttctagataccg
cctcagctttgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattcta
tgctggggggacttaatgaatctaggtacctgggtgggtgttaatttgcaagatgaagcatctagggaccgagtagtcag
ttatgttaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagacaaa
cagtagtagaatatttggtgtctttcggagtgtggattcgcactcccccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaagattttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggcaggctggtatattatataagagagaaacaacacacag
cgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttctgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcaaga
aggcagcctaccccactgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598661_FT00000_P-D Feature FT:source MK598661_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg60). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacattccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttctatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacatgcacgactactgctcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggawgttatgggtcattgccacaagatcatatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgccaaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctatatcgggatgccttaaagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactt
tgctggggggaactaatgactctggccacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaagtgggtaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtaaacgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccggaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaattccagattgggacttcaatcccaacaa
ggacacctggccagacggcaacaaggtaggagctggagcattcgggctgggattcaccccatcgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagtaaatccgcctcctgcatccatcaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK618424_FT00000_P-D Feature FT:source MK618424_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh54). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccttgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcacggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcaaaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttctgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactccctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagtttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgatacca
cttcagctctgtatcgagaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaaggactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatttgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacaattccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK618436_FT00000_P-D Feature FT:source MK618436_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh61). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggaggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcggtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagtttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttcttgataccg
cttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtttattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagctttcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagacagga
aggcagcctacccctctgtctccacctttgagagacactcatcctcaggccgtgcagtggaa
>gnl|hbvnuc|MK693107_FT00000_P-D Feature FT:source MK693107_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ahvaz8). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctcg
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaactttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
agggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaaggtggggttactctttacattttatgg
gctgtgtcattgcatgttatgggtcattgccacaagatcacatcatactgaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtggaaacaatacctgaacgtttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattttcgggacggataactctgttattatctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggaataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtattcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacgtttaca
ccaagaaattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaaggagattgcaactgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaacaggacattatttacacactctatggaaggcgggtatattatataagagagaaacaacccatag
cgcctcattttgggggtcaccatattcttggaaacaagaactacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccgacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN507853_FT00000_P-D Feature FT:source MN507853_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2564_ocHBVd_GC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaggatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcatttccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctggacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccccttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaagactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcatttcttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacatggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|X80926_FT00000_P-D Feature FT:source X80926_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate patient 5). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtcaaccctgttccgactactgcctctaccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatatcattggatgtcatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatgttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctactgacttctttccttcagtacgagatcttctagataccg
ccacagctctatatcgggatgccttagaatctcctgagcattgtacacctcatcatactgcactcaggcaagcaattcta
tgctggggggaactaatgactctagccacctgggtgggtggtaatttgcaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccatcaaatgcccctatctta
tcaacacttccggagacttgtgttattagacaacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaacatacatttaca
ccaagacattatcaacaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtatcaaaccttattatccggaacatctagtt
aatcattacttccaaacccgacattatttacacacactatggaaggcgggtatattatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccatcagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcatggaggtcttttgg
ggtggagccctcaggctcagggcatgctacaaaccttgccagcaaatccgcctcctgcctccaccaatcgacagtcagga
aggcagcctacccctctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|X97849_FT00000_P-D Feature FT:source X97849_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate patient 3). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtacttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcctcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttattccttaaatttcatgg
gctatgtcattggctgttatgggtccttgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaagctaaacaagctttcactttctcgccaacttacaaggtctttc
tgtgtaaacaatacctgaacctttaccccgttgctaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtttggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcttttttgcctcatgacttctttccttcgctacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactt
tgctggggggacttaatgaatctagctacctgggtaggtgttaatttgcaagatccagcatctagggaactagtagtcaa
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaagtgggtaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtaaatgagaaacgaagactacaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccggaacacttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcaggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB090269_FT00000_P-D Feature FT:source AB090269_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3194 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctccaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaatctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgctttacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggtatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaataaatgtgaacaatttgtaggtccactcacagtcaatgagaacagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaacatggagaagaatctttccacc
agcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggactt
caatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacg
gaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaat
cgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB109476_FT00000_P-D Feature FT:source AB109476_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaaaactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcaatggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB109479_FT00000_P-D Feature FT:source AB109479_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttccaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaactcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcaatcaggcaagctatcctt
tgctggggggagttaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB267090_FT00000_P-D Feature FT:source AB267090_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ehime 22-HS). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcgctacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagaggacgaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaaccctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaactccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagccgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB674419_FT00000_P-D Feature FT:source AB674419_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GaziantepLCC16). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggga
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatgcc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtgttgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
ttccaattttcttttgtctttgggtatacatttaaaccctaacaaaacgaaaagatggggttactctttacatttcatgg
gctatgtcattggctgttatgggtcattgccacaagatcacattatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgaag
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagatttttgtattaggaggctgtaggcataaattggtctgcgcaccagtaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagcaatacta
tgctggggggaattaatgtctctagccacctgggtgggtggcaatttagacgatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagacaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagttaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctggtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagatctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaaccccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggcctcttgg
ggtggagccctcaggctcaaggcacactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgacagtcagga
aggcagccgacccctctgtctccacctttgagaaacactcatcctcaggccatacagtggaa
>gnl|hbvnuc|AY233294_FT00000_P-D Feature FT:source AY233294_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 305). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggttgacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtgtgtcctct
aattccaggatcctcaaccaccagcacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtaccatttgttcagtggttcgtaaggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggctactctttaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttcgaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaatttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgtccgaccac
ggggcgcacctctctttacgcggactccccgtatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgtggccttctagataccg
cctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagatctagtagtcag
ttatgtcaacactaatatgggcctaaagtttaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaat
tttactgggctttattcttctactatacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttcaaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY661792_FT00000_P-D Feature FT:source AY661792_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ayw). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcttcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacagtgtgg
ttatcctgctttaatgcctttatatgcatgtattcagtccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
gtacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaagtattgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtacgtgatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgaacattgttctcctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttccggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacgggtctttattcttctactgtacctgtctttaaccctcattggaaaacatcctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccgctcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttag
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctacctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY741796_FT00000_P-D Feature FT:source AY741796_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR-IPI-P3). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttggcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccgtcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactccttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
acgggctggggcttggtcatgggccatcagcgcatgcggggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactatctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatccagagacctagtagtcag
ttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcacaaaatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagacaagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctccgtctccacctttgagaaacacgcaccctcaggccatgcagtggaa
>gnl|hbvnuc|DQ304551_FT00000_P-D Feature FT:source DQ304551_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatcttcctgctggtggctccagttcaagaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagaatagatta
atgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcatctctgccgaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcctttttgccttctgacttctttccgtcggtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgaacattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactttagccacctgggtgggaggtaatttgcaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaacacagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgtcagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccacgaagtggaa
>gnl|hbvnuc|DQ336678_FT00000_P-D Feature FT:source DQ336678_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtggggagc
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ464172_FT00000_P-D Feature FT:source DQ464172_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT2). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttctttggtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagtacgagatcttctagataccg
ccttagctctgtttcgggacgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtggattcgcactcccccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcaggtcccctacaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcaggaatctcactgttagttattcttggactcataaggtgaggagc
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaacatacatttacc
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgccctcttttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatgctacaaactctgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594402_FT00000_P-D Feature FT:source EU594402_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaagaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594431_FT00000_P-D Feature FT:source EU594431_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccactaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatattcatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcgattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594433_FT00000_P-D Feature FT:source EU594433_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaacatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gttatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccttctcggggccgcttaggcctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagtagttag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttatggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattaattatgc
ctgctaggttttatcctaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU787441_FT00000_P-D Feature FT:source EU787441_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W32). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcttgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgtatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccatcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaaaacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagctttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggcgctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU787447_FT00000_P-D Feature FT:source EU787447_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W46). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgagtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cttgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgccgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
tctagcagcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
atggtctttgtattaggagactgtaagcataaattggtctgcgcacctgcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ349215_FT00000_P-D Feature FT:source FJ349215_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H82). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgaatctccctgctggtggctccagttcaggaa
caggaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgatacaggcggggtttttcttgttgataagaatcctcacaataac
gcacagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtgttgtccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaaggtggggttactctttacattttatgg
gctatgttattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaatagacta
aaggcctttgtgctaggaggctgtatggataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaataactctatccacctgggtgggtggtaatttggaagatccaacatcccgggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaagatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattctgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggtggccttttgg
ggtggaggcctcaggctcagggcatactacaaaccttgcctacaaatccgcctcctgcctctaccaatcgtcagccagga
aggcagcctaccactctgtctccacctttgagaaacacgcatcatcaggcaatgaagtggaa
>gnl|hbvnuc|FJ899792_FT00000_P-D Feature FT:source FJ899792_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D146-1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagagacctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacgtcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccaccggcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cttgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaatagatta
atggtttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccatccgtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaatgactctagccacctgggtgggtggtaatatggaagatccagtatccagggacctagtagtcag
ttatgttaacactaatgtgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cggtcttagagtatttggtgtctttcggagtgtggattcgcgctcctccagcttttagaccacaaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaagcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaaccacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctctccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggcgctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904438_FT00000_P-D Feature FT:source FJ904438_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B32). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcggtgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtgcaccaycttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctgcattttatgg
gttatgtcattggaagttggggatcattgccgcaagatcatatcagacacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcccattgattggaaagtgtgtcaacgaattgtgggtcttcttggttttgctgcccctttcacacaatgtgg
ttatcctgcgttaatgcctttatatgcatgtattcaatctaagcaggcgtttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggactgacaactctgtcgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggatctctcgtcctcttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatttttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccatcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagccgttctt
tgctggggggaactaatgactctagctacctgggtgggtggaaatttggaagatccaacatctagggacctagtagtcag
ttatgtcaatactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctaacttttggaagacaaa
ccgtcgtagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagaccaacaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctaatgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttatcctaattgtaccaaatatttgcccttggacaagggtatcaaaccctattatccagaacatgtagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagccyacaccgctgtctccacctataagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ167301_FT00000_P-D Feature FT:source GQ167301_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM452). Complete genome. [Hepadnaviridae] (length=3188 residues).
ctccacaactttccaacaaactctgcaagatcccagagtgagaggcctgaatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactatcgaggtatgttgcccgtttgtccggt
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggcctttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgtttcaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtaggtcttttgggttttgctgcaccttttacacaatgtgg
ttatcctgctttaatgcccttgtacgcctgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctgggggttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatgggcatggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactct
ctgtaatgtcaacgatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaat
aggttaatgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgc
ctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatcc
gtataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatcttctag
ataccgcctcagctctatttcgggacgccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagca
attctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagt
agtcacttatgttaatactaatatgggcattaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaa
gagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccct
atcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctgttttcctaatataca
tttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagactgcaattga
ttatgcctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacat
ctagttaatcattacttccagaccagagattatttacacactctatggaaggcgggtatattatataagagagaaacaac
acatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaat
cctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcc
caacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggcc
ttttggggtggagccctcaggctcagggcatactacaaaccttgcaagcaaatccgcctcctgcttctaccaatcgccag
acgggaaggcagcctacccctctgtctccacctttgagagacactcatcctcaggccgcgcagtggaa
>gnl|hbvnuc|GQ167302_FT00000_P-D Feature FT:source GQ167302_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ZADGM4521). Complete genome. [Hepadnaviridae] (length=3188 residues).
ctccacaactttccaacaaactctgcaagatcccagagtgagaggcctgaatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccacatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgcgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactatcgaggtatgttgcccgtttgtccggt
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtctggcctttagttatacggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgtttcaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtaggtcttttgggttttgctgcaccttttacacaatgtgg
ttatcctgctttaatgcccttgtacgcctgcattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctgggcgttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatgggcatggagaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactct
ctgtaatgtcaacgatcgaccttgaggcatacttcaaagactgtttgtttacaaactgggaggagttgggggaggagaat
aggttaatgatctctgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgc
ctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgatcc
ttataaagaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatcttctag
ataccgcctcagctctatttcgggacgccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagca
attctttgctggggggaactaatgactctagccacctgggtgggtggtaatttggaggatccaacatccagggacctagt
agtcacttatgttaacaccaatatgggcataaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaa
gagaaacggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaaccttatagaccaccaaatgcccct
atcttatcaacacttcctgagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttagtattccttggactcataaggtg
ggaaactttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctgttttcctaatataca
tttacaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagactgcaattgg
ttatgcctgctaggttttatccaaaggttaccaaatatttgccatgggataagggtattaaaccttattatccagaacat
ctagtttatcattacttccagaccagagattatttacacactctatggaaggcgggtatattatataagagagaaacaac
acatagcgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaat
cctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcc
caacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggcc
ttttggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccag
acgggaaggcagcctacccctctgtctccacctttgagagacactcatcctcaggccgtgcagtggaa
>gnl|hbvnuc|GQ183448_FT00000_P-D Feature FT:source GQ183448_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4629). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaatcttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctat
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaccctttcgggctctcctgccgatccatactgaggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaact
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggattctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagaccatatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183449_FT00000_P-D Feature FT:source GQ183449_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4591). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctat
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcaacaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183459_FT00000_P-D Feature FT:source GQ183459_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4585). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctat
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttccgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477456_FT00000_P-D Feature FT:source GQ477456_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P84). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgaggggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccttgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttcctacagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcatgtttcagctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgactctagctacctgggtgggagctaatttggatgatccacaatctagggacctagttgttag
ttatgtcaacactaatgtgggcttaaagttcaggcaacttttgtggtttcacatttcttgtctcacgtttggaagagata
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcgcctcgcagaccaag
atctaaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttaatattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtcttcaaccctcattggaaaacaccctcttttcctaatatacatttacg
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggctaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatcttatataagagagaaacaacacatag
cgcctcattttatgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcaacccaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ477458_FT00000_P-D Feature FT:source GQ477458_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P126). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaaaatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcatcaaaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcttgctcaaggaacctctatgtatccct
cctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaaggtggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattaccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgtattgtgggtcttttgggttttgctgcccctttttcacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttaggggaggagaatagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctggtgactactttccttccgtacgtgatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccagcatccagggacctagtagttgg
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctatagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaagggtaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
agacagcctacccctccaactctacctttgagacacactcatccccaggccatgcagtggaa
>gnl|hbvnuc|GU456640_FT00000_P-D Feature FT:source GU456640_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T12). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcccattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtattcagtcaaagcaggcttttaccttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagatgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttccgacttctttccttcagtacgagatcttctagataccg
cctcagctttgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatacta
tgctggggggaactgatgactctagctacctgggtgggtggtaatttggacgatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttagtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtataccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatacaagagagaaactacacatag
cgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccaattggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
gatggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456645_FT00000_P-D Feature FT:source GU456645_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T80). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctaggggaaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaacgaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggacgatgtggtgttgggggccaaatctgtgtcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcccgctttaatgcctttatatgcatgtattcagtcaaagcaggcttttacattctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccctactccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgatgcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagatta
aagttgtttgttttaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaatccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggacctaataactctatctacctgggtgggtggtaatttggaagatcccacatccagggacctagtagtcag
ctatgtcaacactaatatgggcctgaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtataccttggactcataaggtgggaaac
tttacggggctgtattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattctgtgggtcaccatactcttgggaacaagagctacagcatggggcagaatctctccaccagcaatccgctg
ggattctttcccgaccatcagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccggtcagga
agacagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456648_FT00000_P-D Feature FT:source GU456648_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T85). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatggatcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcatgtattcagtcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtgcgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattcta
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
gatggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctcyaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456649_FT00000_P-D Feature FT:source GU456649_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T57). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactggtggtggacttctctcaattttttagggggaacccccgtgtgtcttggccaaaattcgcagtccc
caacttccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctatttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagtacgagatcttctagataccg
cctcagctttgtatcgggaagccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggatctaataactctaagtacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggcccagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagtctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456650_FT00000_P-D Feature FT:source GU456650_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T62). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatgcc
gaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatcaaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccctgcttcgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctggaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggaccttgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctttgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcatttctg
tgctggggggaactaatgaatctagctacctgggtgggtggtaatttggaagatccaacatccagggacctaatagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcctgtctcaattttggaagagaaa
cagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaagtgtgagcaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgatcaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456651_FT00000_P-D Feature FT:source GU456651_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T34). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacattccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgcgggtcttttaggctttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggaccgataactctgttgttctctcccgaaaat
taacatcgtatccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactatctcgtcctcttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgatgcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aagatctttgtactaggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctagtatcgagttactctcgtttttgccttctgacttctatccttcagtaagagatcttctagataccg
cctcagctttatatcgagaagccttagaatctcctgagcattgctcacctcaccatactgcactcaggcaagcaattcta
tgctggggggaattaatgactttggctacctgggtgggtggtaatttggacgatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttgtagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctccatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctaattggaaaacaccatcttttcctaatatacatttaca
ccaagatattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattttgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatacaagagagaaactacacatag
cgcctcattctgtgggacaccatattcttgggaacaagagctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgatcaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcggactgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatattacaaaccttgccagcaaatccgcctcctgcctctaccaaccgccagtcagga
aggcagccgaccccgctgtctccacctttgagaaacactcatcctcaagcgatgcagtggaa
>gnl|hbvnuc|GU456666_FT00000_P-D Feature FT:source GU456666_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T2). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccaccaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggatactctttacattttatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaacaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcctgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttttttccttcggtaagagatcttctagataccg
cctcagctctgtatcgggaagctttagagtctcctgagcattgttcacctcaccatactgcactcaggcacgcatgtctt
tgctggggggacctaatgaacttagccacctgggtgggtggtaatttggaagatccaacatccagagacctagtagtcag
ttatgtcaactctaacatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cggtcgtagagtatttggtgtctttcggagtgtggatccgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcacaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactacaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggcattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatatcagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctactcctctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HM750155_FT00000_P-D Feature FT:source HM750155_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSF-1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccaccagcacgggtccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacacaaagatggggttactctttacatttcatgg
ggtatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtttgtcaacgtattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcagactttcactttctcgccaacttacaaggcatttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaatagatta
aaggtttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagatactg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctt
tgcttgggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccgttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700464_FT00000_P-D Feature FT:source HQ700464_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_KA40_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggctgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctccttttgtgggtctccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700511_FT00000_P-D Feature FT:source HQ700511_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_164317_2001). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttattctttacatttcatgg
gctatgtcattggatgttatgggtccttgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtatagtgggtcttttgggtttcgctgccccttttacacagtgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaagaaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcttgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctttcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagctatcctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttactaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacatctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JF754595_FT00000_P-D Feature FT:source JF754595_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK164). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatggatcattgccacaagatcacatcaaacagaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaaacaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggactggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgcctacggacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttagaagatccaacatccagggacctagtagtcag
ctatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctaccgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaaggctgcaattgattatgc
ccgctaggttttatccaaatgctaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaactagacattatttacacacgctatggaaggcaggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JF754603_FT00000_P-D Feature FT:source JF754603_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK8). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccacaacactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacattttatgg
gctacgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggattgggaggagttaggggaggagattagatta
aagatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctcaggacttctttccttcagtacgagatcttctagataccg
cttcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaatacta
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactcatatgggcataaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttttagaatatttggtgtctttyggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctaatgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccacaagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcacccctccgcacggaggccttttag
gatggagccctcaggctcagggcatactacaaaccctgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccctgcagtggaa
>gnl|hbvnuc|JN040775_FT00000_P-D Feature FT:source JN040775_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919049). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgaatactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtgctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggattgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatttggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgtattgtaggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
cagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcacgtatctctt
tgctggggggacctaatgaacttagccacctgggtgggtggtaatttggaagatccaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctaacttttggaagagata
cggttttagagtatttggtgtctttcggagtgtggattcgcactcctcccgcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacatactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagaaaatccgcctcctgcctccaccaatcgccagtcaggc
aggcagcctacccctctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040777_FT00000_P-D Feature FT:source JN040777_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919017). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaaacacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacgaaaagatggggctactctttacatttcatgg
gctatgtcattggatgtgatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gtcaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaatattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccatttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcctactattcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatctactagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcac
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtggggaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaagatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttacaaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgccgctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040797_FT00000_P-D Feature FT:source JN040797_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919021). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaaccggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaagacctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctttcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttgtctcacttttggaagagaca
cagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctctattcttctacggtacctgtctttaaccctcattggaaaacaccctcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacactttgtaggcccacttacagtcaatgagaaaagaagactgcaattgatcatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040806_FT00000_P-D Feature FT:source JN040806_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919066). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctctgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaagacctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactccgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgagacaggttccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcacaaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacactttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacacacatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040809_FT00000_P-D Feature FT:source JN040809_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919014). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgcatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcaatggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttatatgcatgtattcagtcaaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacatcctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtta
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagacta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccgcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagctttcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040812_FT00000_P-D Feature FT:source JN040812_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919027). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatgcc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaacaaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttacgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgccaacgtattgtgggtcttttggggtttgctgcaccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcatgtattcaatcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccgggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagccctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctg
tgctggggggatctaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctaatagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaaatattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacatactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacatggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040828_FT00000_P-D Feature FT:source JN040828_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919069). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagaatctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttagggtttgctgccccttttacacaatgtgg
gtatcctgctttaatgcccttgtatgcatgtattcaatcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttaaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcttggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagtttagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttaggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaaaatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcctctaccaatcggcagtcagga
aggcagcctaccccgttgtctccacctttaagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257163_FT00000_P-D Feature FT:source JN257163_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAZI). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgcccgtttgtcctct
acttccaggatcttcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgctgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtgsagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatccagggatctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagcccacaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257170_FT00000_P-D Feature FT:source JN257170_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJWB). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctcgggggaacgaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcgtacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgacg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcctaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aagacctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcttttttgcctggtgacttctttccttcagtacgagatcttctagataccg
cctcagctttatatcgggaagccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactttagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaatgttactaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagcccacaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctctgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257185_FT00000_P-D Feature FT:source JN257185_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHZYD). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcacgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccatgtcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttacaaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257190_FT00000_P-D Feature FT:source JN257190_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHYHY). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccatcaaactctgcaagatcccagggtgcgaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggrgtgggcctcagcccgtttctcctggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttctkttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtacgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggacaactcggttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctcacgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctccgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctgatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctrgataccg
cctcagcactgtatcgggatgccttagagtctcctgaacattgtacacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctgaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagatr
trgtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatctccgcgtcgcagaagatctcaatctagggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagattacaattaattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattagataagggcattaaaccctactatccagaacatctagtt
aatcattacttccaaaccagacattatttacacacgctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttctaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacatggccagacgccaacaaggtaggagctggagcattcgggctgggtttcacccctccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagccgaccccgctgtctccacctttgaggaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257202_FT00000_P-D Feature FT:source JN257202_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSLI). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaacgaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatccgacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgtattgtgggtcttttggggtttgctgccccttttactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtktacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaatgcctgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
cagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacctttataa
agaatttggagctaccgtggagttactctcgtttttgcctactgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgcacacctcaccatactgcactcaggcaagcaattcaa
tgctggggggaactaatgactctagctacctgggtgggtgggaatttggaagacccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaacccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttag
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccggtcagga
aggcagcctaccccgctgtcgccacctttgagagaaactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257203_FT00000_P-D Feature FT:source JN257203_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJKF). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttctgttatctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggktttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaggcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctatgccgatccatactgcagaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctstgcaa
tgtcaacgaccgaccttgaggcatacttyaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagktstttgtattaggaggctgtaggcataaattggtstgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagayaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccytcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaaggctgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccgtattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcaggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642138_FT00000_P-D Feature FT:source JN642138_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb28). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagctcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttgtagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctgtttatcgctggatgtgtctgcggcattttatcatc
atcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcgacgaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcactttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttccacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaatattctcgggacagataactctgttgttctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccttcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctcacgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtcacctgagcattgttcttatcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctaacttttggaagagaaa
cggtcacagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtgcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggcattaaaccttactatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatatacttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642148_FT00000_P-D Feature FT:source JN642148_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb40). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttaggaaacttccc
gttaacaggcctattgattggaaggtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcggtacggacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctcacgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaaccgccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttcggacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgatcattgtacacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtgctaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagtttaggcaaatattgtggtttcacatttcttgtctcacttttggaagagaca
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatattcacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactgcaattgatcatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccctattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataaaagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
agacccctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccaccactgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642153_FT00000_P-D Feature FT:source JN642153_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb47). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacacaaaatcaaggaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccactgtttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctttattccgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttatagaccacaaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtgcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggtcagacgccaacaaggtaggagctggagcattcgggctgggattcactccaccgcacggcggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642163_FT00000_P-D Feature FT:source JN642163_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb59). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggaactgcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggactttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaaactgtacagcatcttgagtccctttttactgctgt
taccaattttcttttatctttgggtatacatttaaaccctcacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattaccacaagatcacatcatacggaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatacctttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattgtcgggacggacaactcggttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctcacgtccccttctccgtctgctgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctccgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtgtttgtattaggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagtacgagatcttctagataccg
cctcagcattgtatcgggaagccctagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatttaatgactctagcaacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctgaagttcagacaactattgtggtttcacgtttcttgtctcacttttggaagagaaa
cggtaatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttcttctgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactacaattgattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattagataagggtatcaaaccctactatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcggga
aggaagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664912_FT00000_P-D Feature FT:source JN664912_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB49_IC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaacctgccgaacctgcatgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggatggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaagatcacatcatacttaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcactcaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaagccttttc
tgtgtcaacaatacctgaaccttttacccgttgcccggcaacggtcaggtctgtgccaagtttttgctgagccaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtttggagcaaacgttctcgggactgacaactctgttgttctctcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtccagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccccaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664920_FT00000_P-D Feature FT:source JN664920_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1903_IC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactccctacattttatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgccattatatgcatgtattcaagctaaacaggctttcactttctcgccagcttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatacagcactcaggcaagcaattctt
tgctggggggaactgatgactctagctacctgggtgggtggtaatttggaagatccagcgtctagagaattagtagtaag
ctatgtcaatgctaatatgggcctaaaactcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgttcctgtctttaatcctgactggcaaaccccctcttttcctcacattcatttgaa
agaggacattatcaacagatgtgaacaatttgtaggccctcttacagttaatgaaaaaaggaggttaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccctagataaaggcattaaaccttattatccggaacatacagtt
aatcattacttccaaactagacactatttacatattctgtggaaggcgggtattttatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664922_FT00000_P-D Feature FT:source JN664922_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DH01_IC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcaccgaatatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgggtgtcttggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggatcctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacatcatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtctgttcgagatctcctcgataccg
cctctgctctgtatcgggaggccttagagtctcctgagcattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggggaggtgacgaatctggccacctgggtgggaagtaatctggaagaccaagcatccagggaattagtagtaag
ctatgtcaatactaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctgctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttgtctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664928_FT00000_P-D Feature FT:source JN664928_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HE27_CHB). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctctattctctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgatgt
taccaattttcttttgtctttgggtatacatttaaaccctaccaaaactaaaagatggggttactctttaaatttcatgg
gctatgttattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagctcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataaaagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctccatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664938_FT00000_P-D Feature FT:source JN664938_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN46_LC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707503_FT00000_P-D Feature FT:source JQ707503_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C43). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707505_FT00000_P-D Feature FT:source JQ707505_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C45). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtcagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtttgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JX898691_FT00000_P-D Feature FT:source JX898691_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P17). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacaattaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875277_FT00000_P-D Feature FT:source KC875277_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV7). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagagcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttgtgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagttgaa
>gnl|hbvnuc|KC875287_FT00000_P-D Feature FT:source KC875287_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV18). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccacttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatccccaggccatgcagtggaa
>gnl|hbvnuc|KC875290_FT00000_P-D Feature FT:source KC875290_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV57). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccctccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttggggacctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaacttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875300_FT00000_P-D Feature FT:source KC875300_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV80). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875316_FT00000_P-D Feature FT:source KC875316_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV16). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caaccgccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacgtctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
agtggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttgtcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgatcttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttggggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagatacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF471642_FT00000_P-D Feature FT:source KF471642_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-65). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatattgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacacaagaggactattggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcatcatacgactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcagctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgtctttagccacctgggtgggtggaaatttggaagatccagtatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttgatattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF471655_FT00000_P-D Feature FT:source KF471655_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG-11). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacgacttttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctatttaccgctgt
ttccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtccttgccacaagatcacatcatacagaaaatcaaggaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtaggtcttttaggttttgctgccccgtttacacaatgtgg
ttatccagctttaatgcctttatatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcaatacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacatcaccatactgctctcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatctggaagatccaatatccagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagatcaggcaactattgtggtttcacatctcttgtctcacttttggaagagaaa
cagttttagagtatttggtgtccttcggagtgtggattcgcactcctctaccttatagaccaccgaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttactgtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtatcaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacactctctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagycctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacaaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF679989_FT00000_P-D Feature FT:source KF679989_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-49). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgccaacgaattgtgggtcttttgggttttgctgctccttttacccaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagtaatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaacatacatttaca
ccaagacattgtcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcagttgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctggtt
aatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcaaatacgcctcctgcttccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF922432_FT00000_P-D Feature FT:source KF922432_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate N011). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacctgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgacacctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctctaaatttcatgg
gttatgtcattggatgttggggatcactgccacaggatcatatcatatgcaaaatcaaaaattgtttcagaaaactccct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaatttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgacaactctgtggttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttggggccctgtcgtcctcttctctgcctgccgttccaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtactaatttagaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttctagagtatttggtgtcttttggagtgtggatccgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctagtatacatttaca
ccaagatattatcaaaaaatgtgaacagtttgtaggcccgcttacagttaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttatcctaattgtaccaagtatttgcccttggacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctgtggaaggcgggtgtgttatataagagagaatcaacacatag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccggggttcaccccaccccacggaggccttttgg
ggtggagccctctggctcagggcataatgcaaaccttgccggcaaatccgcctcctgcctccaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ470889_FT00000_P-D Feature FT:source KJ470889_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8034). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtactggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaamctctaygtatccct
cctgttgctgtayaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaacaaaacaaagagatggggtcattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaagatcacattatacttaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcgaacattctcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccaggcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgagatctactagatactg
ctgcagcgctgtatcgggatgccttagagtctcctgagcattgttcaccgcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtactaatttagaagatccagcatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttctagagtatttggtgtcctttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcctaatatacatttaca
ccaaaatattattgaaaaatgtgaacagtttgtgggccccctcacagtcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttaccctaatgttaccaaatatttacccttggacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtgttttatataagagggaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaattccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccagggttcaccccgccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatamtacamaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ470895_FT00000_P-D Feature FT:source KJ470895_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8120). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgwatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaacaaaacaaagagatggggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaagatcacattatacttaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggccttttgggttttgctgcccctttcactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgycaacttacaaaacctttc
tgcgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgataactctgttgttctttcccgcaagt
atacatcgtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacccttgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttgctgtcgtttttgcctactgacttctttccttccgtccgagatctactagataccg
caacagcgctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaattaatgactctagctacctgggtgggtactaatttagaagatcaatcatccagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcagacaactattgtggtatcacacttcttgtctcatgtttggaagagaaa
cggttcaagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtggggagt
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcctaatatacatttaca
ccaaaatattattgaaaaatgtgaacagtttgtgggccccctcacagtcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttaccctaatgttaccaaatatttacccttggacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgttttatataagagggaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaattccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccgccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatcatacaaaccttgccagcaaatccacctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM524349_FT00000_P-D Feature FT:source KM524349_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV.I-015_HIV-HBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagcaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttactctttaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacatactctttggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
gatggagccctcaggctcagggcataatacaaactttgccagtaaatccgcctcctgcatccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KP090177_FT00000_P-D Feature FT:source KP090177_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR2). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgattactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaactgcct
atcaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttatttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccataccgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaagttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KR905424_FT00000_P-D Feature FT:source KR905424_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI-42). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttccactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366501_FT00000_P-D Feature FT:source KT366501_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O-EICI.23). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaggatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcattcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgcacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtgggtccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366502_FT00000_P-D Feature FT:source KT366502_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O-EICI.27). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaggatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcattcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366506_FT00000_P-D Feature FT:source KT366506_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.18). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttccactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366509_FT00000_P-D Feature FT:source KT366509_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C-EICI.26). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttccactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749828_FT00000_P-D Feature FT:source KT749828_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FL13). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtggggctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactccttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcctgtattcacgctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggagct
cctagccgcttgttttgctcgcagcaggtctggagcgaacattctcgggacggataactctgttgttttatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtagcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccgactgacttctttccttcggtacgagatcttctagataccg
cctcagctctgtatcgggatgctttagagtctcctgagcattgttctcctcaccatactgcactcaggcaagcaatactt
tgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatcctgcatctagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcaaacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaagtgggtaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaactccctcttttcctaatatacatttaca
cccagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtaaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccggaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU668435_FT00000_P-D Feature FT:source KU668435_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV-HCV102). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgatttctttccgtcagtccgagatcttctagataccg
cctcagctctatatcgggatgcgttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgactttcgctacctgggtgggtactaatttggaagatccagcatctagggacctagtggtcag
ttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcccaatatacatttaca
ccaagacatcatcaacaaatgtggacagtttgtaggccctcttactgtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatccagaacatctagtt
aatcattactttcaaaccagacactatttacacactctatggaaagcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggac
>gnl|hbvnuc|KX196236_FT00000_P-D Feature FT:source KX196236_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0121). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacaacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccaaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX827292_FT00000_P-D Feature FT:source KX827292_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate geno3.1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtattatcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttaccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcagcgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
t