HBVdb

Dataset for nucleotide sequence Genomes of genotype D

[Download (right click)] [Alignment] [Repertoires]

1174 sequence(s)

>gnl|hbvnuc|AB104709_FT00000_P-D Feature FT:source AB104709_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EG64). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgttcttgccttctgacttctttccttcagtacgagatctactagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatctagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacgggactttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattattaaaaaatgtgagcaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904426_FT00000_P-D Feature FT:source FJ904426_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B4). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcatcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tatgtaaacaatacytgcacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aagatctttgtattgggaggctgtaggcataaattggtctgcgcaccagcaccatgcacctttttcacctctgcctaatc
agctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaatacta
tgctggggggaactaatgactctagccacctgggtgggtgctaatttggaagatccaacatctagggacctagtagtcag
ttatgttaacaataatatgggcgtaaagttcaggcaactattgtggtttcacatttcttgtctaacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccaccatatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacaacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgctagtattccttggactcataaggtgggaaac
tttacggggctttattcttccactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatattcatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacacctagtt
aatcattacttccaaaccagacattatttacatactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcacccctcctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|JQ707684_FT00000_P-D Feature FT:source JQ707684_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_11). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctacaaaaccttccaccaaactctacaagatcccaaagtgagtggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatagcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcctgcactcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgtagttctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagtacgagatcttcttgataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacaatgcaaaccttgccagcaaatccgcctcctgtatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcaccctcaggccatacagtggaa
>gnl|hbvnuc|AB674406_FT00000_P-D Feature FT:source AB674406_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IstambulB23). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattcccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaagatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggagccaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcttcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcrtcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaaggtggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggycttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcmtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactccgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccagtatctagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaacatacatttaca
ccaagacattatcaaaagatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaaatgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaacaagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattctgtgggtcaccttattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacaactggccagatgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggcccagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JF754595_FT00000_P-D Feature FT:source JF754595_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK164). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatggatcattgccacaagatcacatcaaacagaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaaacaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggactggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgcctacggacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttagaagatccaacatccagggacctagtagtcag
ctatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctaccgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaaggctgcaattgattatgc
ccgctaggttttatccaaatgctaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaactagacattatttacacacgctatggaaggcaggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875284_FT00000_P-D Feature FT:source KC875284_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV28). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcgcagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgccgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatttgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgacaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594421_FT00000_P-D Feature FT:source EU594421_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacgaccttccaccaaactctacaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctagacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgaacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttatggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040829_FT00000_P-D Feature FT:source JN040829_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919089). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtatctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttttagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggacctaatgaatctagctacctgggtgggtagtaatttggaagatccaacatccagggacctagtagtaag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
tagttatagagtatttggtatctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggccctctcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatccgcaggccatgcagtggaa
>gnl|hbvnuc|JN257171_FT00000_P-D Feature FT:source JN257171_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHKML). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgacctggaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaaattcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccatcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagagaagaagactgcaattgattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagctttcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ304549_FT00000_P-D Feature FT:source DQ304549_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatcttcctgctggtggctccagttaaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaacaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagaatagatta
atgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcctttttgccttctgacttctttccgtcggtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgaacattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactttagccacctgggtgggaggtaatttgcaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactctctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaagtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgtcagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccacgaagtggaa
>gnl|hbvnuc|JN257209_FT00000_P-D Feature FT:source JN257209_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHAMR2). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagkccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaaggtggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgtttcagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctctaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggatgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactttctcgtcctcttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggamctaatramtctakccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtatcaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707527_FT00000_P-D Feature FT:source JQ707527_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C44). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttatctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttcttgataccg
cttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU787447_FT00000_P-D Feature FT:source EU787447_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W46). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgagtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cttgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgccgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
tctagcagcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
atggtctttgtattaggagactgtaagcataaattggtctgcgcacctgcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JF754590_FT00000_P-D Feature FT:source JF754590_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK41). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagaccccagagtgaggggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgaccactgtctctcatatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacccgaacaaaacaaaaagatggggttactccttacatttcatgg
gctataccattggatgttatgggtcattgccacaggatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcgcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
cagttgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggatttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatttcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagattcaacatccagggacctagtagtcgg
ttatgttaactctaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctagggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctatattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctccggcctctaccaatcgccagtcagga
aggcaacctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642142_FT00000_P-D Feature FT:source JN642142_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb32). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatctcgtcaatcttctcgaggattggggaccctgtgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgtcatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagccattgtatgcatgtattcagtcaaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaat
acacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaccaatccttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
cagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccatataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggacgccttagagtctcctgagcattgttcacatcatcatactgcactcaggcaagcaattcta
tgctggggggaactaatgactctagctacctgggtgggtggaaatttggatgatccaacatccagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaaatattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccgttggataagggtattaaaccttattatccagaacatacagtt
aatcattacttccaaaccagacattatttacacactctgtggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagccaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctctaagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642145_FT00000_P-D Feature FT:source JN642145_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb36). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacactgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctggtcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcaaacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcctgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattcta
tgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagacccagtatccagggacctggtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtcgccatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaacccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JX898689_FT00000_P-D Feature FT:source JX898689_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P29). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
agcatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacaattaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccagcaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875275_FT00000_P-D Feature FT:source KC875275_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV39). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctgctggctccagttcaggaa
cagtcaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgctagtcggga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875280_FT00000_P-D Feature FT:source KC875280_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV20). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacctgccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaccctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactccaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM524349_FT00000_P-D Feature FT:source KM524349_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagcaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaagagatggggttactctttaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacatactctttggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
gatggagccctcaggctcagggcataatacaaactttgccagtaaatccgcctcctgcatccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM524351_FT00000_P-D Feature FT:source KM524351_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aaaatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccacccgcgtgggaccatgcaaaacctgcacgactactgttcaaggaacctctatgtatccct
actgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggtgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagatatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcatttaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
agatacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggaggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664922_FT00000_P-D Feature FT:source JN664922_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DH01_IC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcaccgaatatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgggtgtcttggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggatcctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacatcatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccgtctgttcgagatctcctcgataccg
cctctgctctgtatcgggaggccttagagtctcctgagcattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggggaggtgacgaatctggccacctgggtgggaagtaatctggaagaccaagcatccagggaattagtagtaag
ctatgtcaatactaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctgctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttgtctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MF618341_FT00000_P-D Feature FT:source MF618341_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgcgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH724237_FT00000_P-D Feature FT:source MH724237_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR28). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagcgatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagactgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcagcgaattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
atatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttttgactcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttgcataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttngggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcaatacgagatcttctagataccg
cctcagctctgtaccgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagagaactagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacgtttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcatatagaccagtaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtggggaac
ttaactgggctttattcttctactgttcctgtatttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgatcaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggag
>gnl|hbvnuc|EU414136_FT00000_P-D Feature FT:source EU414136_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacgcaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaaggtggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgtgctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggaattactctcgtttttgccttctgacttctttccttccgtacgagatctgctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctattttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatattaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggsgggtatattatataagagagaaacaacacatag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccattcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904445_FT00000_P-D Feature FT:source FJ904445_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B62). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagaatctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtccttaccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgtaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcgtggagaccaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccaygcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcytgttgacttctttccttcagtacgagatcttctggataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaag
tggtcctagagtatttggtgtcttttggagtgtggattcgcactcctccagcatatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacaacgaggcaggttccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaacc
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcacaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccggaacacctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaagctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
aggcaacctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040814_FT00000_P-D Feature FT:source JN040814_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919032). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacattccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaagattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggggtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtcaaagcaggcttttactttctcgccaacttacaaggcctttc
tatgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagatgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactg
tgttggggagacctaatgactctagctacctgggtgggtggtaatttggaagatccagtatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccggcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB205128_FT00000_P-D Feature FT:source AB205128_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggttccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcttcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaagtaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttccccttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcctccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctccgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccttctcggggccgcttgggcctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaatgcttgcccaaggtcttgcataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctaggggcctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttatggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttagtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaaggcattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattaattatgc
ctgctaggttttatcctaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattcttccccgaccaccagttggatccagccttcagagcaaacaccgcacatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875324_FT00000_P-D Feature FT:source KC875324_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV59). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccacactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtatcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaagtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagacaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacaacgaggcaggtcccccagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaaaaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875326_FT00000_P-D Feature FT:source KC875326_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV37). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccacttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgcacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gctatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaccgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagacaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttacccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttgggtccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcatacgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactgatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707700_FT00000_P-D Feature FT:source JQ707700_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_36). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctacaaaaccttccaccaaactctacaagatcccaaagtgagtggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatagcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcctgcactcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgtagttctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagtacgagatcttcttgataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacaatgcaaaccttgccagcaaatccgcctcctgtatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcaccctcaggccatacagtggaa
>gnl|hbvnuc|KF471658_FT00000_P-D Feature FT:source KF471658_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG_4). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccagactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaaaactgggaggagtggggagaggagtttagactt
atgtgctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttctcctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaataaatttatccacctgggtgggtggtaatttggaagatccgatatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacatactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM524341_FT00000_P-D Feature FT:source KM524341_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EHBV128_EP). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtacaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattgaaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataacaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcacaccaccgcacggaggccttttgg
ggtggagccctcaggatcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaacagccagtcagga
aggcagcccaccccgctgtctccaccttcgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ924652_FT00000_P-D Feature FT:source GQ924652_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M89). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcaggcagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcttgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctggtagtcag
ttatgtcaacactaatatgggcttaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaca
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctgtattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcagttaattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcggga
aggcagcctaccccgctgtctccacctttgagaaacactcatccacaggccatgcagtggaa
>gnl|hbvnuc|JN040799_FT00000_P-D Feature FT:source JN040799_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919080). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccaaaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctactcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctatttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaggatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaaccggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttccggctcctctaccgatccatactgcggaact
cctagccgcttgttttgcccgcagcaggtctggggcaaacattctcgggacggataactccgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgcttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aagttgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacaaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacatgcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacatactctatggaaggcgggtatattatacaagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggatttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040809_FT00000_P-D Feature FT:source JN040809_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919014). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgcatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcaatggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttatatgcatgtattcagtcaaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacatcctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtta
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagacta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccgcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagctttcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY741795_FT00000_P-D Feature FT:source AY741795_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccgtcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactccttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
acgggctggggcttggtcatgggccatcagcgcatgcggggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactatctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatccagagacctagtagtcag
ttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcacaaaatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagacaagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctccgtctccacctttgagaaacacgcaccctcaggccatgcagtggaa
>gnl|hbvnuc|JN257152_FT00000_P-D Feature FT:source JN257152_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRJB). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccytgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgctgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagwctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactccttgcatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgcttcagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttggggctctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgcttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcaccacaccatactgcactcaggcaagcaattctg
tgctggggggamctaatractctakctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttaccgggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagatattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaacgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatacaagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctatctccacctttgagaaacactcatcctcaggccatgcagtggag
>gnl|hbvnuc|KF679996_FT00000_P-D Feature FT:source KF679996_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EICI). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaataccaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacatactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccacctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ349230_FT00000_P-D Feature FT:source FJ349230_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C7). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctcctacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcaaacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgtcctctcccgcaaat
atacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtgtttgtattaggaggctgcaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatcccacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaca
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctaccgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacactttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttactaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatatacttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctcctcctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040826_FT00000_P-D Feature FT:source JN040826_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919055). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacattccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtaggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtcttccgtttcgaccgtccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaaccctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598640_FT00000_P-D Feature FT:source MK598640_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg18). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgtttcaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccagaatcttcaaccaccagcacgggaccttgcagaacatgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcacgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgattcatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccatgtcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttacaaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctctgggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456683_FT00000_P-D Feature FT:source GU456683_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T101). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcaacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcaccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcccctgccgatccatactgcggagct
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaggttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcacaaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaagatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcgttcggactgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagccaacccctctgtctccacctttgagaaacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|MH724235_FT00000_P-D Feature FT:source MH724235_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR26). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgaccactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccgggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctacattttatgg
ggtatgttattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgcctactgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcaatcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagagaccaagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcatttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgtgcttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctaaatctcgggactctcaatgttaatattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagcgggagcattcgggctgggtttcacccccccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacacacatcctcaggccatgcagtggaa
>gnl|hbvnuc|X65257_FT00000_P-D Feature FT:source X65257_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gctatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccgggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcctgaccttgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcatttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaat
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgatcatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ236016_FT00000_P-D Feature FT:source HQ236016_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate RS3). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccttgcgcagaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcgtactaaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtttgtcaacgaattgtgggtcttttgggctttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgcattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcctgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggtcgcttgggactctctcgtccccttctccgtctgccattccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaggctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaatgactctagctacctgggtgggtggtaatttggaagatccagtatctagagacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattattaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacacactttgccaacaaatccgcctcctgcatccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JF754626_FT00000_P-D Feature FT:source JF754626_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK23). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccagaaacttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccgaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaacccgaacaaaacaaaaagatggggttactctttacatttcatgg
gctataccattggatgttatgggtcattgccacaggatcacattgtacagaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaattgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggcgctactgtggagttactctcgtttttgcctgatgacttctttccttcagtacgagatcttctagatgcca
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactctagccacctgggtgggtggtaatttggaagatcaaacatccagggacctagtagtcag
ttatgttaacactcatatgggtcttaagttcaggcaactattgtggtttcacttttcttgtatcatgtttggaagagaaa
cggttgtagagtttttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctatattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccaaatcatctagtt
aatcattacttcaaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgccactaccaatcgccggtcagga
aggcagcctacccctctgtctccacctttgagagacactcatcctcaggctatccagtggaa
>gnl|hbvnuc|KM524350_FT00000_P-D Feature FT:source KM524350_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaagtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgctaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HM750153_FT00000_P-D Feature FT:source HM750153_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate XJW). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagcaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaatcttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacctcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgccgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggtataaattggtctgcgcatcagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctagtatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccactaggtaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagatgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875291_FT00000_P-D Feature FT:source KC875291_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV58). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcaccttctcgccaccttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatccgcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgacgcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtgaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaatcttattatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM524344_FT00000_P-D Feature FT:source KM524344_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK070_EP). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aaaatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcaaaacctgcacgactcctgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gatatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtcctctg
ttgtgtcaaccctaatatgggcctaacgttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttattgaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagatatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcatttaattatgc
ctgctaagttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
agatacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257193_FT00000_P-D Feature FT:source JN257193_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRKN1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaatcctaacaaaacaaaacggtggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagaatgtttcagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtac
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaakgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH724234_FT00000_P-D Feature FT:source MH724234_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR25). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccaccaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaccaaaacaaanagatggggttactctctaaattttatgg
gttatgtcattggaggttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttcgcaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgcagcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctacagtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctccgctctgtttcgggaaggcttagagtctcctgatcattgcacacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatcaaccatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttatggtttcacatttcttgtctcacttttggaagagaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacgcttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactctacctgtcttcaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcacaagatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacaccgctatctccacctttgagaaacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|MH932714_FT00000_P-D Feature FT:source MH932714_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Hiroshima). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccacaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttactaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB188241_FT00000_P-D Feature FT:source AB188241_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KAMCHATKA25). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttcaacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgatgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctatcctct
aattccaggatcgtcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttgaattttatgg
gctatgtcattggatgttatgggtcattgccacaggatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtatcgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgccattgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtttgccgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagactagatta
aagatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccatcagtacgagatcttctagataccg
cctcagctctmtatcgggaagccttagagtctcctgagcattgttcacntcaccatactgcactcaggcaagcaattctt
tgttggggggaattaatgactctagctacctgggtgggtgctaatttggaagatccaacatctagggacgcagtagttag
ttatgtcaacactaatatgggcctaaagtttaggcaacttttgtggttccacatttcttgtctcacttttggaagagata
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacccaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatattccttggacacataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattgggaaacacccttttttcctaagatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtgggcccactcacagtcaatgaaaaacgcagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgcccttggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
gttggagccctcaggctcagggcataatacaatccttgccagtaaatccgcctcctgcatccaccaatcgccagtcagga
aggcaacctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH724225_FT00000_P-D Feature FT:source MH724225_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR16). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccttatcatcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gatatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggcctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttgacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctnccggggagttactctcgtttttgccttctgacttttttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctgggggaaactaaggattctagctacctgggtgggtgttaatttaaaagatccagcatctagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgtggttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttacccttggataagggtattaaaccttattatccagaacatatagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN310709_FT00000_P-D Feature FT:source MN310709_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BG_46_2010). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttyacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatrggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
awgrtctttgtactgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctatccttcagtacgacaacttctagataccg
cctcagccctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagctattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttttagagtatttggtgtctttcggagtgtggattcgcactcctccaacttatagaccacccaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacattttca
ccaagacattatcaaaaattgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatcctaaggttaccaaatatttacctttggataagggtattaaaccttcttatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggcctggtgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcccaccccgctatctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183476_FT00000_P-D Feature FT:source GQ183476_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4603). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaatcttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacaacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagtaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ205380_FT00000_P-D Feature FT:source GQ205380_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1245). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcacggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagagcacattatacacaagctgaaagaatgttttagaaaactccct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaa
tgtcaacgaccgatcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcccaatatacatttaca
ccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctctgagagacactcatcctcaggccatgcagtggac
>gnl|hbvnuc|KC774436_FT00000_P-D Feature FT:source KC774436_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate dww1008). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagagggctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctaacaaaacaaagagatggggttactctctcaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ctatcctgctctaatgcccttgtatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccggctgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagctaccgtggagttactctcttttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccgcagccctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcccgcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtatttaaccctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattattaaaaaatgtgaacagtttgtaggcccactcacagtcaatgaaaaaagaagattgcaattgattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttactatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaagggcggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacac
cgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggc
tgggattcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaaccttgccaacaaat
ccgcctcctgcctctaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ904419_FT00000_P-D Feature FT:source FJ904419_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A70). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgtttcaggcggggtgtttcttgttgacaagaatcctcacaatgcc
gcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcagcatcttgagtccctttttaccgctgt
ttccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggttattctctacattttatgg
gttatgtcattggatgttggggatccttgccgcaagatcatatcatacacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcccattgattggaaagtgtgtcaacgacttgtgggtcttctgggttttgctgcccctttcacacaatgtgg
ttatcctgcgttaatgcccttatatgcatgtattcaatctaaacaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttctcggaactgacaattctgtggttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggatctatcgtcctcttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcttacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagctattctt
tgctggggggaactactgtctctatctacctgggtgggagtaaatttggacaatcaagcatctagggacctagtagtcgg
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagana
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgaagaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
ttaacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaagatgtgaacagtttgtaggcccgctcacaatcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttatcctaaacgtaccaaatatttgcccttggacaagggtatcaaaccctattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaacaatcccgattgggacttcaatcccaacaa
ggacacttggccagatgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggcggccttttgg
ggtggagccctcaggctcagggcataattcaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040802_FT00000_P-D Feature FT:source JN040802_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919074). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagtacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtcttgcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcctgtattcagtcgaagcaggcttttgctttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactttctcgtcctcttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgagcgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagattgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggacctaataactctatctacctgggtgggtggtaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagaggacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaacgagaaaagaacactacaattgattatgc
ctgctaggttttatcctaaggtcaccaaatatttgcctttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacgcctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaccactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU668447_FT00000_P-D Feature FT:source KU668447_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccatttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataagacgaaaagatggggttattctctacacttcatgg
gttatgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccgcaa
tgtcaacgaccgatcttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtcttcgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctcagcttaatc
atttcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagttactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664938_FT00000_P-D Feature FT:source JN664938_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EN46_LC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707522_FT00000_P-D Feature FT:source JQ707522_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C35). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttctctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttcttgataccg
cttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccggaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707523_FT00000_P-D Feature FT:source JQ707523_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C36). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttctctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttcttgataccg
cttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactatacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY161157_FT00000_P-D Feature FT:source AY161157_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
cagcctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagaatgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttccg
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtttgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttagggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaacttcttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacactgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatctcctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctggccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagaccactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaaaatacatttaca
ccaagacattatcaaaagatgtgaacaatttgtaggcccacttacagttaatgagaagagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875322_FT00000_P-D Feature FT:source KC875322_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV54). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaatccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagacaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatccta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattactttcaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccaaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcagatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366500_FT00000_P-D Feature FT:source KT366500_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaggatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcattcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaattcgtaggcccactcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttacccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY161151_FT00000_P-D Feature FT:source AY161151_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgaatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaaactctattcatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaacaatcatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattgaataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaaccacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904427_FT00000_P-D Feature FT:source FJ904427_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate B6). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgaccactgtatctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgccttggccaaaattcgcagtccc
cgacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggaaagaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattaccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttgcataagaggactcttggactctctgtga
tgtcaacgaacgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aarttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggacgccttagagtctcctgagcattgtacatctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtagtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggttycacatttcttgtctcacttttggaagagaaa
cggtcttagaatatttggtgtctttcggagtgtggattcgcactcctccagcatatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcccaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatatagtt
aatcattactatcaaaccagacattatttacacactctatgggaggcgggtatattgtataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagcgttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctccggcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|KX196216_FT00000_P-D Feature FT:source KX196216_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0101). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcctctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgcacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040785_FT00000_P-D Feature FT:source JN040785_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919022). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcaccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgcggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaacaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagagcatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaacctgccagaaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642159_FT00000_P-D Feature FT:source JN642159_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb52). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatggatcattgccacaagatcacatcagacagaaaatcaaagactgttttagaaaacttccc
gttaacaggcctattgattggaaggtctgtcaacgtatcgtgggtcttttgggttttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcggtacggacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatctcacgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctggtgacttctttccttcaatacgagatcttctagataccg
cctcagctctgtttcgggatgccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgctaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctgaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttcttctgtgcctgtctttaaccctcattggaaaacaccttcttttcctaatattcacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccctattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggactcctggccagacgccaacaaggtaggagctggagcattcgggatgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcaacctacaccgctgtctccacctctgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JX898691_FT00000_P-D Feature FT:source JX898691_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P17). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgaggggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacaattaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ336677_FT00000_P-D Feature FT:source DQ336677_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctgggtatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatgg
ggtatgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagtacgagatcttctagataccg
cctcagctctgtttcgggacgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtggggagc
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU787443_FT00000_P-D Feature FT:source EU787443_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate w40). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttcaaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggcaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttataccgctgt
taccaattttcttttgtctctgggtatacatttaaatcctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtaattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
ccttgccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatcaagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctaattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagttggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700440_FT00000_P-D Feature FT:source HQ700440_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AD05_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggctgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaagrcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaccgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaagtgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB078033_FT00000_P-D Feature FT:source AB078033_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IS1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatccaagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctggcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgttccgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcgctacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggacaccaaatatttgccattagattagagtatttaaacttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatcttatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaaccctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaactccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagccgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183478_FT00000_P-D Feature FT:source GQ183478_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4605). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccactaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctgaatttcatgg
gctatgtcattggatgttatgggtcattaccacaagaacacattacacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagtaatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttataggccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcattctacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM524355_FT00000_P-D Feature FT:source KM524355_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttatatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcatacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactttctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacgaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacgggactttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcattgaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagaatacaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagaggccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttag
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB246347_FT00000_P-D Feature FT:source AB246347_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcattcttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttacccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY661792_FT00000_P-D Feature FT:source AY661792_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate ayw). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcttcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacagtgtgg
ttatcctgctttaatgcctttatatgcatgtattcagtccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
gtacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaagtattgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtacgtgatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgaacattgttctcctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttccggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacgggtctttattcttctactgtacctgtctttaaccctcattggaaaacatcctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccgctcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttag
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctacctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JX096957_FT00000_P-D Feature FT:source JX096957_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 6). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattaccacaagatcacatcatacagaaaatcaaagaatgttttcgaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccttctcggggccgcttgggcctctatcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagaccgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagtagttag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttatggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtc
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggatttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagcccccaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB270541_FT00000_P-D Feature FT:source AB270541_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL47F). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgaccactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagaatgwrcagcatcttgagtccctttttaccgctgt
kaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgtttcgctcgcagcaggtctggggcgaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaatgtttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccatataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcgctcaggcaagcaattctt
tgctggggggatctaatcaatctatccacctgggtgggtggtaatttagaagatcaaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcactttcggaagagata
cggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttctgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttgatattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaagaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatcttatataagagagaaacaacacatag
cgcctcattttatgggtcatcatatccttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccaatcagga
aggcagccgacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ304550_FT00000_P-D Feature FT:source DQ304550_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT4). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatcttcctgctggtggctccagttcaagaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaacaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcagcgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcacccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagaatagatta
atgatttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcatctctgccgaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcctttttgccttctgacttctttccgtcggtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgaacattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactttagccacctgggtgggaggtaatttgcaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggccttaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgtcagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccacgaagtggaa
>gnl|hbvnuc|HM750151_FT00000_P-D Feature FT:source HM750151_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate GSD). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaacttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctgaattttatgg
gttatgtcattggatgttatgggtcattgccacaagaacacattatacaaaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccgacaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggaccgataactctgttgtactctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcgcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcatttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtaaatgagaaaagaagattgcagttgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgaaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggcctgttgg
ggtggagccctcaggctcagggcatattacaaactttgccagcaaatccgcctcctgtctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ349214_FT00000_P-D Feature FT:source FJ349214_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H61). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgcggagcatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgacaactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaatttcatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
actaacaggcctattgattggaaagtatgccaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgcgtaaacaatacctgaacctttaccccgttgcccggcaacgggcaggtctgtgccaagggtttggtgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatcaatcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaag
tagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatccta
tcaacgcttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttgctgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcgtttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattactttcaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaactcatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacaactggccagacgccaacaaggtaggagctggagcattcgggctgggtttcactccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagccgaccccgctgtctccacctttgagaaacactcatcctcatgccatgcagtggaa
>gnl|hbvnuc|KF471659_FT00000_P-D Feature FT:source KF471659_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtttttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggggtccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttatactgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcattcagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacgttctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaatgaacttagccacctgggtgggtggtaatttggaagatccagtatccagagacctcgtagtcgg
ttatgttaacactactgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttatggggctttactcttctactgttcctgtctttaaccctcattggaaaacgccctcttttcctaatatacatttaca
ccaagacattatcacaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactgcaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598659_FT00000_P-D Feature FT:source MK598659_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg72). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgttgtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gtcaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccaccagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggacaactctgttgttctctcccgcaaat
atacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatctgctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctgaagttcaggcaactattatggtttcacatttcttgtctcacttttggaagagaaa
cggtcattgagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctactatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattagataagggtattaaaccctattatccagaacatctggtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccaggatgggacttcaatcccaacaa
ggacacttggccagacgccaacaaggtaggagctggagcaytcgggctggggttcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcagctatcaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF471660_FT00000_P-D Feature FT:source KF471660_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
tgcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccggccttgaggcatacttcaaagactgtttgcttaaagactgggaggagttgggggaggagagtagactt
tgtctatttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttcttcccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttctcctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattctgtgggtcaccatattcttgggaacaagagatacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccaccgttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598649_FT00000_P-D Feature FT:source MK598649_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg15). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagataccagagtgagaggcctgtatttccctgctggtggctccagttcagcaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctacactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcccaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaaccccctcttttcctaatatacatttaca
ccaagacgttatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccaccgttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598677_FT00000_P-D Feature FT:source MK598677_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg41). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacaccaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaaacactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtgcagttactctcttttttgcctcatgacttctttccttcagtacgagatcttctagataccg
cctcagctctctttcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagctaatttggaagatccagcatctagggagctagttgttac
ttatgtcaacattaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctcaagcctatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccttattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctggtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctcctccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707690_FT00000_P-D Feature FT:source JQ707690_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_20). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctacaaaaccttccaccaaactctacaagatcccaaagtgagtggcctgtatttccctgctggtggcttcagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatagcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcctgcactcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgtagttctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagtacgagatcttcttgataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacaatgcaaaccttgccagcaaatccgcctcctgtatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcaccctcaggccatacagtggaa
>gnl|hbvnuc|KJ470896_FT00000_P-D Feature FT:source KJ470896_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8122). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccracttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcgsaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccccaacaaaacaaagagatggggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaagatcacattagacwtaaaatcagagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggtcatgggccatcagcgcatgcgcggaacctttctggctcctctgccgatccataccgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggactgataactctgttgttctctcccgaaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtccccttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaytagatta
aaggtgtttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgagatctactagataccg
ctgcagcgctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaattaatgactctagctacctgggtgggtgctaatttagaagatccagcatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaaaagawa
cggttctagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagaccaccraatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgmgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcctaatattcatttaca
ccaaaatattattgaaaaatgtgaacagtttgtgggccccctcacagtcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttaccctaatgttaccaaatatttacccttggacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacacyctatggaaggcgggtgttttatataagagrgaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaattccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccgccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatactacataccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgcygtctccacctctgagaaacactcatcctcargccatgcagtggaa
>gnl|hbvnuc|KM524338_FT00000_P-D Feature FT:source KM524338_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV136_EP). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggtccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttgttgttgcttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactcctgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatggatcattgccacaagagcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcatttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctcttctccgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactttctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atcacttgtacatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccagtatcccgggacctagtagtcag
ttatgttaacactactgcgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctgatatacacttaca
ccaagacattattaaaagatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgaaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgatcaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcagggaggccttttgg
ggtggaaccctggagctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagccgaccccgctgactccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KP322599_FT00000_P-D Feature FT:source KP322599_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H2811). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT749821_FT00000_P-D Feature FT:source KT749821_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate FL20). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttcgcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcctcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaactaaaagatggggttactctttacagttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctaggcaacggccgggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagatccaacatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagaactccatctcgggaatctcaatgttagtattccttggactcataaagtgggtaac
tttacggggctttattcttctactgcacctgtctttaaccctcattggaaaacaccctcgtttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggccctctcacagtaaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatgtagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggcctgttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctactccgctgtctccgcctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN310713_FT00000_P-D Feature FT:source MN310713_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BG_90_2010). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
gtgaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagatctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattacaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttcaaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456684_FT00000_P-D Feature FT:source GU456684_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T60). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccacaagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaactctgtacaacatcttgaagccctttttaccgctgt
taccaattttcttttgtctctgggcatacatttaaaccctaacaaaacgaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctatagattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
gtatcctgctttaaagcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggaggctagatta
ttgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgatccttataa
agaatttggagctactgtggagttactctcgtttttgcctcatgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggacgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgagtctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttgtctcacttttggaagagata
cggtcctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccagtaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacgggactttattcttctactgttcctgtctttaacccttattggaaaacaccctcttttccaaatatacatttaca
ccaagacattatcaaaaaatgtgaacaacttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttccaccagcaatcctctg
ggattccttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagatgccaacaaggtaggagccggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cggcagcctactcctctgtctccaccgttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700447_FT00000_P-D Feature FT:source HQ700447_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_CH02_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgcggacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattgtcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257199_FT00000_P-D Feature FT:source JN257199_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSOD2). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactattgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcttgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcaaacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgttttgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgccttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcctgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttagaagacccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaacccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY741794_FT00000_P-D Feature FT:source AY741794_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate IR). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccgtcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactccttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
acgggctggggcttggtcatgggccatcagcgcatgcggggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactatctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatccagagacctagtagtcag
ttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcacaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtggggaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagacaagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctccgtctccacctttgagaaacacgcaccctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700449_FT00000_P-D Feature FT:source HQ700449_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GE06_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcyacaaccttccaccaaackctgcaagatcccagagtgagrggcctgtatttycctgctggtggctccagttcaggaa
caktaaaccctgttccgactactgyctctcacatatcgtcaatcttctcgaggattggggaccctgcrctgaacatggag
arcaymacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggarctaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatctcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccacctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF584161_FT00000_P-D Feature FT:source KF584161_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1a). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctggacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacraratcttctarataccg
cctcagctctgtatcgggaagccttaragtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgyacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaacctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagccttcgggctgggattcaccccaccgcacggaggccttttag
grtggagccctcaggctcagggcatactacaaaccttgccagaaaatccgcctcctgcctctaccaatcgccagtcaggg
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggcaatgcagtggaa
>gnl|hbvnuc|JN642166_FT00000_P-D Feature FT:source JN642166_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb35). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
agcgtcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaccatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggaaccacagtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcctgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaccgcccaccagttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagatgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttcggacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagaatctcctgaccattgttcacctcaccatactgcactcaggcaagcaattctc
tgctggggggatctaatgactctagccacctgggtgggtggtaatttggaagatccaatttccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccttagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707479_FT00000_P-D Feature FT:source JQ707479_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C13). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgaccactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgtcaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK052972_FT00000_P-D Feature FT:source MK052972_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NP137Q). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcaacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggga
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggaa
aacatcacatcaggattcctaggactcctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgccttggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aatcccaggatcatcaacaaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttatcgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaacaaaaagatggggttactctcttaatttcatgg
gatatgtcatcggaagttatggttcattgccacaagaacacatcagacataaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtatgtcagcgaattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgctcggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccggcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtccgtgcctcctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttagagactgggaggagttgggggaggagactaggtta
aaggtctctgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgcctgctgacttctttcctacagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgtctctagctacctgggtgggcgctaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctctgttttggaagggata
cggtcgtagcttatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaggttactgttgttagaggacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattacaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctttggaaggcgggtgtattatataagagagaaacaactcatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattccttcccgaccaccagttggacccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacaactggccagacgccaacaaggtaggagccggagcattcgggctgggtctcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642148_FT00000_P-D Feature FT:source JN642148_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb40). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttaggaaacttccc
gttaacaggcctattgattggaaggtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcggtacggacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctcacgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaaccgccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttcggacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgatcattgtacacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtgctaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagtttaggcaaatattgtggtttcacatttcttgtctcacttttggaagagaca
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatattcacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactgcaattgatcatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccctattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataaaagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
agacccctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccaccactgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN688678_FT00000_P-D Feature FT:source JN688678_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV007). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaraaatggggttactctctaaaytttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
gttaaccggcctattgattggaaagtatgtcaacgtattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgttccgaccgactac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagcggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaaaactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccctgcgactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcaatacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcaatcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatccaggatctagagaccaagtagtcag
ttatgtcaacactaatatgggcctaaagttccggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttttagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatccta
tcaacacttccggagattgttgttgttagacgacgaggcaggacccytagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtggggaat
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttactaaatatttacccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggmtgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgcaagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN310711_FT00000_P-D Feature FT:source MN310711_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate CAX_130_2015). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactattcaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaatttcatgg
ggtatgtcattggatgtcatgggtccttgccacaagaacacatcgtacacaaaatcaaagaatgttttagaaaacttcct
rttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttyacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatrggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
awgrtctttgtactgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatgtaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagagacctagttgtcgg
ttatgtcaacactaatatgggcctaaagttccggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttacccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaagctagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccgccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacagactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacacgcaccctcaggccatgcagtggaa
>gnl|hbvnuc|GQ205388_FT00000_P-D Feature FT:source GQ205388_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1562). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataagacgaaaagatggggttattctctacacttcatgg
gttatgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaccttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcggggcgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcatccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctcagcaa
tgtcaacgaccgatcttgagccatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcccaatatacatttaca
ccaagacatcatcaacaaatgtggacagtttgtaggccctcttactgtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttactatccagaacatctagtt
aatcattactttcaaaccagacactatttacacactctatggaaagcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggac
>gnl|hbvnuc|JN040811_FT00000_P-D Feature FT:source JN040811_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919048). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccggatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataca
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtcattgccacaagatcacatcaaacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcccattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctctgtattcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactccgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacccccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaatagatta
catttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctattgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttttttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattcta
tgctggggggacttaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcgg
ttatgtcaacactactgtgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttgtagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgagcaatttgtaggcccactcacagtcaatgagaaaagaagactgaaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatgtagtt
aatcattacttccaaaccagacattatttacacactctgtggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN507852_FT00000_P-D Feature FT:source MN507852_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2562_ocHBVd_GC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccatcaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgtgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcccgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctcaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcgtactaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcagacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcaccttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccataagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacgttaacgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaacctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagtatctagagacctagtagtcag
ttatgtcaacactaatatggggctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattattaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttactaaatatttaccattggataagggtattaaaccttactatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccaccgctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183485_FT00000_P-D Feature FT:source GQ183485_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4599). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctccaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtcttgactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctctgaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcacacaaaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctaccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagtaatagaatagtatttggctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ccgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaagccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggcctttttg
ggtggaaccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040797_FT00000_P-D Feature FT:source JN040797_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919021). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaaccggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttatatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaagacctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctttcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgcggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttgtctcacttttggaagagaca
cagttatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctctattcttctacggtacctgtctttaaccctcattggaaaacaccctcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacactttgtaggcccacttacagtcaatgagaaaagaagactgcaattgatcatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM524345_FT00000_P-D Feature FT:source KM524345_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK082_EP). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtatttccctgctggtggctcaacttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgccgcacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaagacgaaaagatggggtcattctctacatttcatgg
ggtatgttattgattgttggggatcattaccacaagaacacattatacacaagctgaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tctgtaaacagtacatgcacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattatcgggactgataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaagatcttacataagaggactcttggactctccacaa
tgtcaacgaccgatcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgtacgagatcttctagataccg
ccgcagctctgtatcgggatgcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagcatctagggacctagtggtcag
ttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttgggagagaaa
cggttttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccaactttccctaatatacatttaca
ccaagacatcatcaacaaatgtgaacaatttgtaggccctcttactgtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttaccctaactttaccaaatatttacccttagataagggtattaaaccttactatccagaacatctagtt
aatcattactttcaaactagacactatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccaaaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgtcagtcagga
aggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggac
>gnl|hbvnuc|AB109478_FT00000_P-D Feature FT:source AB109478_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccaacaccatgcacctttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcagctcatcatactgcactcaggcaagctatcctt
tgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagggaccaagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcactccaccaccttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
tcaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgacaaccttgccagcaaatccgcctcctgcgtctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594430_FT00000_P-D Feature FT:source EU594430_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggctactctttaaatttcatgg
gttatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcgaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccttctcggggccgcttaggcctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagtagttag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttatggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattaattatgc
ctgctaggttttatcctaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM524347_FT00000_P-D Feature FT:source KM524347_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MK102_EP). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaccaaaactaaaagatggggttactctttaaatttcatgg
gctatgttattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactcggttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctttatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccctgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcagagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgttcctgtctttaacccgcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataaaagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456641_FT00000_P-D Feature FT:source GU456641_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T53). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttcaaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctccagtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcatcggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctctgtatgcatgtattcagtcaaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactccgttgttctttcccgtaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtgcagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattcta
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttacagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtgggaagc
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataaaagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatattacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacacacatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN792903_FT00000_P-D Feature FT:source JN792903_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 310000127). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtccttgccacaagatcacatcaaacagaaaatcacagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcatcgattcttgcccaaggtcttacataagagaactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggacgccttaaagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagaatatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaattcgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598660_FT00000_P-D Feature FT:source MK598660_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg27). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagataccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggawgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatctttcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgccaaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctgtatcgggatgccttaaagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaatactt
tgctggggggaactaatgactctggccacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaagtgggtaac
tttacggggctttattcttctactttacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtaaacgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccggaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcggggtgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccctgcaagtaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456635_FT00000_P-D Feature FT:source GU456635_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T26). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaagcctttatcttcctgctggtggctccagttcaggaa
cagtaacccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctaacaaaacgaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatgggtctttgccacaagatcacatcttacagaaaatcagagattgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
gtatcctgctttaatgcccttgtatgcctgtattcaatccaagcaggcttttactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtaatgggccatcagcgcatgcgtggaaccttttgggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactcggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggacgccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcatttctt
tgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagggagctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattattaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaacgaagattgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacatcacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggctcactacaaaccttaccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700470_FT00000_P-D Feature FT:source HQ700470_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MO59_1999). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattcttgggacggataactctgttgttctctcccgaaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactttctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatcttatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatagccctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN792908_FT00000_P-D Feature FT:source JN792908_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 111002951). Complete genome. [Hepadnaviridae] (length=3185 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacyaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaggacttgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtccttgccacaagatcacatcaaacagaaaatcacagaatgttttcgaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcatcgaccattcttgcccaaggtcttacataagagaactcttggactctctg
caatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagaatgggaggatttgggggaggagcttaga
ttaaaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgccta
atcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgaccctta
taaagaatttggagcttctgtggagttactctcgtttttgcctattgacttctttccttcaatacgagatcttctagata
ccgcctcagctctgtatcgggacgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaatt
ctttgctggggggaactaatgactctagctacctgggtgggtacgaatttggaagatcaaggatctagggacctagtagt
cagttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagag
aaacggtcttagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatc
ttatcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacc
aaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttgatattccttggactcacaaggtggga
aactttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcctaatatacattt
acaccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaatta
tgcctgctaggttttatccaaatggtaccaaatatttgccattagataagggtattaaaccttattatccagaacatcta
gttaatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacaca
tagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcct
ctgggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaa
caaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttt
tggggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtca
ggaagacagcctaccccgctgtctccccctttgagaaacacttatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040783_FT00000_P-D Feature FT:source JN040783_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919090). Complete genome. [Hepadnaviridae] (length=3182 residues).
caccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacagttcatgg
gctatatcattggatgttatgggtcattaccacaagatcacatcatacagaaactcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagatta
cagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagccacctgggtgggtggtaatttggaagatccagtatccagggacctagtagttag
ttatgttaacactaatgtgggcctaaaattcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgatgcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
gggggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JX898694_FT00000_P-D Feature FT:source JX898694_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P24). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactactgctcaaggaacctctatgtatccct
actgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaccaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattgggagttatgggtccttgccacaagaacacatcagacaaaaaatcaaggaatgctttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttaccggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttactaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagacagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598671_FT00000_P-D Feature FT:source MK598671_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg30). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcacgaa
cagtaaatcctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaataggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtcctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctggtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB090269_FT00000_P-D Feature FT:source AB090269_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3194 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatctccaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaatctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgctttacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggtatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaataaatgtgaacaatttgtaggtccactcacagtcaatgagaacagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaacatggagaagaatctttccacc
agcaatcctctgggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggactt
caatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacg
gaggccttttggggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaat
cgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB674411_FT00000_P-D Feature FT:source AB674411_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SamsunD84). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatctcctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaacgaccagtacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggttttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggaagttatgggtcattaccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctatcgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaaacaggctttcactttttcgcaaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagtaagagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggacgatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaactccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattggttatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctctggaaggcgggtgtattatataagagagaaactacacatag
cgcctcattttatgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattttttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcggactgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MF618343_FT00000_P-D Feature FT:source MF618343_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaagattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataagacgaaaagatggggttattctctacattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacattatacacaaaatcgaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctgtcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaagatcttacataagaggactcttggactctccacaa
tgtcaacgaccgatcttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccacgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccctctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatcctaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB674424_FT00000_P-D Feature FT:source AB674424_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AnkaraE24). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaaaatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggtccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtccact
aattccaggatcttcaacgaccagcacgggaccatgcagaacctgcacgagtcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccatcacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtccttgccacaagatcacatcagacacaaaatcaaagaatgttttcgaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccatttacacaatgtgg
ttatcctgccttaaagcccttgtatgcatgtattcagtcgaagcaggctttcaccttctcgccaacttacaaggtctttc
tgtataaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacttcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctatcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgagcgcccaccactgcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaggactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagttccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagctactgtggagttactctcgtttttgcctactgacttctttccttcagtacgtgatcttctagataccg
cctcagctctgtatcgagatgccttagactctcctgaacattgtactcctcaccatactgcactcaggcaagcaattttg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttgcaagatccaacatccagggacctagtagtcac
ttatgtcaacaccaatatgggcctaaagttccggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccagcaaatgcccctatctta
tcaactcttccggagacttctgttattagatccagaagcagggcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagacgactgcaattggttatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatcttatataggagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctccggcctctaccaatcgccagacagga
aggcagcctaccccgctgtctccacctttgagagacacccatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366494_FT00000_P-D Feature FT:source KT366494_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggggccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcacgtttgtcctct
aattccaggatcttcaaccaccagcgaggaaccatgcagaacctgcacgactactgttcaaggaatctctctacagccct
cctgttgctgtaccaaacgttcggaaggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatattgcggaact
cctggccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaacatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH724217_FT00000_P-D Feature FT:source MH724217_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR7). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgctctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtgggacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctagggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccatcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatccagggacctagttgttag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594424_FT00000_P-D Feature FT:source EU594424_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagctcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccgtctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacgccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtattttatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcaaagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183479_FT00000_P-D Feature FT:source GQ183479_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4607). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgcgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgg
gctacgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaatttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagccacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttccactgtacctgtttttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagtaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040768_FT00000_P-D Feature FT:source JN040768_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919051). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctttatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgccgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
tcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacttccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtactggtttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggcgaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtgattggatgttatggttcattgccacaagagcacatcatacagaaaatcaaagattgttttagaaaacttcct
gtaaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
gtatcctgctttgaagcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccaccagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aagttgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttcggtacgagatcttctagataccg
ccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaataactttatccacctgggtgggtggtaatttggaagatccaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcatgtttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacaaaatgcccctatctta
tcaacacttccggagactagtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacgcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacccccacttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacattttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggcatcaaaccttattatccagaacatctggtt
aatcattactaccaaaccagacattatttacacactctgtggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacaactggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ562338_FT00000_P-D Feature FT:source FJ562338_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I192). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccytgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgacttctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttactgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggatgttatgggtcattgccacaagaacacatcatacaaaaaatcaaagaatgctttggaaaacttcct
gttaacaggcctattgattgggaagtctgtcaacgaattgtggggcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccctgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggaccgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcgaggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgtacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccacctaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaaaacaccctcgtttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagtaaatgagaaaagaagattgcagttgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggcaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgaaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggcctgttgg
ggtggagccctcaggctcagggcatattacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707513_FT00000_P-D Feature FT:source JQ707513_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C11). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggattgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttctctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttcttgataccg
cttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366495_FT00000_P-D Feature FT:source KT366495_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttccactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700480_FT00000_P-D Feature FT:source HQ700480_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_RA37_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatrgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactatctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactgttgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctatctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707487_FT00000_P-D Feature FT:source JQ707487_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C25). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacttctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccatcagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctatctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU668442_FT00000_P-D Feature FT:source KU668442_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatgctccactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagaagaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagatatcatcaaaaaatgtgaacagtttgtaggtccactcacagtcaatgagaaacgaagattgcaattaattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaactttgccagcaaatccgcctcctgcatccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700514_FT00000_P-D Feature FT:source HQ700514_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_1664337_2001). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggttgttatgggtcgttaccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtatacaatctcggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcctcttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctatgcctaatc
atctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaggatccagcatctagggacctagtagtcag
ctatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagacctccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaacaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctagattttatccaaatgttaccaaatatttgcccttagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggtcttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707520_FT00000_P-D Feature FT:source JQ707520_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC3_C24). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttctctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttcttgataccg
cttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366496_FT00000_P-D Feature FT:source KT366496_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgacaactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642146_FT00000_P-D Feature FT:source JN642146_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb38). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagagccctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcgtgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaggctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctccactgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctcagtctgccgtttcgaccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcacctttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacctttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattcag
tgctggggggaattaatgtctctagctacctgggtgggtagtaatttggaagatccaacatccagggacctggtagttgg
ttatgtcaactctaatatgggcataaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaaccccttcttttcctaatatacatttacg
ccaagacattatcaaaaaatgtgaacaatttgttggcccactcacagtcaatgagaaaagaagactgaaattgattatgc
ctgctaggttttatccaaatgtcaccaaatatttaccattagacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggaatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccttgccaacaaatcagcctcctgcctctaccaaacgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KP995100_FT00000_P-D Feature FT:source KP995100_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 49). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacacatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctttatgtatccct
cttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgcatccaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttcctgcagtacgagatcttctagataccg
cctcagctttatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatcaaacatctagggacctagtggtcag
ttatgttaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatctggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacttggccagacgccaacaaggtaggagctggcgcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX196231_FT00000_P-D Feature FT:source KX196231_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0116). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggac
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaatttcta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattgaatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcattaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtcggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggactcctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456653_FT00000_P-D Feature FT:source GU456653_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T59). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaagccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggtccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcgcgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacgaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gtcaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aagttgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatctactagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttctcctcaccatactgcactcaggcaagcaatcctt
tgctggggggatttaatgtctctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggatccgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccatggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcgttggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaacaagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875304_FT00000_P-D Feature FT:source KC875304_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV91). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccacttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccattggttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaccttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacccggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgcttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccacctaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcatacgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttgagaaacactcatcctcagaccatgcagtggaa
>gnl|hbvnuc|KX196219_FT00000_P-D Feature FT:source KX196219_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBVFL0104). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtacaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggac
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcattaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtcggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggactcctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456677_FT00000_P-D Feature FT:source GU456677_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T46). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtatctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtccttgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttatatgcatgcattcaatctaagcaggctttcactttctcgcaaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaagcattctcgggacggacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcgtcacctctgc
acgtcgaatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccattcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattgatccctataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttccgtacgagaccttcttgataccg
cctcagctttatttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatggctctagccacctgggtgggtggtaatttggaagatcaaacatccagagacctagtagtcag
gtatgttaacactaatatgggccttaagttcagacaactattgtggtttcacgtttcttgtctcatttttggaagagaag
tggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaaggtcaccaaatatttgccattagataagggtatcaaaccttattatccagaaaatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaatccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040762_FT00000_P-D Feature FT:source JN040762_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919007). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagcaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtgttgggggccaagactgagcagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcagacagaaactcaaagactgttttcgaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgcctatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggcctttctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattagatta
caggtgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgtaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttccgtacgagatcttctagataccg
cctcagctctgtatcggggtgccttagagtcttctgagcattgttctcctcaccatactgcactcaggcaagcggttctt
tgctggggggatctaataaatttatccacctgggtgggtggtaatttggaagatccaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcgtatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacgcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacacctacttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcactgtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttctatcccaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattatttccaaaccagacattatttacacactctatggaaggcgggcatattatataagagagaaacaacacgtag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcttctaccaatcgccagtcagga
aggcaacctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707704_FT00000_P-D Feature FT:source JQ707704_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_5). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctacaaaaccttccaccaaactctacaagatcccaaagtgagtggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatagcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcctgcactcactctaagcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgtagttctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagtacgagatcttcttgataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtttcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacaatgcaaaccttgccagcaaatccgcctcctgtatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcaccctcaggccatacagtggaa
>gnl|hbvnuc|GQ477453_FT00000_P-D Feature FT:source GQ477453_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate P39). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttccaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcgtcctgggctttcggaaaattccta
tgggaatgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaggccctttttacagctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggtcactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacagtatctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattatcgggacggacaactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaagagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggatgccttagagtcccctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgaatctagctacctgggtgggaactaatttggaagatcaaggatctagggacctagttgttag
ttatgtcaacactcatatgggcttaaaattcaggcaacttttgtggtttcacgtttcttgtctcatgtttggaagagcag
tggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccagtaaatgcccctatctta
tcaacacttccggagacttctgttgttagatgccgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctaaatctcgggactcccaatgttagtattccttggactcacaaggtgggaaac
tttacagggctttattcttctacggtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaatcatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccytattatccagaacatctagtc
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgatcaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggatacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcttctaccaatcgacagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaagccatgcagtggaa
>gnl|hbvnuc|JN792911_FT00000_P-D Feature FT:source JN792911_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 111002952). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtaattggatgtcatgggtccttgccacaagatcacatcaaacagaaaatcacagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggaccgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccggttgggactctatcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccttgaaagctcatcaatgcttgcccaaggtcttacataagagaactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgggatcttctagataccg
cctcagctctatatcgggacgccttagagtctcctgaacattgttcacctcaccatacagcactcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtgtgaatttggaagatcaagcatctagggaccaagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagacaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacgacgaggcaggtcccctagaacaagaactccctcgcctcgcagacgaag
gtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtgcctgtctttaacccacattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaattcgtaggccctctcacagtcaatgagaaaagaagactgaaattggttatgc
ctgctaggttttatccaaatggtaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctcta
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcggga
aggcagcctactccgctgtctccacctttgagaattactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875290_FT00000_P-D Feature FT:source KC875290_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV57). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccctccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggatttggggacctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactattgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaacttgagtccctttataccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccacttttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB109477_FT00000_P-D Feature FT:source AB109477_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cggtcttagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183474_FT00000_P-D Feature FT:source GQ183474_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4594). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttgacaggcctattgattggaaagtctgtcaacgtattgggggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttccactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacccgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT603400_FT00000_P-D Feature FT:source MT603400_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 417). Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaycatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtccttgccacaagatcacatcaaacagaaaatcacagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtmtgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccggttaggactctctcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcatcgattcttgcccaaggtcttacataagagaactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggacgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaattcgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642154_FT00000_P-D Feature FT:source JN642154_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb48). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaaactcctcgacgactggggaccctgcgatgaacatggag
aaaatcatatcagaacacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgactccctttttaccgctgt
taccaattttctgttatctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgtcatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgtttcagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctccgctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttggggctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaatgcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagtttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttctgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcattaaggcaagcaattctg
tgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagacccaacatccagggacctaatagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cagtcatagaatatttggtgtctttcggagtgtggattcgcactcctctagcttatagaccaacaaatgcccctatctta
tcaacacttccggagactactgttgttagacaacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccttcttttcctaatatacatttaca
ccaagatattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactttatggaaggcgggatatttatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcctgggaacaagagatacggcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaacccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccacctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH724246_FT00000_P-D Feature FT:source MH724246_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR38). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacttttccggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcactacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagctaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcataaagttcaggcaacttttgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgaaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT603393_FT00000_P-D Feature FT:source MT603393_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 267). Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtccttgccacaagatcacatcaaacagaaaatcacagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtggrtcytttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacctacaaggcctttc
tgygtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgctcatcgatccttgcccaaggtcttacataagagaactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctaatgacttctttccttcagcacgagatcttctagataccg
cctcagctctgtttcgggacgccttagagtctcctgaacattgttcacatcaccatactgcaatcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtgcgaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagacaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaatacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcgaacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaagatgtgaacaattcgtaggcccactcacagtcaatgagaaaagaagactgcrcttarttatgc
ctgctaggttttatccaagtgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacwctctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcgttcgggctaggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB270539_FT00000_P-D Feature FT:source AB270539_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL200F). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccatgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctcaatttcatgg
gctatgtcattggatgttatgggtcattgccacaggaacacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgctctaatgcccttgtatgcatgtattcaatctaaacaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactcggttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaaatattgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtactaatttggaagatccggcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183464_FT00000_P-D Feature FT:source GQ183464_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4703). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctat
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctacggtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598679_FT00000_P-D Feature FT:source MK598679_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg33). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacaccaggattcctaggacccctggtcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaaccggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtgcagttactctcttttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctttcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttgcaagatccagcatctagggagctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctcaagcctatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaacccttattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaatcatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctggtgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ336690_FT00000_P-D Feature FT:source DQ336690_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaa
cagcaaaccctgttccgactactgcctctcctttatcgtcaatcttctcgaggatggggacccttgcactgaacatggag
aacatcacatcaagactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgggtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatgg
ggtatgtcattggaagttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttaccaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgcttgctgatgcaaccccc
actggctggggcttggccatgggccatctgcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggggcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttgtcccacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttataaaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtggggagc
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaacatacatttaca
ccaggacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgaaattgattatgc
ctgcaaggttttatccaaatactaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagtactacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggcttgggttcaccccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JF754619_FT00000_P-D Feature FT:source JF754619_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK62). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgccgaacatgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctgtgggtatacatttaaaccctaccaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaattaaagaatgttttagaaaacttcct
gttaacaggcctattgactggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggcttttactttctcgccaacttacaagacctttc
tgtataaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaatattctcgggacggataactctgttgttctttcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagatytttgtactaggaggctgtaggcataaattggtctgcgcaccagaaccmtgcgactttttcacctctgcctaatc
acctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggrcatggayatygatccttataa
agaatttggagctactgtgcagttactctcgtttttgcctcctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatttcgggaagccttagagtctcctgagcattgttcatctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcattgagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacaacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgcctttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctcctgcttctaccaatcgacagtcagga
aggcagcctacccctctgactccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257200_FT00000_P-D Feature FT:source JN257200_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHMNM). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaacaaactctgcaagatcccagagtgagaggcctgtattcccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaatctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccktttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcwggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgamcgcccaccagttcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
cagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacttccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactgcaaaccttgccagcaaatccgcctccggcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ464182_FT00000_P-D Feature FT:source DQ464182_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S4). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggcttcagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaagggatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgacttttgctcaaggaacctctatgaatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgctttaatgccattgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacttcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcagttctt
tgctggggggaactaatgactttagccacatgggtgggtggtaatttggaagatccaacatctagggacctagtagtcag
ttatgttaacactaatatgggcctaaaattcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatctccgcgtcgcagaagatctcaatctcgggaatctcaatggtagtattccttggactcataaggtgggaact
tttacggggctttattcttctactgttcctgtctttaacccgcagtggaaaacaccctcttttcctaatatacatttgca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaaggtcaccaaatatttgccattggataagggcattaaaccttattacccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcactatattcttgggaacaagagctacagcatggggcggaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacaactggccagacgccaacaaggtaggagctggagcattcgggctgggactcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagcctactcctctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594432_FT00000_P-D Feature FT:source EU594432_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccactaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatattcatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcgattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183482_FT00000_P-D Feature FT:source GQ183482_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4570). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccct
cttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttgcggggctttattcttccactgtacctgtttttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagtaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183473_FT00000_P-D Feature FT:source GQ183473_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4601). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtcccttattaccgctgt
taccatttttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctaccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttccactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaatcatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257150_FT00000_P-D Feature FT:source JN257150_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHABS). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagmggcctgwatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccytgcgckgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcacaatacc
gmagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaycatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacmggcctattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagccattgtacgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgcmgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctagggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagabtaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacattttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacayactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF471647_FT00000_P-D Feature FT:source KF471647_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtttccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggttattctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctttcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
cagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccataccgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtaccagtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaagctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040770_FT00000_P-D Feature FT:source JN040770_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919087). Complete genome. [Hepadnaviridae] (length=3182 residues).
cttcacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcctcttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttcagttcgagatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgttcagctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctaacttttggaagagaaa
cggtcttagagtatttggtatctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcggtctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875315_FT00000_P-D Feature FT:source KC875315_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV8). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccagaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccggcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactacgaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcatgcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacattacttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagatgattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtctattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
gctggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaatcactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF471655_FT00000_P-D Feature FT:source KF471655_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacgacttttcaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctatttaccgctgt
ttccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtccttgccacaagatcacatcatacagaaaatcaaggaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtaggtcttttaggttttgctgccccgtttacacaatgtgg
ttatccagctttaatgcctttatatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccggttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccaacaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcaatacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacatcaccatactgctctcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatctggaagatccaatatccagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagatcaggcaactattgtggtttcacatctcttgtctcacttttggaagagaaa
cagttttagagtatttggtgtccttcggagtgtggattcgcactcctctaccttatagaccaccgaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttactgtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtatcaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacactctctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagycctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctacaaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB471856_FT00000_P-D Feature FT:source AB471856_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate F3O). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggagcctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ336686_FT00000_P-D Feature FT:source DQ336686_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT5). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgctcgcggcgttttatcatc
ttcctcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcgaccaccagcacgggaccatgccggacctgcacgactcttgctcaaggaacctctatgtatcctt
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctaacaaaacaaaaagatggggttattctttaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaaccgccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtccgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aagggctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttccgtggagctactctcgtttttgccttctgacttctatccttcagtacgagatcttctagataccg
cctcagctctgtttcgggacgccttagagtcttccgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttgggctcataaggtggggagc
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040824_FT00000_P-D Feature FT:source JN040824_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919071). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggaa
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggatactctttacatttcatgg
gttatgtcattggatgttatgggtcattgccacaagatcacattaaacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtccaagcaggctttcactttttcgccaacttataaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttgttcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcatatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtatcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaagtcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggatattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgtacatgtcctactattcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagacaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaaaatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU787442_FT00000_P-D Feature FT:source EU787442_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate W37). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtcagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccctcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcataaagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgcagccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctctgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactgatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagtttaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacacccacttttcctaatatacacttaca
ccaagatattattaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgcaagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707489_FT00000_P-D Feature FT:source JQ707489_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C28). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtaccgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccacctaatgcccctatctta
tcgacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875303_FT00000_P-D Feature FT:source KC875303_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV92). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccacttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggtccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcatgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgaatctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcatacgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700459_FT00000_P-D Feature FT:source HQ700459_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_HE55_1993). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagctccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM519455_FT00000_P-D Feature FT:source KM519455_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D3_WT_SA). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttcgaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaatttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
tctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagaccgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgtgaccttctagataccg
cctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagatctcgtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactatacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598672_FT00000_P-D Feature FT:source MK598672_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg53). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctcctcgtgttacaggcggggtttttcttgttgacaagaatcctctcaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcaaaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttctgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttgaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaataggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagccattgtatgcctgtattcaatctagacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactccgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgaaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctctctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040759_FT00000_P-D Feature FT:source JN040759_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919063). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcctgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctggtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcactatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040805_FT00000_P-D Feature FT:source JN040805_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919058). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactattgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
agcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatcctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcaaacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctctgtatgcatgtattcaatcaaagcaggcttttactttctcgccaacttataaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactccgttgttctctcccgcaaat
atacatcatatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactcactgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacctttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttacg
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggcaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagacttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366493_FT00000_P-D Feature FT:source KT366493_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcaaaacctgcacgactactgttcaaggaacctctatatatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaccaaaactaaaagatggggttactctttaaatttcatgg
gctatgttattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttggggtttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactcggttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactttatcgtccccttcttcgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggacctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcctgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcgtttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataaaagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccacctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664912_FT00000_P-D Feature FT:source JN664912_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB49_IC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaacctgccgaacctgcatgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggatggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaagatcacatcatacttaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcactcaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaagccttttc
tgtgtcaacaatacctgaaccttttacccgttgcccggcaacggtcaggtctgtgccaagtttttgctgagccaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtttggagcaaacgttctcgggactgacaactctgttgttctctcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcttgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcgtccagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccccaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875316_FT00000_P-D Feature FT:source KC875316_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV16). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caaccgccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacgtctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
agtggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttgtcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgatcttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttggggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagatacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875330_FT00000_P-D Feature FT:source KC875330_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV87). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgtgttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
ccacagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagacaaa
cagttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcagatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcagggcatgcagtggaa
>gnl|hbvnuc|JF754631_FT00000_P-D Feature FT:source JF754631_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TK193). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatattgtcaatcttctcgaggattggggaccctgcgctgaccatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgggtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggtgcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcaccttgagtccctttatactgctgt
ttccaattttcttatgtctgtgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatggatcattgccacaagatcacatcatacagaaaatcaaagaatgttttcgcaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatcgaagcaggctttcacattctcgccaacttacaaggcctttc
tgtgtaaacaatacctgcacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgcctactgacttctatccttccgtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaattatt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttgtctcacttttggaagagaaa
cggtcttagagtttttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttcaaatgttcctgtctttaaccctcatgggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgcacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagcattcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcctacgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagccaaga
aggcagcctacccctcagtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257205_FT00000_P-D Feature FT:source JN257205_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHRYD). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaacaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttctgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcaaacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacgtcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcctgcccaaggtcttacataagaggactcttggactctctgtaa
tatcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaatagatta
atggtttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattcta
tgctggggggaactaatgactctagctacttgggtgggtggtaatttggacgacccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cagtcgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccttcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctagattctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtggatcaccatattcttgggaacaagagctacggcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaacccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctacctctaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642151_FT00000_P-D Feature FT:source JN642151_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb44). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttactgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gtcaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactcggttgttctctcccgtaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcatcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgcctgctgacttctttccttccgtacgagatcttctagataccg
cctcagctctatttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggagctaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacctttggaagagaaa
cggtaatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttcttctgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagatattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttactaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacacctctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700466_FT00000_P-D Feature FT:source HQ700466_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_MI26_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggctgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
tctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaagtgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaaaaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642131_FT00000_P-D Feature FT:source JN642131_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb16). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtagaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggagtggggaccctgcgttgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
ggcaagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctcgaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttttgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttcgaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttccacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagcgaactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN507837_FT00000_P-D Feature FT:source MN507837_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2505_ocHBVd_GC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caatgtccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgatcggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttg
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcgggggcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggtgattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttcccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaaatccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY721611_FT00000_P-D Feature FT:source AY721611_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate SK1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccgcaaccttccacgaaactctgcaagatcccagagtgagaagcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtatcaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaataggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttatccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatctactagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacttaatgactctagccacctgggtgggtggtaatttggaagatccagtatccagggacctaatagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtcgttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattgtcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaaggagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtatcaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggcctgttgg
gatggagccctcaggctcagggcatgctacacaccgtgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ349206_FT00000_P-D Feature FT:source FJ349206_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttcgcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctaggcaacggccgggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatctttcgtccccttctccgcctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaatagatta
aaggtttatgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcatttttgccttctgacttctttccttcggtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtggtaatttggaagatccaacatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtccttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctccatctcgggaatctcaatgttagtattccttggactcataaagtgggtaac
tttacggggctttattcttctactgcacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggccctctcacagtaaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccggaacatgtagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggattcaccccaccgcacggaggcctgttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccgcctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT603396_FT00000_P-D Feature FT:source MT603396_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 101161). Complete genome. [Riboviria] (length=3182 residues).
ctccamaaycttccaccaaactctgcaagatcccagagtgagaggcctgtattyccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggam
aacatcacatcaggattcctargacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggraactaccgtgtgtcktggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgttyctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
tacyaattttcttttgtctttgggtgtacatttaaaccctmacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtccttgccacaagatcacatcaaacagaaaatcacagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccggttrggactctctcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcatcgattcttgcccaaggtcttacataagagractcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagamtgggaggatttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggacgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggamctaatgactctagctacctgggtgggtgtgaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggttatagaatatttggtgtctttcggagtgtggattcgcactcctcmwkcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctyaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctyttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaattcgtaggccctctcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgwctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040794_FT00000_P-D Feature FT:source JN040794_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919075). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcaacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcagacaaaaaatcaaagaatgttttagacaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaactttatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgcttgggactatctcgtcctcttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccatataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttactaaatatttgccattggataagggtattaagccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JX470760_FT00000_P-D Feature FT:source JX470760_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate H). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacctttcaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggag
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcagcaaccaccagcacgggaccatgccgaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaacctttggacggaaattgcacctgtattcrcatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctgaattttatgg
gttatgtcattggaagttatgggtccttgccacaagaacacatcatacaaaaaatcaaagcatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaagcattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtatccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccgaatgttgcccaaggtcttacataagaggactcttggactctctacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcagttctt
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccagcatctagagacctagtagtcgg
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtcttacttttggaagagaaa
ccgttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactggtctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcctttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccacttacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcgttcgggccgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcatccaccaatcgcaagacagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598670_FT00000_P-D Feature FT:source MK598670_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg36). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaactttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctgtatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccaccagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctgaagttcaggcaactattatggtttcacatttcttgtctcacttttggaagagaaa
cggtcattgagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcacaaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttctatcccaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctggtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcatatccgcctcctatatctacctatcgccagtcagga
aggcagcataccccgctgtctccatctttgacagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594422_FT00000_P-D Feature FT:source EU594422_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaataggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgccattgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccgtataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagctcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgacgctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgaaattaatcatgc
ctgctaggttttatccaaatgttaccaaatatttaccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcactccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN688713_FT00000_P-D Feature FT:source JN688713_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV173). Complete genome. [Hepadnaviridae] (length=3185 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggawgttatgggtccttaccacaaccgcacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttgggtttcgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctcgcagcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccctcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcgtcacctctgc
atcatgtcgaatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactctkggactctctg
caatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtaga
ttaatgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccattcaactttttcacctctgccta
atcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgaccctta
taaagaatttggagctaccgtggagttactctcgtttttgcctrctgacttctttcctwccgtacgagatcttctagata
ccgcctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaatt
ctgtgctggggggaattaatgactctagctacctgggtgggtgttaatttggaagatcaatcctctagagacctagtagt
cagttacgtcaacaataatatgggcmtaaagttcaggcaactcttgtggtttcacatttcttgtcttacttttggaagag
aagtagtaatagagtatttggtgtyttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatc
ctatcaacacttccggagactactgttgttagacgagaaggcaggtcccctagaagaagaactccctcgcctagcagacg
aaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggg
aactttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacattt
acatcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgaaaaaagaagattgcaattgatta
tgcctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatcta
gttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatatcagagagaaacaacaca
tagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcct
ctgggattctttcccgaccaccagttggatccagccttcagagcaaataccgcaaatccagattgggacttcaatcccaa
caaggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccgccgcacggaggccttt
tggggtggagccctcaggctcagggcatactgcaaactttgccagcaaatccacctcctgcctccaccaatcgccagtca
ggaaggcagccgaccccgctatctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF584163_FT00000_P-D Feature FT:source KF584163_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S2a). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctggacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacraratcttctarataccg
cctcagctctgtatcgggaagccttaragtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgyacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcarttgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaacctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagccttcgggcygggattcaccccaccgcacggaggccttttag
ggtggagccctcaggctcagggcatactacamaccttgccagaaaatccgyctcctgcctctaccaatcgccagtcaggg
aggcagcctaccccgctgtctccaccwttgagaaacactcatcctcaggcaatgcagtggaa
>gnl|hbvnuc|GQ183466_FT00000_P-D Feature FT:source GQ183466_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4577). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctat
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700512_FT00000_P-D Feature FT:source HQ700512_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NC_182089_2001). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggttgttatgggtcgttaccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtatacaatctcggcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatccttcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcctcttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagrtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaggatccagcatctagggacctagtagtcag
ctatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagacctccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaacaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctagattttatccaaatgttaccaaatatttgcccttagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggtcttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707682_FT00000_P-D Feature FT:source JQ707682_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S13_1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctacaaaaccttccaccaaactctacaagatcccaaagtgagtggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaggattggggaccttgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgattactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacagaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatagcattggatgttatgggtcattgccacaagatcacatcagacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttgatgcccttatatgcctgcactcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgtagttctctcccgcaagt
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggctctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcttataa
agaatttggagctactgtggagttactctcgtttttgcctgctgacttttttccttcagtacgagatcttcttgataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacacaaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaggcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggccccctagaggaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctaggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacaatgcaaaccttgccagcaaatccgcctcctgtatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcaccctcaggccatacagtggaa
>gnl|hbvnuc|JN642133_FT00000_P-D Feature FT:source JN642133_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb21). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacagccttccaccaaactctgcaagatcccagagtgaagggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcacctccttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaaactcttcgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaccttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgagggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactttctcgtccccttctctgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaccgcccaccagttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtgtgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattcta
tgctggggggaattaatgactctagccacctgggtgggtggcaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttgtctcacttttggaagagaaa
cagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaatcctcattggaaaacaccctcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacactttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcgaatccagattgggacttcaatcccaacaa
agacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcggga
aggcagtctacccctctgtctccacctttgaggaacactcatcctcaggccgtgcagtggaa
>gnl|hbvnuc|JN642143_FT00000_P-D Feature FT:source JN642143_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb33). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtccttaccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattgtcgggacggacaactcggttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctcacgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctccgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctgatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagcactgtatcgggatgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggacctaatgaatctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctgaagttcagacaaatattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttcttctgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaacgaagactacaattaattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattagataagggtattaaaccctactatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatgatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctactccgctgtctccacctttgagagaaactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK618431_FT00000_P-D Feature FT:source MK618431_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh36). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggcccatgcagaacctgcacgactcctgctcacggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tatgtaaccaatacctgaacctttaccccgtttcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttcttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtatttgttttaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctttgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttacc
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagttaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcacaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgcaagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MF925379_FT00000_P-D Feature FT:source MF925379_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgaggggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggcacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgcacctttaccccgttgctcggcaacggccaggtctgtgccaagtatttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgttctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccctcccggggccgcttggggctctaccgtccccttcttcgtctgccgtaccgaccgtccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctgatattgcccaaggtattgcataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctttgtttcgggatgccttggagtctcctgagcattgctcccctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagacaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaaccaatgcccctatctta
tcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaatcatgc
ctgctaggttttacccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccggaacatctagtt
aatcattactttcaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacaagtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattcttccccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcaaggcataatacaaaccttgccagcaaatccgcctcccgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK693109_FT00000_P-D Feature FT:source MK693109_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Ahvaz31). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtggcccgttggtcctgt
aattccaggattctcaaccaccagcacgggaccatgcagaacctgcacgaatcctggtcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaaatgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcagagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttaggttttgctgcaccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactattggactctcagtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaatatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaaaaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT603398_FT00000_P-D Feature FT:source MT603398_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 2132). Complete genome. [Riboviria] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccaaagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggaa
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtccttgccacaagatcacatcaaacagaaaatcacagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtmtgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcctttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccggttaggactctctcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcatcgatccttgcccaaggtcttacataagagaactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagatta
atgatctttgtaytaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgcctwctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcggaacgccttagagtctcctgaacattgttcagctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactctagctacctgggtgggtgtgaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaattcgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcgttcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AM422939_FT00000_P-D Feature FT:source AM422939_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate X28). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctcaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgaggtcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagggaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaaccctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY721609_FT00000_P-D Feature FT:source AY721609_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate AA1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgacctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttcgaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggccttttgggttttgctgccccttttacacaatgcgg
ttatcctgctttaatgcccttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactttctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattagatta
aaggtgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttcttcccttcagtacgtgatcttctagatactg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcagtacttccaaaccagacattatttacacactctatggaaggtgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642153_FT00000_P-D Feature FT:source JN642153_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb47). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcatgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacacaaaatcaaggaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttcccggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccactgtttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctttattccgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacacttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttatagaccacaaaatgcccctatctta
tcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtgcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggtcagacgccaacaaggtaggagctggagcattcgggctgggattcactccaccgcacggcggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257203_FT00000_P-D Feature FT:source JN257203_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHJKF). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggaytcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcgaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttctgttatctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggktttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaggcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctatgccgatccatactgcagaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctstgcaa
tgtcaacgaccgaccttgaggcatacttyaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagktstttgtattaggaggctgtaggcataaattggtstgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagayaccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccytcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaaggctgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccgtattacccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcaggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF584165_FT00000_P-D Feature FT:source KF584165_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Da). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctracaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgracctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacraratcttctarataccg
cctcagctctgtatcgggaagccttaragtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacgcttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgyacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaacctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagccttcgggcygggattcaccccaccgcacggaggccttttag
ggtggagccctcaggctcagggcatactacaaaccttsccagaaaatccgcctcctgcctctaccaatcgccagtcaggg
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggcaatgcagtggaa
>gnl|hbvnuc|MF925393_FT00000_P-D Feature FT:source MF925393_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BD). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gatatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacgtcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaagcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggagagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaggctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcacaccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456665_FT00000_P-D Feature FT:source GU456665_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T76). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaactttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatctcctcgaggactggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctggtcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcagttttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacttgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactggtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaaatctgtgcaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaagaagatgggggtactctttacagttcatgg
gctatgtcattggaggttatggttcattgccacaagatcacatcagacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
gtatcctgctttaaagcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcctgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtaccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaatcattgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
atgatctttgtagtaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggcgcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgtacacctcaccatactgcactcaggcaagcaatttta
tgctggggggagctaataactctaagcacctgggtgggtggtaatttggaagatccaacatccagagagctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcactttcggaagagaaa
cagtcttagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggcattaaaccctattatccagaacatctagtt
aatcattacttccaagccagacattatttacacactctatggaaggcaggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcaaggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctactccactgtctccacctctgagagacactcatcctcaggctatgcagtggac
>gnl|hbvnuc|HQ700441_FT00000_P-D Feature FT:source HQ700441_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN10_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366499_FT00000_P-D Feature FT:source KT366499_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate O). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacgcaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacataatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacgcccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtcccactctacgtctgccctttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB330369_FT00000_P-D Feature FT:source AB330369_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TAJ5HBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaaaactaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttcgcaaacttcct
gttaataggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttgtatgcctgtattcaatctcggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtcctaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcgtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagttag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgcgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaacccgacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagatgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875282_FT00000_P-D Feature FT:source KC875282_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV13). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcgtctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcatgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaagccctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccagcgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaaacccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcacgccatgcagtggaa
>gnl|hbvnuc|KM524358_FT00000_P-D Feature FT:source KM524358_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate EHBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagggtaagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaacctgcagaacctgcacgactcctgctcgaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaagatcacatcatacttaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcactcaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtttggagcaaacgttctcgggactgacaactctgttgttctctcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtttcgggaacccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagttaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctttcttttggaagacaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttattagacgacgagtcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaccctcaatgttaatattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaaaacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatatagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcgaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggagtcatcccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ904415_FT00000_P-D Feature FT:source FJ904415_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate A63). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaggatccaagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcatcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatcttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcgtgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggatggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcatccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttgcataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattcta
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggatgatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcatatagaccaccaaatgcccctatctta
tcaacacttccggagcattctgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcgtagcagtcgaag
gtgtcaatcggcgggtagcagaagatctcaatctcgggaatctcaatgttagtattcgttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctactcctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700442_FT00000_P-D Feature FT:source HQ700442_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN12_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacataatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagacccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccacctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707499_FT00000_P-D Feature FT:source JQ707499_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C38). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaaccactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgaccactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacgtcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ205382_FT00000_P-D Feature FT:source GQ205382_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T1360d). Complete genome. [Hepadnaviridae] (length=3182 residues).
atccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtacttccctgctggtggctcaacttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccagcttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataagacaaaaagatggggatattctctacacttcatgg
gttatgtcattggttgttggggatccttaccacaagagcacattatacacaagctgaaagaatgttttagaaaactccct
gttaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgccattatatgcatgtattcaagcgaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctgtcgtcctctcctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaagatcttacataagaggactcttggactctccgcaa
tgtcaacgaccgatcttgagcaatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgactttagctacctgggtgggtactaatttggaagatccagcatctagggacctagtggtcag
ttatgtcaacactaacatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtgttggagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccctggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccaacttttcccaatatacatttaca
ccaagacatcatcaacaaatgtgaacagtttgtaggccctcttactgtcaatgagaaaagaagattgcaattgattatgc
cagctaggttttaccctaactttaccaaatatttacctttagataagggtattaaaccttattatccagaacatctagtt
aatcattactttcaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggctcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggac
>gnl|hbvnuc|KJ470895_FT00000_P-D Feature FT:source KJ470895_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 8120). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgwatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaacaaaacaaagagatggggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaagatcacattatacttaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggccttttgggttttgctgcccctttcactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgycaacttacaaaacctttc
tgcgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggactgataactctgttgttctttcccgcaagt
atacatcgtttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctctgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacccttgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttgctgtcgtttttgcctactgacttctttccttccgtccgagatctactagataccg
caacagcgctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggaattaatgactctagctacctgggtgggtactaatttagaagatcaatcatccagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcagacaactattgtggtatcacacttcttgtctcatgtttggaagagaaa
cggttcaagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtggggagt
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcctaatatacatttaca
ccaaaatattattgaaaaatgtgaacagtttgtgggccccctcacagtcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttaccctaatgttaccaaatatttacccttggacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgttttatataagagggaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaattccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccgccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatcatacaaaccttgccagcaaatccacctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU736926_FT00000_P-D Feature FT:source KU736926_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Sudan_18). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttkcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcycatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccccaacaaaacaaagagatggggctactctctaaatttcatgg
gctatgtcattggatgttatgggtcactgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgcgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgtaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagcggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttrgagtctyctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcractcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagaatatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtttttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccgctcacagtcaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggcygggattcaccccaccacacggaggccttytgg
ggtggagccctcaggctcagggcatactacaatccctgccaacaaatccgcctccggcctctaccaaycgccagtcagga
aggcagcctaccccgctgtctccacctttgagaracactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB109479_FT00000_P-D Feature FT:source AB109479_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttccaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaactcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctggccgcttgttttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcaatcaggcaagctatcctt
tgctggggggagttaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cggtcatagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594428_FT00000_P-D Feature FT:source EU594428_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcaggacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttgaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaataggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgccattgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgaaattaatcatgc
ctgctaggttttatccaaatgttaccaaatatttaccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU668449_FT00000_P-D Feature FT:source KU668449_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate OHBV). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaacttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcgggaa
cagtgaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactctcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcggttatgtggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttattctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagaatgttttaggaaacttcct
gttaacaggccgattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttaatgcccttatatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctcgcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ329356_FT00000_P-D Feature FT:source DQ329356_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate LT1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcgcaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacttgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctccgcaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggtttgggcgtcgtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcccttgggactctctcgtccccttctccggctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgggcacttcgcttcacctctgc
gcgtccgatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttagggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctatccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggagagatctaatgactctagctacctcggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtgccttcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgctagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcggcggagaagatctaaatctcgggaatctcaatgttagaattccttggactcataaggtggggagc
tttactgggctttattcttctactggacctgtctttaatcctaattggaaaacaccatcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgaaattgattatgc
ctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattcttgcccgaccaccagttggatccagccttcagagcaaacaccggaaatccagattgggacttcaatccaaacaa
ggacacctggcaagacgccaacaaggaaggagctggagcattcgggctgggtttcacccaaccgcacggaggccttttgg
ggtggagccctcaggttcagggcatgctacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgttgtctcaacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ336674_FT00000_P-D Feature FT:source DQ336674_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate S1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcagaaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcactgaacatggag
aacatcacatcaggactcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcagttttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcttgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggcgtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagagtgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttaggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactattggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccttataa
agaatttggagcttccgtggagttactctcgtttttgccttctgacttctatccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggatctaatgactctagctacctgggtgggtgctaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatagccctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaag
tagttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggagc
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaacatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggtcttttgg
ggtggagccctcaggctcagggcatgctacaaactttgccagcaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183483_FT00000_P-D Feature FT:source GQ183483_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4566). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggagcctctatgtatccct
cttgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagtaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB119256_FT00000_P-D Feature FT:source AB119256_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtgtttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggcttttagctatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggacttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgagacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcctgggactccctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccactgcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagctatcctt
tgctggggggatttaatgactctagctacctgggggggtgttaacttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaca
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcatcacttccggagattactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
tgtgaagccctcaggctcagggcataatacaaaccatgccagtatatccgcctcctgcatctaccaatcgaaggtcaaaa
aggcagcctaccccgctgtctccacctttgagagacactcatccccaggccatgcagtggaa
>gnl|hbvnuc|JN642130_FT00000_P-D Feature FT:source JN642130_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb13). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggga
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaagattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gtcaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctcagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactcggttgttctctcccgtaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattcta
tgctggggggaattaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacgtttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagatattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttactaaatatttgccattggataagggcatcaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtgggtcatcatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH464854_FT00000_P-D Feature FT:source MH464854_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MA132). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttcgaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaatttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacgttatcgggactgataactcggttgtcctctcccgtaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcagacgacccctctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctccgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgtgaccttctagataccg
cctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagatctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgagnnnnnngcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtg
gggaactttactgggctttattcttctactatacctgtctttaatcctcattggaaaacaccatcttttcctaatataca
tttacatcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattga
tcatgcctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacat
ctagttaatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaac
acatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnagaatctttccaccagcaatcctctgggattctttcccgaccaccagttggatccagccttcagagc
aaacaccgcaaatccagattgggacttcaatcccaacaaggacacctggccagacgccaacaaggtaggagctggagcat
tcgggctgggtttcaccccaccgcacggaggccttttggggtggagccctcaggctcagggcatactacaaactttgcca
gcaaatccgcctcctgcctccaccaatcgccagtcaggaaggcagcctaccccgctgtctccacctttgagaaacactca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|AB120308_FT00000_P-D Feature FT:source AB120308_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggacccccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctttgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctatcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgtacacctcatcatactgcactcaggcaagctatcctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cggtcctagagtatttggtgtctttcggagtgtggattcgcactccaccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcctctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcacaccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY233291_FT00000_P-D Feature FT:source AY233291_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 179). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtgtgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctggcctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttcgcaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaagcaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggtctctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgtgaccttctagataccg
cctcagctctgtatcgggaagccttagaatctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagatctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttcaactatacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
tcaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgctaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagggaaacaacacatag
cacctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC875292_FT00000_P-D Feature FT:source KC875292_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV21). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaacctttggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
gttaataggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccagcttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctg
tgctggggggacttaataaccctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcattgagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaatcctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttacccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctttggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccacaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctctgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB270546_FT00000_P-D Feature FT:source AB270546_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MGL88F). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgckgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgaatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggcgaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttattctttacatttcatgg
gctatgtcattggaagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactttctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccatataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagacaccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcgcctcaccataccgcactcaggcaagcaactatt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttagaagatccaacatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagcaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456649_FT00000_P-D Feature FT:source GU456649_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T57). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactggtggtggacttctctcaattttttagggggaacccccgtgtgtcttggccaaaattcgcagtccc
caacttccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctatttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcctgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttttttccttcagtacgagatcttctagataccg
cctcagctttgtatcgggaagccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggatctaataactctaagtacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaactacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacctcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggcccagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagtctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM524342_FT00000_P-D Feature FT:source KM524342_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate DR003_EP). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcacggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacattatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttgatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaacc
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtatgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttccggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaactccctcttttcctaatatacatttaca
ccaagacattatcaaaagatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatcccaaggttaccaaatatttgccattggataagggcattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaacaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggtatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcaacctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700483_FT00000_P-D Feature FT:source HQ700483_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_TA120_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaghctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttccc
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattcttgggacggataactctgttgttctctcccgaaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggcctcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaccttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatgtagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN040767_FT00000_P-D Feature FT:source JN040767_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 919019). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacattccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctggacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcataggccaccagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttatccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aagttgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagacaccg
cctcagctctgtatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggaagatccaacatccagagacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacgtttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctagggcatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacccccacttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattagataagggcattaaaccttattatccagaacatctggtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagagacacgcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664909_FT00000_P-D Feature FT:source JN664909_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB36_IC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttctgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgcgttgatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctgtcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttagcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgactctagctacctgggtgggtactaatttggaagatccagcatccagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcctaatatacatttaca
ccaaaatattattgaaaaatgtgaacagtttgtaggcccgctcacagtcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttaccctaatgttaccaaatatttgcccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtattttatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccggaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GU456664_FT00000_P-D Feature FT:source GU456664_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T40). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatgggggtactctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaggatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcctgctttgctcgcagcaggtctggggcaaacattctcgggacggataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggtctctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtattgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccgagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggaagccttagagtctcctgagcattgttcatctcaccatactgcactaaggcaagcaattctt
tgctggggggacttaatgaatctagccacctgggtgggtagtaatttggaagatccagtatccagagacctagtagtcag
ttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacctttcttgtctcacttttggaagacaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttattagacaacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatgttacaaaatatttgccattggataagggcattaaaccctattatccagaacatctagtt
aatcattacttccaaacccgacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacttggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccaacaaatccgcctcctgcctccaccaatcgtcagtcagga
aggcagcctacccctctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664932_FT00000_P-D Feature FT:source JN664932_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate T2235_CHB). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatattgtcaatcttctcgaagattggggaccctgcaccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcgaccaccagcacgggaccatgcagaacttgcataaccactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccctaacaagacgaaacgttggggttattctctacacttcatgg
ggtatgtcattggttgttggggatcattaccacaagagcacattatacacaagctaaaagaatgttttagaaaactccct
gttaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgcgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgtgcgggatcttctcgacaccg
ccgcagctctgtatcgggatgcgttagaatctcctgaacattgttcacctcaccatactgcactaaggcaagcaattctg
tgctggggagagttgatgactctagctacctgggtgggtagtaatttggaagatccagcatctagggacctagtggtcag
ttatgtcaacactaacatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttgggagagaaa
cggttttggagtatttggtgtctttcggagtgtggattcgcactcctaccgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgccaggttttatccaaaggttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccagaaatccagattgggacttcaatcccaacaa
ggacccatggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccaccgcacggaggccttttgg
ggtggagcccgcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcagctaccaatcgccagtcagga
aggcagcctaccccactgtctccacctctgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT366507_FT00000_P-D Feature FT:source KT366507_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate C). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctatcacttatcgtcaatcttctcgaggattggggaccctgcgttgaacatggag
agcatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctctgaattttatgg
gctatgtcattggatgttatgggtcattgccacaagaacacatcagagaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcccattgattggaaagtgtgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
tctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagcggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagctattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctcattggaagacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccactgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN792907_FT00000_P-D Feature FT:source JN792907_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate 312000473). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgtgctgaacatggaa
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcaggacttgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtgtacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgtcatgggtccttgccacaagatcacatcaaacagaaaatcacagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccggttgggactctctcgtcccctcctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctcatcgattcttgcccaaggtcttacataagagaactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggatttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggacgccttagagtctcctgaacattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgtgaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaattattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagaccaag
gtctaaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttgatattccttggactcacaaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaacccacattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattaattatgc
ctgctaggttttatccaaatagaaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggacccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccacctcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
agacagcctaccccgctgtctccccctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF471650_FT00000_P-D Feature FT:source KF471650_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PG). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcttgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcgtcaaccaccagcacgggatcatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgttgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaatcctaacaaaacaaaaagatggggttattctttacatttcatgg
gctatgtcattggatgttatggttcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctaaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggtcatgggccatcagcgcatgcgtggaacctttcaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatctgctagataccg
cctcagctctatatcgggacgccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaacatctagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttagtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgtcagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF584160_FT00000_P-D Feature FT:source KF584160_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate M3). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttyttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgggtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggcacctctatgtatccct
catgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctmacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaraaaatcaaagaatgttttaraaaacttcct
gttaayaggcctattgattggaaagtctgtcaacgcattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgracctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
ttacatcgtatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcagttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccragctgtgccttgggtggctttrgggcatggacattgacccttataa
agaatttggagctwctgtggagttactctcgtttttgccttcygacttctttccttccgtacgagatcttctagataccg
cctcagctctgtatcgggaagccttaragtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggamctaatgaatctagctacctgggtgggtggtaatttggaaratccartatccagggacctagtagtcag
ttatgtyaacactaatrkgggcctaaagttcaggcaactwttgkggtttcacatttcttgtctcacttttggaararaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcmacgcttccggrgactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatytcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttytactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctagattttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaacctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacactrcaaatcmagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggggctggagccttcgggctgggattcaccccaccgcacggaggccttttag
ggtggagccctcaggctcagggcatactacaaaccwtgccagaaaatccgcctcctgcctctaccaatcgccagtcaggg
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggcaatgcagtggaa
>gnl|hbvnuc|KC875321_FT00000_P-D Feature FT:source KC875321_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV19). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
gttatgtcattggatgttatgggtccttgccacaagaacacatcatacaaaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttacccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
cgacacctggccagacgccaacaaggtaggagctggaccattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KY629633_FT00000_P-D Feature FT:source KY629633_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KLMY14). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcaacaaccttccaycaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaaacaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cttgctgctgtacmaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaggaatgttttagaaaacttcct
gttaacaggccgattgattggaaagtctgtcaacgtattgtgggtcttttgggatttgctgccccttttacgcaatgtgg
gtatcctgctttaaagccyttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccmggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aagytdtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgatccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagatacag
cctcagckytatatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaattaatgactctagccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcgg
ttatgttaactctaatatgggcctgaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cggtcwtagagtatttggtgtcttttggagtgtggattcgcactcctccaccttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaagaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaacccgacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
tgcctcattttgtggatcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaacattgccagcatatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctaccccgctgwctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK618418_FT00000_P-D Feature FT:source MK618418_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_Arkh7). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgaaattaatcatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttggcagcaaatccggctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700451_FT00000_P-D Feature FT:source HQ700451_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_GI11_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgcgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaacttatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccacctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257183_FT00000_P-D Feature FT:source JN257183_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHKSH). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatytccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttatcgaggattggggaccytgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagagtctagactcgtggtggacttctctcarttttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaartctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacattttatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcagtctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttccggctcctttaccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgcttgggactctttcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaacaatgcctgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgtgcagttactctcgtttttgccttctgacttctttccttcaatacgagatcttctagataccg
ccgcagctctgtatggggaagccttacagtctcctgagcattgctcacctcaccatacagcactcaggcaagcaattctg
tgctggggggacctaatgaatctagctacctgggtgggtggtaatttggaagacccagtatccagggacctaatagtcgg
ttatgtcaacactactgtgggcctaaagttcaggcaactattgtggtttcacatttcctgtctcacttttggaagagaaa
cagtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcactggaaaacaccttcttttcctaatatacatttaca
ccaagacattattaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaakgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtatattatatawgagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctccggcctcwaccaatcgccagtcggga
aggcagcccaccccgctgtctccaccgttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MN310708_FT00000_P-D Feature FT:source MN310708_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BG_67_2010). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
gtgaacaggcctattgattggaaagtttgtcaacgaattgtgggtcttttgggttttgctgcccctttyacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatrggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
awgrtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagagatctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttcaaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggccgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ183454_FT00000_P-D Feature FT:source GQ183454_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate MOD_4582). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctat
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgttcagcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggctactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccgcaagatcacatcatacagaaaatcaaagattgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgcctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagcattagagtctcctgagcattgttcacctcaccatacggcactcaggcaagcaattctt
tgctggggagatctaataactctatccacctgggtgggtggtaatttggaagatccaacatccagggacctagtagttag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgcctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaaagttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttccggaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcacactacaaaccgtgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcccacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN664910_FT00000_P-D Feature FT:source JN664910_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate THB43_IC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaaccagcacgggaccatgccggacctgcatgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaatttcatgg
gttatgtcattggatgttgtggatccttgccacaagatcacatcatacttaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggttttgctgccccttttactcaatgtgg
ttatcctgcgttgatgcctttatatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctatcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggtcgcttgggactctctcgtcctcttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggagaactaatgaatctagctacctgggtgggtactaatttggaagatccagcgtctagagacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cggttctagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaat
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattattgaaaaatgtgaacagtttgtaggcccgctcacagttaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttaccctaatgttaccaaatatttgcccttggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtgtattatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaactccgccaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ927384_FT00000_P-D Feature FT:source JQ927384_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate KM2109). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccactaccttccaacaaactctgcaagatcccagagtgagaggcctgtatctccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgaggccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacactaacaaaacaaaaagatggggatattctctacatttcatgg
gttatgtcattggatgttggggatcattgccacaagatcatatcgtccacaaaatcaaagaatgtttcagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcacgcaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaagcgggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggcccggtctgtgccaagtgtttgctgatgcaaccccc
actggctggggcttggtcataggccatcagcgcatgcgtggaacctttccggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacgtgcttgggactgacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcgaggccgcttgggactctaccgtcccctkctacgcctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaaatcttgcccaaggtcttatataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaatagatta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttcrgcacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcactgttcacctcaccatactacactcaggcaagccattctt
tgctggggggaacttatgaatctagctacctgggtgggtgcaaatttgcaagatcaagcatctagggatctagtagtcaa
ttatgtcaacactaatatgggcctaaagtttagacaactattgtggtttcacacttcttgtctcacttttggaagagaaa
ccgtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccatcaaatgcccctatctta
tcaacacttccggagacttgtgttrttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttgatattccttggactcataaggtgggaaat
tttacggggctttattctactactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcgacaaatgtgaacaatttgtaggcccgctaacagtcaatgaaaaaagaaggctgaaattgattatgc
ctgctaggttttttccaaagtgtaccaaatatttgcccttggacaagggtattaaaccgtattatccggaacatctagtt
aatcattactttcaaactagacactatttacacactctatggaaggcgggtattttatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattccttcccgatcaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctggggttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcattctacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagagayactcaycctcaggccatacaktggaa
>gnl|hbvnuc|HQ700444_FT00000_P-D Feature FT:source HQ700444_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate D_NZL_AN19_1984). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaacgctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcttcaaccaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggcagttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctaaccctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctacgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgctcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaccttatgactctagccacctgggtgggtggtaatttggaagatccagtatccagggacctagtagtcag
ttatgttaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttactcttctactgttcctatctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaagtgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatttagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaaaaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccacacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KF192831_FT00000_P-D Feature FT:source KF192831_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate TP59). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaacctgcagaacctgcacgactcctgctcgaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaagatcacatcatacttaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcactcaatgtgg
ttatcctgctttaatgcccttatatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtcaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtttggagcaaacgttctcgggactgacaactctgttgttctctcccgcaaat
atacatcctttccatggctgctaggctgtgctgccaactggatcttacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtcctcttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccatgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccgaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatccagcatccagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcctagagtatttggtgtcttttggagtgtggattcgcactcctacagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcctaatatacatttaca
ccaaaatattattgaaaaatgtgaacagtttgtaggcccgctcacagtcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttaccctaatgttaccaaatatttgcccttggacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtgttttatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaattccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccgccgcacggaggtcttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598636_FT00000_P-D Feature FT:source MK598636_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg1). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctacaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgagtactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccagaatcttcaaccaccagcacgggaccttgcagaacatgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttggggatctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctataa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagcttagatta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctatatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagccacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgttaacactaatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgttcctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU594400_FT00000_P-D Feature FT:source EU594400_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggccaattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcctgtattcaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggttatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgctttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctctatcgagaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggagttaatttggaagatccagcatctagggacctagttgttag
ttatgtcaacactaatatgggcttaaaattcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacagggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgaaaaacgaagactgcaattaattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctggtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacacagcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcctctaccaatcgccactcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN257162_FT00000_P-D Feature FT:source JN257162_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate WHSDQ). Complete genome. [Hepadnaviridae] (length=3182 residues).
ytccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgaccactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacattacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggrmmcaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcytgtcctccracttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtytgtcctct
aattccaggatcytcaacwaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaastctgtryhgcatcttgagkccctttttwccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggawgttatgggtcattgccacaagatcacatcagacagaaaatcaaagaatgttttagaaaacttcct
rttaataggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaawgcccttgtatgcatgtattcagtctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccmggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattatagggacggacaactccgttgttctmtcccgcaaat
atacatcgtwtccatggctgctaggctgtgctgccaactggatcctrcgcggaacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgyctgccgtttcaaccaaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgaatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagrtta
mwgatmtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcmcctctgcctaktc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgaacattgtacacctcaccatacggctctcaggcaagcaatacta
tgctggggggaactaatgactctagctacctgggtgggtggtaatttgsaagatscaacatccagggacctagtagtcrg
ttatgtcaacwctaatatgggcttaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagtcatagagtatttggtgtcttttggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgcayaaggtgggaaat
tttacggggctttattcttctactgtwcctgtctttaaycctcattggaaaacaccmtcttttcckaatatacatttaca
tcaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaaggctgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttgccattggataagggtattaaaccttattacccagaacatctagtt
aatcattacttccaarccagacattatttacacactctatggaagtcaggtgtattatatcagagagaaacaacacatag
cgcctcattttgtgggtcactctattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccctgccagcaaatccgcctcctgcttctaccaatcgccagtcagga
aggcagccbacaccgttgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MK598663_FT00000_P-D Feature FT:source MK598663_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV_occult_VNovg31). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgtttcaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttctctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacgcaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgctcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaataccaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccttcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacatactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagcgggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcaaggcatactacaaaccttgccagcaaatccgcctcctgcttccaccaatcgccagtcagga
aggcagcctaccccgttgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707485_FT00000_P-D Feature FT:source JQ707485_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C22). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccttgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttaacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgaccactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcgcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttatataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttcttgataccg
cttcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggatctaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatgtgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctcaagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacccctggccaaacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaatactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ707486_FT00000_P-D Feature FT:source JQ707486_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate PC1_C24). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggggaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgtgggaccatgcagaacctgcacgactactgttcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcaccttgagtccctttttaccgctgt
taccaattttcttttatctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gttatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactcgctcgtccccttctccgtctgccgtttcgtccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccacttcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtctgtttaaagactgggaggagttgggggaggagtttagatta
caggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtacgagatcttcttgataccg
cttcagctctgtatcgggacgccttagagtctcctgagcattgttcacctcatcatactgcactcaggcaagcaatcctt
tgctggggggagctaatgactctagctacctgggtgggtgttaatttggaagatcaagcatctagggacctagtagtcag
ttatgtcaacactcatatgggcctaaagttcaggcaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccacctaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagacatcatcaaaaaatgtgaacaatttgtaggtccactcacagtcaatgagaaacgaagactgcaattaattatgc
ctgccaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaacaacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaaaagctacagcatggggcagaatctgtccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KM577671_FT00000_P-D Feature FT:source KM577671_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate NIR). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctcaagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcgcgggaccatgcagaacctgcacgactactgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggtgcgtcgggctttcccccac
tgtttggcttttagttacatggatgatgtggtattgggggccaagtctgtctcgcaccttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaaagatggggttactctttaaatttcatgg
gctatgtcattggaagctatgggtcattgccacaagatcacatcatacagaaaatcaaagactgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaaagcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggggcaaacattatcggaacggacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctcgcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactaggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagcttctgttgagttactctcgtttttgcctgctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtttcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggagggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacaccaatatgggcctgaaattcaggcaactattgtggtttcacatttcttgtctcacttttggaagagata
cggttgtagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgccccaatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccacttacagtcaatgagaaacgaagactgcaattaattatgc
ctgctaggttttatccaaatgttaccaaatatttgccattagataagggtattaaaccctattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatcttatataagagagaaacaacacgtag
cgcttcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattcttccccgaccaccagttggatccagccttcagagcaaacactgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagcgggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcataatacaaaccttgccagcaaatccgcctcctgcatctaccaatcgtcaatcagga
agacagcctaccccgctgtctccacctttgagagacactcatcctcaagcaatgcagtggaa
>gnl|hbvnuc|GU456643_FT00000_P-D Feature FT:source GU456643_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate I_T52). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaacctttcatcaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gaagaatctagactcgtggtggacttctctcaattttctagggggaaccaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcaatttactagtgccatttgttcagtggttcgcagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaagacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttttgggtcattgccacaagatcacatcatacagaaaatcaaagaatgctttagaaaacttcct
gttaataggcctattgattggaaagtctgtcaacgtatagtgggtcttttgggttttgctgccccttttactcaatgtgg
ttatcctgctttaatgcctttgtatgcctgtattcagtcaaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacagataactctgttgttctctcccgcaaat
atacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtcccctcatccgtctgccgtttcaaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagagtgggaggagttgggggaggagattagatta
aaggtgtttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgatccttataa
agaatttggagctactgtggagttactctcgtttttgcctcatgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggacttaattaatctatctacctgggtgggtggtaatttggaagatccaacatccagggacctagtagtcag
ttatgtcaacactactataggcctaaagttcaggcaactattgtggtttcacatttcttgtctcacttttggaagacaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccaccttatagaccacaaaatgcccctatctta
tcaacacttccggagactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccctcttttcctaatatacatttaca
ccaagaccttatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttttatcctaaggttaccaaatatttgccattggacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtgtattatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagcattcagagcaaacacagcgaatcccgattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaaccttgccagcaaatccgcctcctgccagtaccaatcgccagtcagga
aggcagcctaccccgctgactccacctttaagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KP090181_FT00000_P-D Feature FT:source KP090181_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR40). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccttatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccatgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagagatggggttactctctaaattttatgg
ggtatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgttttagaaaacttcct
attaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctaggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcgtttttgccttctgacttctttccttcagtacgagatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctt
tgctggggggaactaatgactctagctacctgggtgggtgtcaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctccggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacatttaca
ccaagacattatcaaaaagtgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaatgttaccaaatatttaccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtttcaccccaccgcacggaggccttttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccagtcgccagtcagga
aggcagcctacccctctgtctccacctttgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MH724251_FT00000_P-D Feature FT:source MH724251_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate BR44). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgaaaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcacttatcgtcaatcttctcgaggattggggaccctgcgcagaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtatctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaaccaccagcacgggaccctgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtacaaaaccttcggatggaaactgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggcatacatttaaaccccaacaaaacaaagagatggggttattctctaaatttcatgg
gctatgtcattggatgttggggatcattgccacaagatcacatcatacttaaaatcaaagaatgttttagaaaactccct
gttaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggttttgctgcccctttcactcaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttcgggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggactgacaactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggaccctgtcgtccccttctctgcctgccgttccgaccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagctactgtggagttactctcgtttttgccttctgacttctttccttccgtccgagatctactagataccg
ctgcagcgctgtatcgggatgccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattctg
tgctggggggacctaatgactctagctacctgggtgggtactaatttagaagatcaaccatccagggacctagtagtcag
ttatgtcaacactactgcgggcctaaagttcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cggtcctagagtatttggtgtcttttggagtgtggattcgcactcctcaagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaat
tttacggggctttattcttctactgtacctgtctttaaccctcattggaaaacaccatcttttcctaatatacatttaca
ccaaaatattattgaaaaatgtgaacagtttgtgggcccgctcacagtcaatgagaaaagaaggttgaaattgattatgc
ctgctaggttttaccctaatgttaccaaatatttgcccttggacaagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacactatttacacactctatggaaggcgggtgttttatataagagagaatcaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaattccaacaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctagggttcaccccgccgcacggaggtcttttgg
ggtggagccctcaggctcagggcataatgcaaaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
cggcagcctaccccgctgtctccacctctgagaaacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JN642135_FT00000_P-D Feature FT:source JN642135_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate Leb24). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcacatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgttcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaacgaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccgacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
gattccaggatcttcaaccaccagcacgggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtatccct
cctgctgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccctttgttcaatggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacagaaaatcaaagaatgttttagaaaacttcct
gttaacaggcctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgccgttgtatgcctgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tatataaacaatacctgaacctttaccccgttgcacggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttgaggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctctcgtccccttctccgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaatgcttgcccaaggtcttacataagaggactcttggactctctgtaa
tgtcaacgaccgaccttgaggcatacttcaaagaccgtttgtttaaggactgggaggagttgggggaggagcttagatta
atgatctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctgatc
atctcttgttcatgtcctactgttcaagcctccaagttgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactgtgcagttactctcgtttttgccttctgacttttttccttccgtacgagatcttctagataccg
cctcagctctatatcgggacgccttagagtctcctgagcattgtacatatcatcatactgcactcaggcaagcaattcta
tgctggggggaactaatgactttagccacctgggtgggtggtaatttggacgatccaacatccagggacctagtagtcag
ttatgtcaataataatatgggcctaaaattcaggcaactattgtggtttcacatttcttgtctcacttttggaagagcaa
cggtcatagagtatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacaacaacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttacggggctttattcttcttctgttcctgtctttaatcctcattggaaaacaccctcttttcctaatatacacttaca
ccaagacattatcaaaaaatgtgaacaatttgtaggcccactcacagtcaatgagaaaagaagactgcaattgattatgc
ctgctaggttctatccaaaggttaccaaatatttgccattggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaaccagacattatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccaccagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggattcaccccaccgcacggaggccttttgg
gatggagccctcaggctcagggcacactacagaccttgccagcaaatccgcctcctgcctctaccaatcgccagtcagga
aggcaacctacccctctgactccacctttgagaatcactcatcctcacaccatgcagtggaa
>gnl|hbvnuc|JN688711_FT00000_P-D Feature FT:source JN688711_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D (isolate HBV161). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaaccttccaccaaactctgcaagatcccagactgataggcctggatgtctctgctggaggctcaagttcaggaa
cagtaaaccctgttcccactacagcgtctcccttatcgtcgatcgtctcgaggattgtgaaccctgcgatgaacatggag
aacttccaatcaggattcctaggaccccttctcgtgttacaggcggggttttttttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcctcaaccaccagcacgggaccctgccgaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacatgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaagcgatggggttactctctaaattttatgg
gatatgtcattggatgttatgggtccttgccacaagaacacatcgtacaaaaaatcaaagaatgtttccgaaaacttcct
attaataggcctattgattggaaagtgtgtcagcgtattgtgggtcttttgggttttgctgcccctttcacacaatgtgg
ttatcctgctttaatgcccttgtatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattatcgggactgataactctgttgtcctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggtcgcttgggactctctcgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaaatcttgcccaaggtcttacataagaggactcttggactctttacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactagatta
aaggtctttgtactaggaggctgtaggcataaattggtttgcgcaccagtaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccttataa
agaatttggagctactctagagttactttcttttttgccktctgacttctwtccttcggtacgagatcttctagataccg
cctcagctctgtrtcgggaagccttagagtctcctgagcattgttcacctcaccatactgcactcaggcaagcaattttt
tgctggggggaamtaatgactctagctacctgggtgggtgbtaatttggaagatccagcatctagagacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcaggcaacttttgtggtttcacatttcttgtcttacttttggaagagaaa
cagttgtagagtatttggtgtttttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatccta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccgtagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtattccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctcattggaaaacaccatcttttcctaatatacacttaca
ccaagatattatcaaaaaatgtgaacagtttgtaggcccactcacagttaatgagaaaagaagattgcaattgattatgc
ctgctaggttttatccaaaggttaccaaatatttaccactggataagggtattaaaccttattatccagaacatctagtt
aatcattacttccaaactagacactatttacacactctatggaaggcgggtatattatataagagagaaacaacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatggggcagaatctttccaccagcaatcctctg
ggattctttcccgaccatcagttggatccagccttcagagcaaacaccgcaaatccagattgggacttcaatcccaacaa
ggacacctggccagacgccaacaaggtaggagctggagcattcgggctgggtytcaccccaccgcatggaggcctgttgg
ggtggagccctcaggctcagggcatactacaaactttgccagcaaatccgcctcctgcctccaccaatcgccagtcagga
aggcagcctaccccgctgtctccacctttgagagacactcatcctcaggccatgcagtggaa
>gnl|hbvnuc|Y07587_FT00000_P-D Feature FT:source Y07587_FT00000_P-D of [Viruses] Hepatitis B Virus genotype D. Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccacaaccttccaccaaactctgcaagatcccagagtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggattggggaccctgcgctgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggaactaccgtgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaacctgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcttcaactaccagcacgggaccatgcagaacctgcacgactcctgctcaaggaacctctatgtatccct
cctgttgctgtaccaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcggaaaattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaaagatggggttactctttacatttcatgg
gctatgtcattggatgttatgggtcattgccacaagatcacatcatacaaaaaatcaaagaatgttttcgaaaacttcct
gttaacagacctattgattggaaagtctgtcaacgtattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ttatcctgctttaatgcctttgtatgcatgtattcagtcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggtcatgggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagcaggtctggagcaaacattctcgggacggataactctgttgttctctcccgcaaat
atacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccacggacgacccttctcggggtcgcttggggctctctcgtccccttctccgtctaccgtttcgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaattcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgatccttataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttcagtacgtgatcttctagataccg
cctcagctctgtatcgggaagccttagagtctcctgagcattgttcacctcaccatactgctctcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtggtaatttggaagatccaatatccagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttccggcaactattgtggtttcacatttcttgtctcacttttggaagagaaa
cagttatagaatatttggtgtctttcggagtgtggattcgcactcctccagcttatagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacg