HBVdb

Dataset for nucleotide sequence S of genotype C

[Download (right click)] [Alignment] [Repertoires]

10471 sequence(s)

>gnl|hbvcds|AB014360_S_P-C Feature FT:CDS AB014360_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 01D01HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctgcaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacggttcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtccaacatcttgagtccctttttac
ctctattaccaattttctgttgtctttgggtatacatttga
>gnl|hbvcds|AB014361_S_P-C Feature FT:CDS AB014361_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 02D02HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagaccctttttac
ctctattaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB014362_S_P-C Feature FT:CDS AB014362_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 03D03HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattacccattttcttttatctttgggtatacatttga
>gnl|hbvcds|AB014363_S_P-C Feature FT:CDS AB014363_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 04D04HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctaractcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctctatat
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaatttccttttgtctttgggtatacatttga
>gnl|hbvcds|AB014364_S_P-C Feature FT:CDS AB014364_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 05D05HCC). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcamctctatgt
ttccctcttgttgctgtacaaaaccttcggacggcaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttwtac
ckctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014365_S_P-C Feature FT:CDS AB014365_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 01D06HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaccacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctaaactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatcatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttac
ctctattaccaattttctgttgtctttgggtatacatttga
>gnl|hbvcds|AB014367_S_P-C Feature FT:CDS AB014367_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 08D08HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaacatgcaggacctgcacgattcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014368_S_P-C Feature FT:CDS AB014368_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 09D09HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccamgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatatccctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacrtcaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcytggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014369_S_P-C Feature FT:CDS AB014369_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10D10HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctaggggaagcacccamgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttstggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcaatggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014371_S_P-C Feature FT:CDS AB014371_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 12D12HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgcttgatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctamttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014372_S_P-C Feature FT:CDS AB014372_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 13D13HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcac
aataccacagagtctaractcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaaactctacga
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014373_S_P-C Feature FT:CDS AB014373_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 14D14HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaayttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgactcctgctcaaaacacctcaggga
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttctgttgtctttgggtatacatttga
>gnl|hbvcds|AB014374_S_P-C Feature FT:CDS AB014374_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 15D15HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatctactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB014376_S_P-C Feature FT:CDS AB014376_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 17T02HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014377_S_P-C Feature FT:CDS AB014377_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18T03HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014378_S_P-C Feature FT:CDS AB014378_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 19Y01HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagaggctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtcggtacaacatcgtgagtccctttttac
ckctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014379_S_P-C Feature FT:CDS AB014379_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 20Y02HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatyaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014380_S_P-C Feature FT:CDS AB014380_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 21Y03HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatccgcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagtacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactrccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcaactctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttatgtctttgggtatacatttga
>gnl|hbvcds|AB014381_S_P-C Feature FT:CDS AB014381_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 22Y04HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014382_S_P-C Feature FT:CDS AB014382_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23Y05HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggarcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcgaaacacctctatat
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014383_S_P-C Feature FT:CDS AB014383_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 24Y06HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014384_S_P-C Feature FT:CDS AB014384_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 25Y07HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactygtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaacwaccagcacgggaccatgcaagacctgcacrattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014385_S_P-C Feature FT:CDS AB014385_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 26Y08HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcactcaagtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcagaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccytttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014387_S_P-C Feature FT:CDS AB014387_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 28Y10HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggttgacttctctcaattttctaggggaagtacccaagtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaacaaacagcacgggaccatgcaagacctgcacgattcctgctcaaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacagaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatmcatttga
>gnl|hbvcds|AB014388_S_P-C Feature FT:CDS AB014388_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 29Y11HCC). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctaractcgtggtggacttctctcagttttctagggggagcacccaagtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaacyaccagcacgggaccatgcaagacctgcacgaytcctgctcaaaacacctctatgt
ttccctcytgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcrtcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaggccctttatac
ctctattactaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014389_S_P-C Feature FT:CDS AB014389_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 30Y12HCC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcytccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014390_S_P-C Feature FT:CDS AB014390_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 31Y13HCC). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaagacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014391_S_P-C Feature FT:CDS AB014391_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 32Y14HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaagtgtcctggccgaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaaacaactctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctrgctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014392_S_P-C Feature FT:CDS AB014392_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 33Y15HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctaaactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014393_S_P-C Feature FT:CDS AB014393_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 34Y16HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcattttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014394_S_P-C Feature FT:CDS AB014394_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 35Y17HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggacttccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014395_S_P-C Feature FT:CDS AB014395_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 36Y18HCC). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggttttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatatagtattgggggccaagtctgtacaacatcttgagtccctttatac
cgccattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014396_S_P-C Feature FT:CDS AB014396_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 37Y19HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaagcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014397_S_P-C Feature FT:CDS AB014397_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 38Y20HCC). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctaaactcgtggtggacttctctcaattttctagggggagcacccrcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014398_S_P-C Feature FT:CDS AB014398_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 39Y21HCC). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcactttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacatgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB014399_S_P-C Feature FT:CDS AB014399_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 40Y22HCC). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ckctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB026811_S_P-C Feature FT:CDS AB026811_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;97.Feb.). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB026812_S_P-C Feature FT:CDS AB026812_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;98.May). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB026813_S_P-C Feature FT:CDS AB026813_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;97.Sep.). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB026814_S_P-C Feature FT:CDS AB026814_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Donor 3;98.May). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB026815_S_P-C Feature FT:CDS AB026815_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 2:full). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029950_S_P-C Feature FT:CDS AB029950_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgaggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggtacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cactattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029951_S_P-C Feature FT:CDS AB029951_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaatttcctgttgtctttgggcatacatttga
>gnl|hbvcds|AB029952_S_P-C Feature FT:CDS AB029952_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029953_S_P-C Feature FT:CDS AB029953_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcttttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccatcagcacggggccatgcaagacctgcacgattcctgctcaaggaaactcttcgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB029954_S_P-C Feature FT:CDS AB029954_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB029955_S_P-C Feature FT:CDS AB029955_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029956_S_P-C Feature FT:CDS AB029956_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029957_S_P-C Feature FT:CDS AB029957_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029958_S_P-C Feature FT:CDS AB029958_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029959_S_P-C Feature FT:CDS AB029959_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcactcaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctctatga
aacactcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggcttcc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029960_S_P-C Feature FT:CDS AB029960_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
atccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029961_S_P-C Feature FT:CDS AB029961_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB029962_S_P-C Feature FT:CDS AB029962_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029963_S_P-C Feature FT:CDS AB029963_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgagtcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029964_S_P-C Feature FT:CDS AB029964_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgagtcctgctcaaggaacctctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctgggtcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029965_S_P-C Feature FT:CDS AB029965_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029966_S_P-C Feature FT:CDS AB029966_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029967_S_P-C Feature FT:CDS AB029967_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtccaccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029968_S_P-C Feature FT:CDS AB029968_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029969_S_P-C Feature FT:CDS AB029969_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029970_S_P-C Feature FT:CDS AB029970_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtccaccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB029971_S_P-C Feature FT:CDS AB029971_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029972_S_P-C Feature FT:CDS AB029972_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029973_S_P-C Feature FT:CDS AB029973_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029974_S_P-C Feature FT:CDS AB029974_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatccaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029975_S_P-C Feature FT:CDS AB029975_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029976_S_P-C Feature FT:CDS AB029976_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029977_S_P-C Feature FT:CDS AB029977_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB029978_S_P-C Feature FT:CDS AB029978_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029979_S_P-C Feature FT:CDS AB029979_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029980_S_P-C Feature FT:CDS AB029980_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029981_S_P-C Feature FT:CDS AB029981_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029982_S_P-C Feature FT:CDS AB029982_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029983_S_P-C Feature FT:CDS AB029983_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029984_S_P-C Feature FT:CDS AB029984_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029985_S_P-C Feature FT:CDS AB029985_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029986_S_P-C Feature FT:CDS AB029986_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029987_S_P-C Feature FT:CDS AB029987_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029988_S_P-C Feature FT:CDS AB029988_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029989_S_P-C Feature FT:CDS AB029989_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029990_S_P-C Feature FT:CDS AB029990_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB029991_S_P-C Feature FT:CDS AB029991_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB030507_S_P-C Feature FT:CDS AB030507_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBNP1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB030508_S_P-C Feature FT:CDS AB030508_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBNP2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB030510_S_P-C Feature FT:CDS AB030510_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBNP4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB030511_S_P-C Feature FT:CDS AB030511_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBNP5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctttcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctccttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggcaactgcacttgtattcccatcccgtcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
ctctattaccaattttcttatgtctttgggtatacatttga
>gnl|hbvcds|AB030512_S_P-C Feature FT:CDS AB030512_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBNP6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactacaaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB030514_S_P-C Feature FT:CDS AB030514_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBNP8). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB030515_S_P-C Feature FT:CDS AB030515_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBNP9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AB030516_S_P-C Feature FT:CDS AB030516_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBNP10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB030517_S_P-C Feature FT:CDS AB030517_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBNP11). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcaccaacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB031262_S_P-C Feature FT:CDS AB031262_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV VietA-3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagaatctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacgtcaaccaccagcatgggaccatgcaagacctgcacaactcctgctctaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB033550_S_P-C Feature FT:CDS AB033550_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NDR260). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB033551_S_P-C Feature FT:CDS AB033551_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK300). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagaaccgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AB033552_S_P-C Feature FT:CDS AB033552_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK494). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AB033553_S_P-C Feature FT:CDS AB033553_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SK619). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacgaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AB033556_S_P-C Feature FT:CDS AB033556_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AK66). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AB039740_S_P-C Feature FT:CDS AB039740_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagccctgcacgattccagcgctaggagcctttaagt
ttccctcttgtggcggtacaaaaccttctgacgtagacagcactagtattcccatcccatcttcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaaaatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB039741_S_P-C Feature FT:CDS AB039741_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcatttt
atcatatccctcttcatcctgctgctatgcctcatctccttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccagaaacatcaactaccagcacggggacatgcaagacctgcacgattcctgcccacggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccacactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB039742_S_P-C Feature FT:CDS AB039742_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacacacgtgtcctggccaaaattcgc
agtccccaagctccaatcactcaccaacctcttgtcctcccatttgtcctggctatcgctggatgtatcttcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggtaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacgtttaa
>gnl|hbvcds|AB042282_S_P-C Feature FT:CDS AB042282_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB042283_S_P-C Feature FT:CDS AB042283_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB042284_S_P-C Feature FT:CDS AB042284_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctccactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB042285_S_P-C Feature FT:CDS AB042285_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NSS-4). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcatttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB049610_S_P-C Feature FT:CDS AB049610_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV AN29). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgtcgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB050018_S_P-C Feature FT:CDS AB050018_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB074047_S_P-C Feature FT:CDS AB074047_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaagggaaatacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcgaaacatctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaccatcgtgaagccctttttac
cgctgttaccaattttcttttatctttgggcatacatctaa
>gnl|hbvcds|AB074755_S_P-C Feature FT:CDS AB074755_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th44). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB074756_S_P-C Feature FT:CDS AB074756_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th55). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB105173_S_P-C Feature FT:CDS AB105173_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hawaii 16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB105174_S_P-C Feature FT:CDS AB105174_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hawaii 60). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaatctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagcctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB106895_S_P-C Feature FT:CDS AB106895_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate pHB4-4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacggttcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtgtacatttga
>gnl|hbvcds|AB111112_S_P-C Feature FT:CDS AB111112_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccrcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaatctctatgt
gtccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgattcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111113_S_P-C Feature FT:CDS AB111113_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccgcgtgtcctggccaaagttcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgaaagacctgcacgattcctgctcaaggaatctctatgt
gtccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgattcgcagggctttc
ccccactgtttggctttcagttatatagatgatgtggtattgggggccaagtctgcacaacatcttgagtccctttttac
cgctattaccaattttctttcgtctttgggtatacatttga
>gnl|hbvcds|AB111114_S_P-C Feature FT:CDS AB111114_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagaggctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttgtgtctttgggtatacatttga
>gnl|hbvcds|AB111115_S_P-C Feature FT:CDS AB111115_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacaaaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111116_S_P-C Feature FT:CDS AB111116_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacaaaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111117_S_P-C Feature FT:CDS AB111117_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgttcctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtgtggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111118_S_P-C Feature FT:CDS AB111118_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111119_S_P-C Feature FT:CDS AB111119_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111120_S_P-C Feature FT:CDS AB111120_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111121_S_P-C Feature FT:CDS AB111121_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111122_S_P-C Feature FT:CDS AB111122_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccacactgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111123_S_P-C Feature FT:CDS AB111123_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111124_S_P-C Feature FT:CDS AB111124_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatattgtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111125_S_P-C Feature FT:CDS AB111125_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatattgtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB111946_S_P-C Feature FT:CDS AB111946_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT103). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggtcccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctggggggagcccccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcatgggaccatgcaagacctgcacgacacctgctcaaggaacctctatgt
ttccctcttgttgctgtaccaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AB112063_S_P-C Feature FT:CDS AB112063_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT101). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgttctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcatgggaccatgcaagacctgcacgacacctgctcaaggaacctctatgt
ttccctcttgttgctgtacacaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AB112065_S_P-C Feature FT:CDS AB112065_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT140). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgtggcccgtttg
tcctctacttccaggaacatcaactaccatcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB112066_S_P-C Feature FT:CDS AB112066_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY624). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtcaccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccatcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgt
ttccctcgtgctgctgtacaaaaccttcggacggaaatggcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaagccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB112348_S_P-C Feature FT:CDS AB112348_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY656). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgttctgtccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctctaggagactctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB112408_S_P-C Feature FT:CDS AB112408_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-MY683). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcaccgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctctaggcatctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaatccctttttac
ctctattaccaattttctttcgtctttgggtatacatttaa
>gnl|hbvcds|AB112471_S_P-C Feature FT:CDS AB112471_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TH123). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctggacgaatcctgctcaaggaacctctatgt
ttccctcatgttggtggacaaaaccttgggacggaaaatgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB112472_S_P-C Feature FT:CDS AB112472_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TH124). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB113875_S_P-C Feature FT:CDS AB113875_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtatctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB113876_S_P-C Feature FT:CDS AB113876_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtatctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB113877_S_P-C Feature FT:CDS AB113877_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaaactctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgagaccctttatac
cgctattaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|AB113878_S_P-C Feature FT:CDS AB113878_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB113879_S_P-C Feature FT:CDS AB113879_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB115417_S_P-C Feature FT:CDS AB115417_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-O47). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagaatctagactcgtggtggacttctcacagttttctagggggaacacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttggtggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaagcacctctatgt
ttccctcttggtggtggacaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcctgggctttcgcaaga
atcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggcttcc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB115418_S_P-C Feature FT:CDS AB115418_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-O55). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggaggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctgttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttat
atcatattcctcttcatgctgctgctatgcctcatcttcttgtgggttctgctggactatcaagggatgtcgcccgttgg
tcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttcccttttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggctaagtctgtacaacatcgtgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB117758_S_P-C Feature FT:CDS AB117758_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-CB10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB176642_S_P-C Feature FT:CDS AB176642_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-115). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggyggcgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttyt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgctcaacatcttgagtccctttttac
ckctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB176643_S_P-C Feature FT:CDS AB176643_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-NK1). Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcccaggacccctgctcgtgttacaggcggggtttttcttgktgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccragtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgwcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgcggctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaayctctatga
gtccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatrtrgtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB182589_S_P-C Feature FT:CDS AB182589_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CH:Mat-Ko). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaactctttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195930_S_P-C Feature FT:CDS AB195930_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcgtatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195931_S_P-C Feature FT:CDS AB195931_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195932_S_P-C Feature FT:CDS AB195932_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcattccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195936_S_P-C Feature FT:CDS AB195936_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195937_S_P-C Feature FT:CDS AB195937_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195938_S_P-C Feature FT:CDS AB195938_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195942_S_P-C Feature FT:CDS AB195942_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttctcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195943_S_P-C Feature FT:CDS AB195943_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195944_S_P-C Feature FT:CDS AB195944_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195945_S_P-C Feature FT:CDS AB195945_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccgtcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195946_S_P-C Feature FT:CDS AB195946_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgttgtacaaaaccttcggacggaaactgcacttgtattcccatcccgtcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195947_S_P-C Feature FT:CDS AB195947_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB195948_S_P-C Feature FT:CDS AB195948_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB195949_S_P-C Feature FT:CDS AB195949_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB195952_S_P-C Feature FT:CDS AB195952_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195953_S_P-C Feature FT:CDS AB195953_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB195954_S_P-C Feature FT:CDS AB195954_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198076_S_P-C Feature FT:CDS AB198076_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198077_S_P-C Feature FT:CDS AB198077_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198078_S_P-C Feature FT:CDS AB198078_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198079_S_P-C Feature FT:CDS AB198079_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198080_S_P-C Feature FT:CDS AB198080_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198081_S_P-C Feature FT:CDS AB198081_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198082_S_P-C Feature FT:CDS AB198082_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB198083_S_P-C Feature FT:CDS AB198083_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB202071_S_P-C Feature FT:CDS AB202071_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB202072_S_P-C Feature FT:CDS AB202072_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB205123_S_P-C Feature FT:CDS AB205123_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-CN578-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggagtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacaccaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttcctagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB205124_S_P-C Feature FT:CDS AB205124_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TJ3-1-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB205125_S_P-C Feature FT:CDS AB205125_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VH34-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cactattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222714_S_P-C Feature FT:CDS AB222714_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate UZNVC7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222715_S_P-C Feature FT:CDS AB222715_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate UZNVC7M). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222716_S_P-C Feature FT:CDS AB222716_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF688). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222717_S_P-C Feature FT:CDS AB222717_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF689). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtanggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222718_S_P-C Feature FT:CDS AB222718_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF690). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222719_S_P-C Feature FT:CDS AB222719_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF691). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222720_S_P-C Feature FT:CDS AB222720_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF692). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaatctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222721_S_P-C Feature FT:CDS AB222721_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF693). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222722_S_P-C Feature FT:CDS AB222722_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF694). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222723_S_P-C Feature FT:CDS AB222723_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF695). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222724_S_P-C Feature FT:CDS AB222724_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF696). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222725_S_P-C Feature FT:CDS AB222725_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF697). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222726_S_P-C Feature FT:CDS AB222726_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF698). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222727_S_P-C Feature FT:CDS AB222727_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF699). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaccacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtcggcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222728_S_P-C Feature FT:CDS AB222728_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF700). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222729_S_P-C Feature FT:CDS AB222729_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF701). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtccaccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB222730_S_P-C Feature FT:CDS AB222730_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF702). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222731_S_P-C Feature FT:CDS AB222731_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF703). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222732_S_P-C Feature FT:CDS AB222732_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF704). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaccctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222733_S_P-C Feature FT:CDS AB222733_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF706). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222734_S_P-C Feature FT:CDS AB222734_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF708). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|AB222735_S_P-C Feature FT:CDS AB222735_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF709). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222736_S_P-C Feature FT:CDS AB222736_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF710). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222737_S_P-C Feature FT:CDS AB222737_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF711). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222738_S_P-C Feature FT:CDS AB222738_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF712). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222739_S_P-C Feature FT:CDS AB222739_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF717). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattacccattttcttttatctttgggtatacatttga
>gnl|hbvcds|AB222740_S_P-C Feature FT:CDS AB222740_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF719). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222741_S_P-C Feature FT:CDS AB222741_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IF721). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222743_S_P-C Feature FT:CDS AB222743_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN415). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcactgnnncntgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|AB222744_S_P-C Feature FT:CDS AB222744_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN420). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222745_S_P-C Feature FT:CDS AB222745_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN446). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222746_S_P-C Feature FT:CDS AB222746_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN448). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222747_S_P-C Feature FT:CDS AB222747_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN465). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcntcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222748_S_P-C Feature FT:CDS AB222748_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN482). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222749_S_P-C Feature FT:CDS AB222749_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN485). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222750_S_P-C Feature FT:CDS AB222750_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN486). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggahgacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222751_S_P-C Feature FT:CDS AB222751_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN492). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222752_S_P-C Feature FT:CDS AB222752_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN493). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaaaacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacttgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222753_S_P-C Feature FT:CDS AB222753_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN496). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcacaaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222754_S_P-C Feature FT:CDS AB222754_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN497). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222755_S_P-C Feature FT:CDS AB222755_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN498). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222756_S_P-C Feature FT:CDS AB222756_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN500). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222757_S_P-C Feature FT:CDS AB222757_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN502). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222758_S_P-C Feature FT:CDS AB222758_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN503). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtcccaaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222759_S_P-C Feature FT:CDS AB222759_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN504). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222760_S_P-C Feature FT:CDS AB222760_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN505). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggcacctctatgc
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222761_S_P-C Feature FT:CDS AB222761_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN506). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222762_S_P-C Feature FT:CDS AB222762_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN507). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222763_S_P-C Feature FT:CDS AB222763_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN508). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacnaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222764_S_P-C Feature FT:CDS AB222764_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN509). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222765_S_P-C Feature FT:CDS AB222765_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN510). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222766_S_P-C Feature FT:CDS AB222766_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN511). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222767_S_P-C Feature FT:CDS AB222767_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN512). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222768_S_P-C Feature FT:CDS AB222768_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN515). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|AB222769_S_P-C Feature FT:CDS AB222769_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN517). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222770_S_P-C Feature FT:CDS AB222770_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN520). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacagcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222771_S_P-C Feature FT:CDS AB222771_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN523). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222772_S_P-C Feature FT:CDS AB222772_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN524). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|AB222773_S_P-C Feature FT:CDS AB222773_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN525). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222774_S_P-C Feature FT:CDS AB222774_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN526). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaaggcctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcnaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222775_S_P-C Feature FT:CDS AB222775_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN527). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacancaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222776_S_P-C Feature FT:CDS AB222776_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN530). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222777_S_P-C Feature FT:CDS AB222777_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN531). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggcccagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctcgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB222778_S_P-C Feature FT:CDS AB222778_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN532). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222779_S_P-C Feature FT:CDS AB222779_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN533). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222780_S_P-C Feature FT:CDS AB222780_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN534). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB222781_S_P-C Feature FT:CDS AB222781_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN598). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactnaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB232089_S_P-C Feature FT:CDS AB232089_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY268). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctactggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232090_S_P-C Feature FT:CDS AB232090_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY270). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232091_S_P-C Feature FT:CDS AB232091_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY325). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccaatgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|AB232092_S_P-C Feature FT:CDS AB232092_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY344). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232093_S_P-C Feature FT:CDS AB232093_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY346). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232094_S_P-C Feature FT:CDS AB232094_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY347). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232095_S_P-C Feature FT:CDS AB232095_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY354). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctcgactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232096_S_P-C Feature FT:CDS AB232096_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY362). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232097_S_P-C Feature FT:CDS AB232097_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY374). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcaccttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232098_S_P-C Feature FT:CDS AB232098_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY494). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatccaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggccggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232099_S_P-C Feature FT:CDS AB232099_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY496). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatccaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232100_S_P-C Feature FT:CDS AB232100_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY505). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccccgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccatctggaatccctttttac
ctctattactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232101_S_P-C Feature FT:CDS AB232101_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY515). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcacaaacctcttgtcctccaatttgtcctggttatcgctggatgtgtcggcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232102_S_P-C Feature FT:CDS AB232102_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY521). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232103_S_P-C Feature FT:CDS AB232103_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY532). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcgtattgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232104_S_P-C Feature FT:CDS AB232104_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY568). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232105_S_P-C Feature FT:CDS AB232105_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY573). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232106_S_P-C Feature FT:CDS AB232106_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY577). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtccaccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgttcg
tcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232107_S_P-C Feature FT:CDS AB232107_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY586). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaagccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232108_S_P-C Feature FT:CDS AB232108_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY604). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcgnanggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagcccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232109_S_P-C Feature FT:CDS AB232109_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY607). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232110_S_P-C Feature FT:CDS AB232110_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY681). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctcgactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|AB232111_S_P-C Feature FT:CDS AB232111_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY632). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcccgccgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232113_S_P-C Feature FT:CDS AB232113_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY838). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggatatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcatctggactatcgaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB232502_S_P-C Feature FT:CDS AB232502_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH77). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232503_S_P-C Feature FT:CDS AB232503_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH78). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232504_S_P-C Feature FT:CDS AB232504_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH79). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232505_S_P-C Feature FT:CDS AB232505_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH80). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232507_S_P-C Feature FT:CDS AB232507_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH81). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacggttcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaccatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232508_S_P-C Feature FT:CDS AB232508_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH89). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgaatccctttatac
cgctattaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|AB232509_S_P-C Feature FT:CDS AB232509_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH93). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232510_S_P-C Feature FT:CDS AB232510_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH94). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|AB232511_S_P-C Feature FT:CDS AB232511_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH103). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatataa
>gnl|hbvcds|AB232512_S_P-C Feature FT:CDS AB232512_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH104). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaagccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232513_S_P-C Feature FT:CDS AB232513_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH108). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactgccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232514_S_P-C Feature FT:CDS AB232514_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH109). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232515_S_P-C Feature FT:CDS AB232515_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH111). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232516_S_P-C Feature FT:CDS AB232516_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH115). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232517_S_P-C Feature FT:CDS AB232517_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH119). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232518_S_P-C Feature FT:CDS AB232518_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH39). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232520_S_P-C Feature FT:CDS AB232520_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH64). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgggtcctgctcaaggaacctctatga
aacactcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232521_S_P-C Feature FT:CDS AB232521_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH65). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctccatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagcccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232522_S_P-C Feature FT:CDS AB232522_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH67). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctcgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232523_S_P-C Feature FT:CDS AB232523_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TH74). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctcgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB232524_S_P-C Feature FT:CDS AB232524_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate VT1027). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB241110_S_P-C Feature FT:CDS AB241110_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhLC03). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggaacatccacaacaagcacgggaccatgcaaaacctgcacgactcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatctga
>gnl|hbvcds|AB241111_S_P-C Feature FT:CDS AB241111_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhLC14). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB241112_S_P-C Feature FT:CDS AB241112_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhHCC15). Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggactaccaaggtatgttgcccgtttg
tcctctaattccaggaacatccacaacaagcacgggaccatgcaaaacctgcacgaatcctgctcaaggcaactctatgt
ttccctcatgttgctgtacaaaacctacggatggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB241113_S_P-C Feature FT:CDS AB241113_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PhHCC13). Partial genome (Contains: HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggaacctccaccaccagcacgggaccctgcaaaacctgcacgaatcctgctcaaggcacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtactgggggccaagtctgtacaacatcttgaggccctttttac
ctctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB246344_S_P-C Feature FT:CDS AB246344_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatattgtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB246345_S_P-C Feature FT:CDS AB246345_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB246346_S_P-C Feature FT:CDS AB246346_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacttcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cactgtttccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB247916_S_P-C Feature FT:CDS AB247916_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctcgactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctccttactcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB250109_S_P-C Feature FT:CDS AB250109_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IH030213). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgttgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctgcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacaccttgaggccctttttac
ctctattaccaattttcttttttctttgggtatacatttga
>gnl|hbvcds|AB253407_S_P-C Feature FT:CDS AB253407_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate VC60). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccancacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtgttcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcantttactagtgccatttgttcagtggttcgtanggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253408_S_P-C Feature FT:CDS AB253408_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate VC61). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgcgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgaatccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253409_S_P-C Feature FT:CDS AB253409_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate VC66). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagtgcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253411_S_P-C Feature FT:CDS AB253411_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate VC72). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcanttnactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253412_S_P-C Feature FT:CDS AB253412_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate VC91). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253611_S_P-C Feature FT:CDS AB253611_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TV82). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgccgcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253612_S_P-C Feature FT:CDS AB253612_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TV83). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatatgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253615_S_P-C Feature FT:CDS AB253615_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TV87). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB253620_S_P-C Feature FT:CDS AB253620_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TV93). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtccaccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaatccctttttac
cgctattaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB284371_S_P-C Feature FT:CDS AB284371_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcatgggaccatgcaagacctgcacgatttctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggcttccgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB288026_S_P-C Feature FT:CDS AB288026_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattggc
agtccccaacctcaaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB298720_S_P-C Feature FT:CDS AB298720_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BAJT2006-1S). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB298721_S_P-C Feature FT:CDS AB298721_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BAJT2006-1C). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB299858_S_P-C Feature FT:CDS AB299858_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|AB300359_S_P-C Feature FT:CDS AB300359_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300360_S_P-C Feature FT:CDS AB300360_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaaccttttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccttgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaggtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300361_S_P-C Feature FT:CDS AB300361_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300362_S_P-C Feature FT:CDS AB300362_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300363_S_P-C Feature FT:CDS AB300363_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300365_S_P-C Feature FT:CDS AB300365_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300368_S_P-C Feature FT:CDS AB300368_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300372_S_P-C Feature FT:CDS AB300372_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient14). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggcttccgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300373_S_P-C Feature FT:CDS AB300373_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient15). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB362932_S_P-C Feature FT:CDS AB362932_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB365438_S_P-C Feature FT:CDS AB365438_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BOL123). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB365439_S_P-C Feature FT:CDS AB365439_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BOL182). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB365440_S_P-C Feature FT:CDS AB365440_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BOL414). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB365442_S_P-C Feature FT:CDS AB365442_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BOL583). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccatgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB365451_S_P-C Feature FT:CDS AB365451_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BOL196). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367392_S_P-C Feature FT:CDS AB367392_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagacttgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcaggtctttc
ccccactgtgtggctttcagttatgtggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttctttcgtctttgggtatacatttga
>gnl|hbvcds|AB367394_S_P-C Feature FT:CDS AB367394_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 3/Adefovir-treated Pt. 8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttcgggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367395_S_P-C Feature FT:CDS AB367395_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB367396_S_P-C Feature FT:CDS AB367396_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB367397_S_P-C Feature FT:CDS AB367397_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367398_S_P-C Feature FT:CDS AB367398_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 7/Adefovir-treated Pt. 20). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367399_S_P-C Feature FT:CDS AB367399_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 8/Adefovir-treated Pt. 29). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367401_S_P-C Feature FT:CDS AB367401_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 10/Adefovir-treated Pt. 9). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttctgttgtctttgggtatacatttga
>gnl|hbvcds|AB367402_S_P-C Feature FT:CDS AB367402_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgctgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagttcactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367403_S_P-C Feature FT:CDS AB367403_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 12/Adefovir-treated Pt. 17). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagtacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367404_S_P-C Feature FT:CDS AB367404_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 13/Adefovir-treated Pt. 22). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367405_S_P-C Feature FT:CDS AB367405_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 14/Adefovir-treated Pt. 25). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggcaaagtctgtacaacaccttgagtccctttttac
cgctgttaccaattttcttgtgtctttgggtatacatttga
>gnl|hbvcds|AB367406_S_P-C Feature FT:CDS AB367406_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 15/Adefovir-treated Pt. 7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacttgcaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcgtgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367407_S_P-C Feature FT:CDS AB367407_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 16/Adefovir-treated Pt. 11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367408_S_P-C Feature FT:CDS AB367408_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 17/Adefovir-treated Pt. 14). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367409_S_P-C Feature FT:CDS AB367409_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 18). Partial genome (Contains: HBe, HBc, HBx, SHBs). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcatgacctgcacgactcctgctcatggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367410_S_P-C Feature FT:CDS AB367410_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 19/Adefovir-treated Pt. 19). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtggctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367411_S_P-C Feature FT:CDS AB367411_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 20). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggttttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367412_S_P-C Feature FT:CDS AB367412_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 21). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggttttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367413_S_P-C Feature FT:CDS AB367413_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 22/Adefovir-treated Pt. 4). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggttttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367414_S_P-C Feature FT:CDS AB367414_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 23/Adefovir-treated Pt. 3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttatgtctttgggtatacatttga
>gnl|hbvcds|AB367416_S_P-C Feature FT:CDS AB367416_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 25). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagaggctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtggctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtgtggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB367417_S_P-C Feature FT:CDS AB367417_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 26). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttccttttgtctttgggtatacatttaa
>gnl|hbvcds|AB367418_S_P-C Feature FT:CDS AB367418_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 27/Adefovir-treated Pt. 21). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaacatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatttggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttgtgtctttgggtatacatttga
>gnl|hbvcds|AB367420_S_P-C Feature FT:CDS AB367420_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 29). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagtaccaaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
ctctattaccaattttctgtcttctttgggtatacatttga
>gnl|hbvcds|AB367421_S_P-C Feature FT:CDS AB367421_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 30). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcccgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatagatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttctttcatctttgggtatacatttga
>gnl|hbvcds|AB367422_S_P-C Feature FT:CDS AB367422_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 31/Adefovir-treated Pt. 12). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367423_S_P-C Feature FT:CDS AB367423_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 32/Adefovir-treated Pt. 28). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtggggctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367424_S_P-C Feature FT:CDS AB367424_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 33). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB367425_S_P-C Feature FT:CDS AB367425_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 34/Adefovir-treated Pt. 15). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367426_S_P-C Feature FT:CDS AB367426_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 35). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccgaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgatggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggcttccgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367427_S_P-C Feature FT:CDS AB367427_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 36/Adefovir-treated Pt. 18). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367428_S_P-C Feature FT:CDS AB367428_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 37/Adefovir-treated Pt. 10). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttggatatacatttga
>gnl|hbvcds|AB367429_S_P-C Feature FT:CDS AB367429_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 38). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaatctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttatac
ctctattaccaattttcttttttctttgggtatacatttga
>gnl|hbvcds|AB367430_S_P-C Feature FT:CDS AB367430_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 39/Adefovir-treated Pt. 5). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctagtacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgaggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367431_S_P-C Feature FT:CDS AB367431_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 40). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgttggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatcgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367432_S_P-C Feature FT:CDS AB367432_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 41). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367433_S_P-C Feature FT:CDS AB367433_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 42/Adefovir-treated Pt. 27). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctcgactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgatggatgtgtctgcggcgtttt
atcatattcctctccatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367434_S_P-C Feature FT:CDS AB367434_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 43/Adefovir-treated Pt. 26). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatccggatccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccgaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AB367435_S_P-C Feature FT:CDS AB367435_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 44/Adefovir-treated Pt. 23). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgatggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtgtggctttcagttatattgatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttac
ctctattaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|AB367801_S_P-C Feature FT:CDS AB367801_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 30). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccgaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgatggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggcttccgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367802_S_P-C Feature FT:CDS AB367802_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 16). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB367803_S_P-C Feature FT:CDS AB367803_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 13). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagaggctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtggctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtgtggctttcagttatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
ctctattacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB367804_S_P-C Feature FT:CDS AB367804_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB368297_S_P-C Feature FT:CDS AB368297_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatctttggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB426467_S_P-C Feature FT:CDS AB426467_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|AB471848_S_P-C Feature FT:CDS AB471848_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-F). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB471849_S_P-C Feature FT:CDS AB471849_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-C2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB471850_S_P-C Feature FT:CDS AB471850_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F1S-C1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB471851_S_P-C Feature FT:CDS AB471851_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2NK-F). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB471852_S_P-C Feature FT:CDS AB471852_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2S-C2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB471853_S_P-C Feature FT:CDS AB471853_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F2S-C3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB485808_S_P-C Feature FT:CDS AB485808_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-IT). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB485809_S_P-C Feature FT:CDS AB485809_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FEP1). Non-functional genomic sequence. [Hepadnaviridae] (length=672 residues).
atggagagcacaacatcaggattcctaggacccctgcccgtgttacaggaggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaaacaacacggaaccatgcaaaacctgcacgactcctgctcaaggaacctctatgacaccctctt
gttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcccatgg
gagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgt
ttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctataac
caattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB485810_S_P-C Feature FT:CDS AB485810_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FEP2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB493839_S_P-C Feature FT:CDS AB493839_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 08UC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatccggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaacgaccaccacaggaccttgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB493844_S_P-C Feature FT:CDS AB493844_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 43UC). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatccggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccatgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccttgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB640730_S_P-C Feature FT:CDS AB640730_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ehime-EPCH-HBV-C1-HN). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB642095_S_P-C Feature FT:CDS AB642095_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2000-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB642097_S_P-C Feature FT:CDS AB642097_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2003-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtatttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtktggctttcagttatatggatgatgtggtattggggrcaargtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB642099_S_P-C Feature FT:CDS AB642099_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2005-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctcgatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB642100_S_P-C Feature FT:CDS AB642100_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2006-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670237_S_P-C Feature FT:CDS AB670237_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctggttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactyaccaacctcttgtcctccaacttgwcctggctatcgctggatgtgtctgcrgcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgactcctgctcaarrcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcmtgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttctgwtgtctttgggtatacatttga
>gnl|hbvcds|AB670238_S_P-C Feature FT:CDS AB670238_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccctaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggcccatgcaaggcctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670239_S_P-C Feature FT:CDS AB670239_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttctgttgtctttgggtatacatttga
>gnl|hbvcds|AB670240_S_P-C Feature FT:CDS AB670240_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttctgttgtctttgggtatacatttga
>gnl|hbvcds|AB670241_S_P-C Feature FT:CDS AB670241_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcytgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgyagggctttc
ccccactgtttggctttcagttatatggatgatrtggtattgggggcmaagtctgtacaacatcttgagtccctttwtac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670242_S_P-C Feature FT:CDS AB670242_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactygtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaayttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgatccctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670243_S_P-C Feature FT:CDS AB670243_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.7). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670246_S_P-C Feature FT:CDS AB670246_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.10). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggcgagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcagcatttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctccacttccaggaacatcaactaccagcacgggaccatgcaagaactgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctccataaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670247_S_P-C Feature FT:CDS AB670247_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.11). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB670248_S_P-C Feature FT:CDS AB670248_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.12). Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggcgagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcrgcatttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctccacttccaggaacatcaactaccagcacgggaccatgcaagaactgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctccataaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670249_S_P-C Feature FT:CDS AB670249_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.13). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaayttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgaytcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670251_S_P-C Feature FT:CDS AB670251_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.15). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670252_S_P-C Feature FT:CDS AB670252_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB670253_S_P-C Feature FT:CDS AB670253_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.17). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aatactaaagaatctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcatttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670254_S_P-C Feature FT:CDS AB670254_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.18). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctcgattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670255_S_P-C Feature FT:CDS AB670255_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.19). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaaatctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670256_S_P-C Feature FT:CDS AB670256_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.20). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670258_S_P-C Feature FT:CDS AB670258_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.22). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtggctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacggttcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670259_S_P-C Feature FT:CDS AB670259_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.23). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccaagtgtcttggccaaagttcgc
agtccccaacctgcaatcactcaccaacctcttgtcctccgacttgtcctggctatcgctggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670260_S_P-C Feature FT:CDS AB670260_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.24). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcaatggttcgcagggctttc
ccccactgtttggctttcaggtatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670261_S_P-C Feature FT:CDS AB670261_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.25). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670262_S_P-C Feature FT:CDS AB670262_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.26). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB670263_S_P-C Feature FT:CDS AB670263_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.27). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB670264_S_P-C Feature FT:CDS AB670264_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.28). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|AB670265_S_P-C Feature FT:CDS AB670265_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.29). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccgaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670266_S_P-C Feature FT:CDS AB670266_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.30). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670267_S_P-C Feature FT:CDS AB670267_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.31). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcargacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670268_S_P-C Feature FT:CDS AB670268_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.32). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggaccacccgcgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgttgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtccaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670269_S_P-C Feature FT:CDS AB670269_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.33). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttwtac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670270_S_P-C Feature FT:CDS AB670270_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.34). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AB670272_S_P-C Feature FT:CDS AB670272_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.36). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatcgatgatgtggttttgggggccaagactgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670273_S_P-C Feature FT:CDS AB670273_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.37). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaaytcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670274_S_P-C Feature FT:CDS AB670274_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtcagcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatatggtattgggggcaaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670275_S_P-C Feature FT:CDS AB670275_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcacyaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttttctttgggtatacatttga
>gnl|hbvcds|AB670276_S_P-C Feature FT:CDS AB670276_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670277_S_P-C Feature FT:CDS AB670277_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaccctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670278_S_P-C Feature FT:CDS AB670278_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670279_S_P-C Feature FT:CDS AB670279_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgactgctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670281_S_P-C Feature FT:CDS AB670281_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670282_S_P-C Feature FT:CDS AB670282_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.9). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670283_S_P-C Feature FT:CDS AB670283_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB670285_S_P-C Feature FT:CDS AB670285_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.12). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgstgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670287_S_P-C Feature FT:CDS AB670287_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.14). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670288_S_P-C Feature FT:CDS AB670288_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.15). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB670289_S_P-C Feature FT:CDS AB670289_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.16). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagantcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670290_S_P-C Feature FT:CDS AB670290_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.17). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctccattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670291_S_P-C Feature FT:CDS AB670291_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.18). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagaggctagactcgtggttgacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattacccattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670292_S_P-C Feature FT:CDS AB670292_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.19). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670294_S_P-C Feature FT:CDS AB670294_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.21). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcccctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670295_S_P-C Feature FT:CDS AB670295_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.22). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagtacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctrttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670297_S_P-C Feature FT:CDS AB670297_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.24). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670298_S_P-C Feature FT:CDS AB670298_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.25). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgcgttacaggcgggatttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacgaatcctgccaacggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggcatacatttga
>gnl|hbvcds|AB670300_S_P-C Feature FT:CDS AB670300_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.27). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccgaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670301_S_P-C Feature FT:CDS AB670301_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.28). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgcttgatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670302_S_P-C Feature FT:CDS AB670302_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.29). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670304_S_P-C Feature FT:CDS AB670304_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.31). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcractaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgttgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670305_S_P-C Feature FT:CDS AB670305_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.32). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670306_S_P-C Feature FT:CDS AB670306_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.33). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgcaggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670307_S_P-C Feature FT:CDS AB670307_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.34). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670308_S_P-C Feature FT:CDS AB670308_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.35). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcttcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttatgtctttgggtatacatttga
>gnl|hbvcds|AB670309_S_P-C Feature FT:CDS AB670309_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.36). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctactgccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670310_S_P-C Feature FT:CDS AB670310_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.37). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB670311_S_P-C Feature FT:CDS AB670311_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.38). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttgc
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB675674_S_P-C Feature FT:CDS AB675674_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A33). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcaacaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaccctctatgt
ttccctcttgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB675675_S_P-C Feature FT:CDS AB675675_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A34). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggatcaacaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaccctctatgt
ttccctcttgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB675677_S_P-C Feature FT:CDS AB675677_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A39). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB697490_S_P-C Feature FT:CDS AB697490_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB697494_S_P-C Feature FT:CDS AB697494_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No9). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB697500_S_P-C Feature FT:CDS AB697500_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No17). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB697502_S_P-C Feature FT:CDS AB697502_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No20). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgtkgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaaccttttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaycaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtkatkggggccaagactgtacaccatcttgastccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB697510_S_P-C Feature FT:CDS AB697510_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No33). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB713885_S_P-C Feature FT:CDS AB713885_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate YOGHhbv84). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgatggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgagatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtgtctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB713890_S_P-C Feature FT:CDS AB713890_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate YOGHhbv105). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaaccttttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggcacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB809472_S_P-C Feature FT:CDS AB809472_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H33). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaagttcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcatttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctactgccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactacacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809473_S_P-C Feature FT:CDS AB809473_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KUR13). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttctgttgtctttgggtatacatt
>gnl|hbvcds|AB809474_S_P-C Feature FT:CDS AB809474_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KUR5). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatatatctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaara
ttcctatgggagtgggcctcagtccgtttctcctgactcagtttactagtgccatttgttcagtgattcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttwtac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809475_S_P-C Feature FT:CDS AB809475_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattctctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggttcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809525_S_P-C Feature FT:CDS AB809525_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Kagoshima-S-2006). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcctggcccaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgc
ttccctcttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttcttctggctcagtttaccagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809527_S_P-C Feature FT:CDS AB809527_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Miyazaki-S-2006). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagatcacaacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagcaagggaccatgcaggacctgcacgattcctgctccaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcggaaaa
ttcctatgggagtcggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctatttccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809530_S_P-C Feature FT:CDS AB809530_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Aichi2-S-2006). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809531_S_P-C Feature FT:CDS AB809531_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Aichi1-S-2007). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacatcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcaccggaccatgcaagaactgcacgattcctgctcaaggaaactctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809535_S_P-C Feature FT:CDS AB809535_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Aichi1-S-2008). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809536_S_P-C Feature FT:CDS AB809536_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Aichi2-S-2008). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctctccatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809539_S_P-C Feature FT:CDS AB809539_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Osaka3-S-2008). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809540_S_P-C Feature FT:CDS AB809540_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Osaka4-S-2008). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809544_S_P-C Feature FT:CDS AB809544_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Aichi1-S-2009). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatatgtctgcagcgtttt
atcatattcctcttcatcctgctgccatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctgactcagtttactagtgccatttgttcagtgattcgcagggctttc
ccccactgtttggctttcagttatatagatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttwtac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809545_S_P-C Feature FT:CDS AB809545_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Aichi2-S-2009). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809546_S_P-C Feature FT:CDS AB809546_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Aichi3-S-2009). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809548_S_P-C Feature FT:CDS AB809548_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Gifu-S-2009). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcac
aatgccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactacaaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccacactgtttggcttttagttatatggatgatgtggtattgggggccaaatctgtacaacaccttgagtccctttttac
atctattaccaattttctgttgtctttgggtatacatt
>gnl|hbvcds|AB809549_S_P-C Feature FT:CDS AB809549_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Wakayama-S-2010). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacaggaccatgcaagacatgcacgagtcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809550_S_P-C Feature FT:CDS AB809550_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Okayama-S-2010). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggactcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctctttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809551_S_P-C Feature FT:CDS AB809551_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Aichi1-S-2011). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggattcctaagacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatctccttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809553_S_P-C Feature FT:CDS AB809553_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Aichi3-S-2011). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaaactctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809554_S_P-C Feature FT:CDS AB809554_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Aichi4-S-2011). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccgtcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809555_S_P-C Feature FT:CDS AB809555_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Aichi5-S-2011). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaccacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatactacagagtctagactcgtggtggacttctctcagttttctagggggagcacacgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggacttccgaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgagtcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809556_S_P-C Feature FT:CDS AB809556_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Aichi6-S-2011). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgactcctgctgccaacatctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB809557_S_P-C Feature FT:CDS AB809557_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Aichi7-S-2011). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=678 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgcttctatgcctcatcttcttgttgggtcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatcatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatt
>gnl|hbvcds|AB900099_S_P-C Feature FT:CDS AB900099_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagtacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB900109_S_P-C Feature FT:CDS AB900109_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttayac
cgctattaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|AB900113_S_P-C Feature FT:CDS AB900113_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacggagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaattcgc
agtgcccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcatttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaacgaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB900115_S_P-C Feature FT:CDS AB900115_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB900116_S_P-C Feature FT:CDS AB900116_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB931170_S_P-C Feature FT:CDS AB931170_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2P_HB11-0921). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggactggaaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaagggacctctatgt
ttccctcttgttgctgttcaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB931171_S_P-C Feature FT:CDS AB931171_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2S_HB11-0922). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaagggacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB971714_S_P-C Feature FT:CDS AB971714_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB11-1026). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaggacctgcacgactcttgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB971715_S_P-C Feature FT:CDS AB971715_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB11-1027). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaggacctgcacgactcttgttcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF013631_S_P-C Feature FT:CDS AF013631_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctgcgtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF036236_S_P-C Feature FT:CDS AF036236_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattctc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctgcgtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF036237_S_P-C Feature FT:CDS AF036237_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctgcgtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF036238_S_P-C Feature FT:CDS AF036238_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctgcgtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggttttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF036239_S_P-C Feature FT:CDS AF036239_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctgcaatcactcaccaacctcttgtcctccaatttgtcctgcgtatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF068756_S_P-C Feature FT:CDS AF068756_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF134139_S_P-C Feature FT:CDS AF134139_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgactccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF182802_S_P-C Feature FT:CDS AF182802_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atgcagaacacaacatcaggattcctaggacccctgctcgcgttacaggcggggttttccttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttg
tcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcccgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcaatccgtttctcctggctcagtttactagttccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaatttcctgttgtctttgggcatacatttga
>gnl|hbvcds|AF182803_S_P-C Feature FT:CDS AF182803_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcgtcttcttgttggttcttctggactaccgaggtatgttgcccgtttg
tcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcaatccgtttctcctggctcagtttactagtgccatttgttcagtgggtcgtaaggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaatttcctgttgtctttgggcatacatttga
>gnl|hbvcds|AF182804_S_P-C Feature FT:CDS AF182804_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattctctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaatttcctgttgtctttgggcatacatttga
>gnl|hbvcds|AF182805_S_P-C Feature FT:CDS AF182805_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtagtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgcccgtttg
tcctcttcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcggttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaatttcctgttgtctttgggcatacatttga
>gnl|hbvcds|AF208867_S_P-C Feature FT:CDS AF208867_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate gk4422). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgccacatcttcttgttggttcttctggactaccaaggtatattgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF208868_S_P-C Feature FT:CDS AF208868_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate gs817). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgccacatcttcttgttggttcttctggactaccaaggtatattgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF208869_S_P-C Feature FT:CDS AF208869_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ib2556). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgccacatcttcttgttggttcttctggactaccaaggtatattgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF208876_S_P-C Feature FT:CDS AF208876_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate pal6191). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcggtggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggaatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttcgctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctgagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcccttaatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF209390_S_P-C Feature FT:CDS AF209390_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ab9932). Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagtgcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctgac
aataccacagagtctagactcgtggtggacttctctcaattttcaagggggagcacccacgtgtcttggccataattcgc
agtccccaacctccaatcactcaccaacgtcttgccctccaatttgccctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccggcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagggggcctccgtccgtttctccttgctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcacttatatggatgatgtggtatggggggccaagtctgtacagcatcttgagtccctttttgc
ctcgattaccaattttcttttgcctttgggtatacatttaa
>gnl|hbvcds|AF209393_S_P-C Feature FT:CDS AF209393_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate bttt9625). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgcttcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF209402_S_P-C Feature FT:CDS AF209402_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate sc036). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF223954_S_P-C Feature FT:CDS AF223954_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF223955_S_P-C Feature FT:CDS AF223955_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF223956_S_P-C Feature FT:CDS AF223956_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea3). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF223957_S_P-C Feature FT:CDS AF223957_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF223958_S_P-C Feature FT:CDS AF223958_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AF223959_S_P-C Feature FT:CDS AF223959_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea6). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF223960_S_P-C Feature FT:CDS AF223960_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtgtg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF223961_S_P-C Feature FT:CDS AF223961_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF241410_S_P-C Feature FT:CDS AF241410_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 3270). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccttttttac
ctctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|AF241411_S_P-C Feature FT:CDS AF241411_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8290). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacmtctwgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF286594_S_P-C Feature FT:CDS AF286594_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|AF329858_S_P-C Feature FT:CDS AF329858_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagaacgggaccatgcaagaactgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgctcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF329859_S_P-C Feature FT:CDS AF329859_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccagaaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF329861_S_P-C Feature FT:CDS AF329861_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgctcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF329862_S_P-C Feature FT:CDS AF329862_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgtaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF329863_S_P-C Feature FT:CDS AF329863_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF329864_S_P-C Feature FT:CDS AF329864_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF329865_S_P-C Feature FT:CDS AF329865_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF335733_S_P-C Feature FT:CDS AF335733_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 522). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacgacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcatttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF335734_S_P-C Feature FT:CDS AF335734_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 522). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcatccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF335735_S_P-C Feature FT:CDS AF335735_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 702). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=672 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaaacagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctctt
gttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattcctatgg
gagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgctcagtggttcgcagggctttcccccactgt
ttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctattac
caattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF335736_S_P-C Feature FT:CDS AF335736_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 702). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=672 residues).
atggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctctt
gttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattcctatgg
gagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgctcagtggttcgcagggctttcccccactgt
ttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctattac
caattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF363961_S_P-C Feature FT:CDS AF363961_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggcttccgcaaga
ttcctatgggagttggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF384371_S_P-C Feature FT:CDS AF384371_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G376-7). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctatcaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF384372_S_P-C Feature FT:CDS AF384372_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G376-A6). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=687 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacct
ctatgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttc
gcaagattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagg
gctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccct
ttttacctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF411408_S_P-C Feature FT:CDS AF411408_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF411410_S_P-C Feature FT:CDS AF411410_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaaggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccaccaccctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF411411_S_P-C Feature FT:CDS AF411411_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF411412_S_P-C Feature FT:CDS AF411412_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF415218_S_P-C Feature FT:CDS AF415218_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcttggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacagaaccttcggacggaaacttcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttat
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF415219_S_P-C Feature FT:CDS AF415219_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 14). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacagaaatcgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cactgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF415220_S_P-C Feature FT:CDS AF415220_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 15). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaagcacccaagtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactgccagcacgggaccctgcaaggcctgcatgattcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacagaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cactgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF415223_S_P-C Feature FT:CDS AF415223_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttcgagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctgtgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggtacatcaactaccagcacgggaccatgcaacacctgcacgattcctgcaaacgggacctctatgt
ttccctcttgttactgcacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactaatgccatttattcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattdggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF458664_S_P-C Feature FT:CDS AF458664_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C84). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacttccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF458665_S_P-C Feature FT:CDS AF458665_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C733). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacaacaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aatacctcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggtgtttt
atcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF461357_S_P-C Feature FT:CDS AF461357_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccatgtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF461358_S_P-C Feature FT:CDS AF461358_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH8). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcgcgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttttcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF461359_S_P-C Feature FT:CDS AF461359_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate c16). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcgcgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF461363_S_P-C Feature FT:CDS AF461363_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C8). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccatgtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AF473543_S_P-C Feature FT:CDS AF473543_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2e). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccctgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF533983_S_P-C Feature FT:CDS AF533983_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
agtaccacagagtctagactcgcggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggacgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AJ748098_S_P-C Feature FT:CDS AJ748098_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient Z1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacctcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011097_S_P-C Feature FT:CDS AP011097_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011098_S_P-C Feature FT:CDS AP011098_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AP011099_S_P-C Feature FT:CDS AP011099_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011100_S_P-C Feature FT:CDS AP011100_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtgtacatttga
>gnl|hbvcds|AP011101_S_P-C Feature FT:CDS AP011101_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaattctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AP011106_S_P-C Feature FT:CDS AP011106_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AP011107_S_P-C Feature FT:CDS AP011107_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY057947_S_P-C Feature FT:CDS AY057947_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Tibet705). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacgtgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY066028_S_P-C Feature FT:CDS AY066028_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FH4). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY122487_S_P-C Feature FT:CDS AY122487_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F010). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122488_S_P-C Feature FT:CDS AY122488_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F078). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcattggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122489_S_P-C Feature FT:CDS AY122489_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F105). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122490_S_P-C Feature FT:CDS AY122490_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F123). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtattacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
cgtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122491_S_P-C Feature FT:CDS AY122491_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F131). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122492_S_P-C Feature FT:CDS AY122492_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F139). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122493_S_P-C Feature FT:CDS AY122493_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F157). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaataccacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggacttccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122494_S_P-C Feature FT:CDS AY122494_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F204). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaggcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY122495_S_P-C Feature FT:CDS AY122495_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F211). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaggcaccacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122496_S_P-C Feature FT:CDS AY122496_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F254). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaggcaccacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122497_S_P-C Feature FT:CDS AY122497_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F261). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtattacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaagggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122498_S_P-C Feature FT:CDS AY122498_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F265). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaggtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122499_S_P-C Feature FT:CDS AY122499_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F266). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaagcacccgtgtgtcctggccaaaattcgc
cgtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122500_S_P-C Feature FT:CDS AY122500_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F283). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggggaagcacccaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcaatttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122501_S_P-C Feature FT:CDS AY122501_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F284). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122502_S_P-C Feature FT:CDS AY122502_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F287). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaagggaagcacccgtgtgtcctggccaaaattcgc
cgtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122503_S_P-C Feature FT:CDS AY122503_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F291). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagggcaccacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122504_S_P-C Feature FT:CDS AY122504_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F292). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtattacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122505_S_P-C Feature FT:CDS AY122505_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F296). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacacctgctcgggttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaattcgc
cgtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122506_S_P-C Feature FT:CDS AY122506_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate F298). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122507_S_P-C Feature FT:CDS AY122507_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate K086). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122508_S_P-C Feature FT:CDS AY122508_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate K136). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122509_S_P-C Feature FT:CDS AY122509_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate K240). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccatttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122510_S_P-C Feature FT:CDS AY122510_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate K271). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggacaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacaggaccttgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122511_S_P-C Feature FT:CDS AY122511_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T002). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122512_S_P-C Feature FT:CDS AY122512_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T011). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagaatctagactcgtggtggacttctctcaattttctaggggaaccacccgtgtgtcatggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122513_S_P-C Feature FT:CDS AY122513_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T015). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122514_S_P-C Feature FT:CDS AY122514_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T016). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122515_S_P-C Feature FT:CDS AY122515_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T017). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122516_S_P-C Feature FT:CDS AY122516_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T127). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122517_S_P-C Feature FT:CDS AY122517_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T134). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122518_S_P-C Feature FT:CDS AY122518_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T144). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcacaaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122519_S_P-C Feature FT:CDS AY122519_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T190). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122520_S_P-C Feature FT:CDS AY122520_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T226). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
aatccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122521_S_P-C Feature FT:CDS AY122521_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T230). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaatctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122522_S_P-C Feature FT:CDS AY122522_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T233). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122523_S_P-C Feature FT:CDS AY122523_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T241). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacggagtctagacttgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122524_S_P-C Feature FT:CDS AY122524_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T242). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122525_S_P-C Feature FT:CDS AY122525_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T243). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcgaaacacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatattgaggccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122526_S_P-C Feature FT:CDS AY122526_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T252). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122527_S_P-C Feature FT:CDS AY122527_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T253). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcactcgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122528_S_P-C Feature FT:CDS AY122528_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T267). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggaaggcaccacatcaggattcctaggacccctgctcgtattacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122529_S_P-C Feature FT:CDS AY122529_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T275). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122530_S_P-C Feature FT:CDS AY122530_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate T285). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122531_S_P-C Feature FT:CDS AY122531_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V074). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY122532_S_P-C Feature FT:CDS AY122532_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V075). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122533_S_P-C Feature FT:CDS AY122533_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V102). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122534_S_P-C Feature FT:CDS AY122534_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V116). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaataccacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggacttccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122535_S_P-C Feature FT:CDS AY122535_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V124). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatttggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122536_S_P-C Feature FT:CDS AY122536_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V125). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatttggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122537_S_P-C Feature FT:CDS AY122537_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V132). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacactacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcgcgggaccatgcaggacctgcacgattactgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122538_S_P-C Feature FT:CDS AY122538_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V133). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122539_S_P-C Feature FT:CDS AY122539_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V141). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaataccacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggacttccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY122540_S_P-C Feature FT:CDS AY122540_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V143). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgccttatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaaccactactaccagcacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY122541_S_P-C Feature FT:CDS AY122541_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V150). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|AY122542_S_P-C Feature FT:CDS AY122542_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V158). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgccttatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaaccacaaccaccagcacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaatttttttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122543_S_P-C Feature FT:CDS AY122543_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V159). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122544_S_P-C Feature FT:CDS AY122544_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V178). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgatttctgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatttggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122545_S_P-C Feature FT:CDS AY122545_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V185). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AY122546_S_P-C Feature FT:CDS AY122546_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V221). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcttggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgagtcctgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122547_S_P-C Feature FT:CDS AY122547_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V235). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgggttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccatttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122548_S_P-C Feature FT:CDS AY122548_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V245). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagagtcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatttggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122549_S_P-C Feature FT:CDS AY122549_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V288). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgcacaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatttggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122550_S_P-C Feature FT:CDS AY122550_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate V290). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtatgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122577_S_P-C Feature FT:CDS AY122577_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate P014). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggatttctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aatnccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctacttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|AY122578_S_P-C Feature FT:CDS AY122578_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate P217). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtattacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122579_S_P-C Feature FT:CDS AY122579_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate P398). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122580_S_P-C Feature FT:CDS AY122580_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate P585). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122581_S_P-C Feature FT:CDS AY122581_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate P619). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttccaggggaagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcacaaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122582_S_P-C Feature FT:CDS AY122582_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PH046). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctcgactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttggtggttcttctggattaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|AY122583_S_P-C Feature FT:CDS AY122583_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PH006). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctcgactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122584_S_P-C Feature FT:CDS AY122584_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PQ046). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggattaccaaggtatgttgcccgtttg
tcctctacttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|AY122585_S_P-C Feature FT:CDS AY122585_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PX006). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggatttctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctacttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgattcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY122586_S_P-C Feature FT:CDS AY122586_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate P058). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctacttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167090_S_P-C Feature FT:CDS AY167090_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctatttccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY167091_S_P-C Feature FT:CDS AY167091_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ic). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY167092_S_P-C Feature FT:CDS AY167092_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Id). Partial genome (Contains: HBe, HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccaggtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167096_S_P-C Feature FT:CDS AY167096_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IIIa). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167099_S_P-C Feature FT:CDS AY167099_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IVb). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctaaactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaaatgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206376_S_P-C Feature FT:CDS AY206376_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaaggcctgcacgactcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206378_S_P-C Feature FT:CDS AY206378_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatcctcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AY206379_S_P-C Feature FT:CDS AY206379_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaaggcctgcacgactcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtctggcttttagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206381_S_P-C Feature FT:CDS AY206381_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
tacctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY206382_S_P-C Feature FT:CDS AY206382_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttcttctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaactttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206384_S_P-C Feature FT:CDS AY206384_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatggaagtgtgcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY206385_S_P-C Feature FT:CDS AY206385_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY206386_S_P-C Feature FT:CDS AY206386_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtanggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY206388_S_P-C Feature FT:CDS AY206388_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaaattcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatga
gtccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggccttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggtccgtagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattaggggccaagtctgtacaacatcgtgaggccctttttac
cactattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY206389_S_P-C Feature FT:CDS AY206389_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcaccctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206392_S_P-C Feature FT:CDS AY206392_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaatttcctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY220699_S_P-C Feature FT:CDS AY220699_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactacaaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttctttggtctttgggtatacatttga
>gnl|hbvcds|AY220700_S_P-C Feature FT:CDS AY220700_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaacatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgagagtgggcctcagtccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtaaggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtacacatttga
>gnl|hbvcds|AY220701_S_P-C Feature FT:CDS AY220701_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttatcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggcaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctccacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY220702_S_P-C Feature FT:CDS AY220702_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccaacacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttgacaaga
ttcctatgggagtgggcctcaatccgtttctcctgactcaatttactagtgccatttgttcaatggttcgtaaggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttgtgtctttgggtatacatttga
>gnl|hbvcds|AY247031_S_P-C Feature FT:CDS AY247031_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KUHB84). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY247032_S_P-C Feature FT:CDS AY247032_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KUHB95). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY306136_S_P-C Feature FT:CDS AY306136_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H85). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtcggcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY345162_S_P-C Feature FT:CDS AY345162_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaaactctatgt
ttccctcttgttgctgtacaaaaccttcggacagaaattgcacttgttttcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtctactagtgccatttgttcagtggttcgtacggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatac
cgctattaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|AY345163_S_P-C Feature FT:CDS AY345163_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggaattctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaaactctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtctactagtgccatttgttcagtggttcgtacggctttc
ccccactgtttggctttcagttatatggatgatgtggaattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY582136_S_P-C Feature FT:CDS AY582136_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY596107_S_P-C Feature FT:CDS AY596107_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib-1). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacttgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggattgggcctcagtccgtttctcatggctaagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596108_S_P-C Feature FT:CDS AY596108_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib-2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY641558_S_P-C Feature FT:CDS AY641558_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He74). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY641559_S_P-C Feature FT:CDS AY641559_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He53). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcaatttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttatac
ctctattaccaattttcttgtgtctttgggtatacatttga
>gnl|hbvcds|AY641560_S_P-C Feature FT:CDS AY641560_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He100). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY641561_S_P-C Feature FT:CDS AY641561_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He127). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY641562_S_P-C Feature FT:CDS AY641562_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He82). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaaacacctctattt
ttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcgtcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY641563_S_P-C Feature FT:CDS AY641563_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He52). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatttggtattgggggccaaatctgtacaacatctggagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY646444_S_P-C Feature FT:CDS AY646444_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=680 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacattaa
>gnl|hbvcds|AY738823_S_P-C Feature FT:CDS AY738823_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcacaaacctcttgtcctccaatttgtcctggctatcgttggatgtgtcggcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaagatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctccatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtcgttcgtagggctttc
ccccactgtttggctttcagttatatggataatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY738824_S_P-C Feature FT:CDS AY738824_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccatgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacaacaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctccatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagcggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY738825_S_P-C Feature FT:CDS AY738825_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatccggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaatcacccatgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcaagggaccttgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY738826_S_P-C Feature FT:CDS AY738826_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccttgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY738827_S_P-C Feature FT:CDS AY738827_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaagttcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccttgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcttggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY738828_S_P-C Feature FT:CDS AY738828_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacagccggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagctcccaggtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaacgaccaggacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738829_S_P-C Feature FT:CDS AY738829_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacacgtgcttgagtccctttatac
cactattaccaattttcttttgtctttgggtatacacttaa
>gnl|hbvcds|AY738830_S_P-C Feature FT:CDS AY738830_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattccatggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttgcctttcagctatatggataatgtggtattgggggccaagtctatacagcatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738831_S_P-C Feature FT:CDS AY738831_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaatttttcagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY738832_S_P-C Feature FT:CDS AY738832_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttctgctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AY738833_S_P-C Feature FT:CDS AY738833_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctcgactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtcgttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY738834_S_P-C Feature FT:CDS AY738834_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgatgggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY738835_S_P-C Feature FT:CDS AY738835_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccacactaggattcctaagacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcagcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaca
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|AY738836_S_P-C Feature FT:CDS AY738836_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagctcccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738837_S_P-C Feature FT:CDS AY738837_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738838_S_P-C Feature FT:CDS AY738838_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggaaaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738839_S_P-C Feature FT:CDS AY738839_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggtaccatgcaggacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738840_S_P-C Feature FT:CDS AY738840_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738841_S_P-C Feature FT:CDS AY738841_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaaccttctgtcctccaatttgtcctggctatcgctccatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtcgttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY738842_S_P-C Feature FT:CDS AY738842_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggacaagacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY738843_S_P-C Feature FT:CDS AY738843_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctgttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY738844_S_P-C Feature FT:CDS AY738844_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcagaacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY738845_S_P-C Feature FT:CDS AY738845_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttggccgtttg
tcctctacttccaggaacctcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagttcactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738846_S_P-C Feature FT:CDS AY738846_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY738847_S_P-C Feature FT:CDS AY738847_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcactacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY862869_S_P-C Feature FT:CDS AY862869_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H8). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cactattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|D00630_S_P-C Feature FT:CDS D00630_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggcccaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D10055_S_P-C Feature FT:CDS D10055_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcctggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcaatttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D12980_S_P-C Feature FT:CDS D12980_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttggtgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D23680_S_P-C Feature FT:CDS D23680_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B4-HBVST1). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattacccattttcttttatctttgggtatacatttga
>gnl|hbvcds|D23681_S_P-C Feature FT:CDS D23681_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C4-HBVST2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgc
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattacccattttcttttatctttgggtatacatttga
>gnl|hbvcds|D23682_S_P-C Feature FT:CDS D23682_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B5-HBVKO1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttctcgttgacaagaatccacac
aatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D23683_S_P-C Feature FT:CDS D23683_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C5-HBVKO2). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttctcgttgacaagaatccacac
aatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggcaaggtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtattcatttga
>gnl|hbvcds|D23684_S_P-C Feature FT:CDS D23684_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C6-TKB588). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaccacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D28880_S_P-C Feature FT:CDS D28880_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Plasma 1992-085-9434). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagacttgtggtggacttctctcaattttctagggggagcacccaagtgtcctggcctaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctcgatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacaccaactaccagcacaggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcatttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D50517_S_P-C Feature FT:CDS D50517_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D50518_S_P-C Feature FT:CDS D50518_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D50519_S_P-C Feature FT:CDS D50519_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctgggtcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|D50520_S_P-C Feature FT:CDS D50520_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ089756_S_P-C Feature FT:CDS DQ089756_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK75). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcacttaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089757_S_P-C Feature FT:CDS DQ089757_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2342). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccraaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccaytgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaycttgaayccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089758_S_P-C Feature FT:CDS DQ089758_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1733). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtccaccaacttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgagtcctgctcaaggaaactctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089759_S_P-C Feature FT:CDS DQ089759_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1512). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctggttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgtaaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089760_S_P-C Feature FT:CDS DQ089760_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK454). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089761_S_P-C Feature FT:CDS DQ089761_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK515). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctgcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089762_S_P-C Feature FT:CDS DQ089762_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1644). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccrcgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089763_S_P-C Feature FT:CDS DQ089763_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1048). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgcttgatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089764_S_P-C Feature FT:CDS DQ089764_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK967). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089765_S_P-C Feature FT:CDS DQ089765_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK428). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089766_S_P-C Feature FT:CDS DQ089766_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK553). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttct
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccamggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgyaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089767_S_P-C Feature FT:CDS DQ089767_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1663). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctctggtcctccaayttgtcctggttatcgctggatgtgtctgcggcgttyt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccamgtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089768_S_P-C Feature FT:CDS DQ089768_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1814). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaaccttttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttyt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089769_S_P-C Feature FT:CDS DQ089769_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK430). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcgtgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089770_S_P-C Feature FT:CDS DQ089770_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1272). Complete genome. [Hepadnaviridae] (length=681 residues).
atggaaagcaccatatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089771_S_P-C Feature FT:CDS DQ089771_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1629). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcactacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ089772_S_P-C Feature FT:CDS DQ089772_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK910). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|DQ089773_S_P-C Feature FT:CDS DQ089773_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1193). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089775_S_P-C Feature FT:CDS DQ089775_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK290). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccccgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgstgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089776_S_P-C Feature FT:CDS DQ089776_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK884). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggkagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttg
tcctctgcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|DQ089777_S_P-C Feature FT:CDS DQ089777_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1159). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggtagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttg
tcctctgcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|DQ089778_S_P-C Feature FT:CDS DQ089778_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1442). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089779_S_P-C Feature FT:CDS DQ089779_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK554). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089780_S_P-C Feature FT:CDS DQ089780_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK947). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttggttgttcttckggactaccgaggtatgttgcccgtttg
tcctcyacttccaggaacatcaactaccagcaygggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgrttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089781_S_P-C Feature FT:CDS DQ089781_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1476). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089782_S_P-C Feature FT:CDS DQ089782_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2032). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089783_S_P-C Feature FT:CDS DQ089783_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1402). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatac
cgctattaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|DQ089784_S_P-C Feature FT:CDS DQ089784_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1285). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccakgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089785_S_P-C Feature FT:CDS DQ089785_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1386). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgtwacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttct
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccatcttgagtccctttatac
cgctattaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|DQ089786_S_P-C Feature FT:CDS DQ089786_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2074). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcatctcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ089787_S_P-C Feature FT:CDS DQ089787_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK352). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089788_S_P-C Feature FT:CDS DQ089788_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK820). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatctccctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtcttgggggccaagtctgtacaacatcttgaatccctttatac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089789_S_P-C Feature FT:CDS DQ089789_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK926). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089790_S_P-C Feature FT:CDS DQ089790_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1248). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactacaaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaaggcctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggtctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cactattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089791_S_P-C Feature FT:CDS DQ089791_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1205). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaacyaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtmcaacatcttgaatccctttttac
cgctrttaccaattttctttkgtctttgggtatacatataa
>gnl|hbvcds|DQ089792_S_P-C Feature FT:CDS DQ089792_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK870). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaytcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcmaagtctgtacaacatcttgaatcccttttwac
cgctattaccaattttcttttrtctttgggtatacatttaa
>gnl|hbvcds|DQ089793_S_P-C Feature FT:CDS DQ089793_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK343). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ089794_S_P-C Feature FT:CDS DQ089794_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1896). Partial genome (Contains: HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcaccaaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctcaaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ089795_S_P-C Feature FT:CDS DQ089795_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1465). Complete genome. [Hepadnaviridae] (length=684 residues).
atggagaacacaatatcargattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaaattcaacaaccaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctcta
tgtttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgca
agattcctatgggagtgggsctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggct
ttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttt
tacctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089796_S_P-C Feature FT:CDS DQ089796_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK751). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgc
ggtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacctcaacmaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089797_S_P-C Feature FT:CDS DQ089797_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1169). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaakcactcactaatctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtcttgggggccaagwctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ089799_S_P-C Feature FT:CDS DQ089799_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK734). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggatcatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatctga
>gnl|hbvcds|DQ089800_S_P-C Feature FT:CDS DQ089800_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK741). Partial genome (Contains: HBc, HBx, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttgc
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ089801_S_P-C Feature FT:CDS DQ089801_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK2100). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ089802_S_P-C Feature FT:CDS DQ089802_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1371). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ089803_S_P-C Feature FT:CDS DQ089803_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK931). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggatccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaagggacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ089804_S_P-C Feature FT:CDS DQ089804_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK262). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctagkacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctcgggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtccaccaatttgtcctggttatcgctggatgtgtctgcggcgttct
atcatattcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|DQ141656_S_P-C Feature FT:CDS DQ141656_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EIH46AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ141657_S_P-C Feature FT:CDS DQ141657_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2051Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcaggggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctgataccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ141658_S_P-C Feature FT:CDS DQ141658_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Alr016East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgctcaaggaacctctatgt
ttccctcttgttgctggacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141659_S_P-C Feature FT:CDS DQ141659_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Alr062East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgctcaaggaacctctatgt
ttccctcttgttgctggacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141660_S_P-C Feature FT:CDS DQ141660_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Alr198East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatctga
>gnl|hbvcds|DQ141661_S_P-C Feature FT:CDS DQ141661_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SBT35East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ141662_S_P-C Feature FT:CDS DQ141662_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2076Chinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ141663_S_P-C Feature FT:CDS DQ141663_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2074Chinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccatatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141664_S_P-C Feature FT:CDS DQ141664_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EIHM5Chinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcggggtggacttctctcaattttctagggggaacacccgcgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141665_S_P-C Feature FT:CDS DQ141665_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EIH40AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141666_S_P-C Feature FT:CDS DQ141666_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EIH22AChinese). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggagtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgaacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141667_S_P-C Feature FT:CDS DQ141667_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Alr006East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcacaaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctcgaagccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141668_S_P-C Feature FT:CDS DQ141668_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SBT47East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ246215_S_P-C Feature FT:CDS DQ246215_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GZ-DYH). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatatgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ315781_S_P-C Feature FT:CDS DQ315781_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI0398). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ315782_S_P-C Feature FT:CDS DQ315782_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI0423). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgacgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ315783_S_P-C Feature FT:CDS DQ315783_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI03188). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcaccgacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ361526_S_P-C Feature FT:CDS DQ361526_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NK-586). Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggcccatgcaagacctgcacgattcctgctcaaggaccctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ361533_S_P-C Feature FT:CDS DQ361533_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate UDV-039). Partial genome (Contains: HBe, HBc, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ361534_S_P-C Feature FT:CDS DQ361534_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CR-081). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaagccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ370438_S_P-C Feature FT:CDS DQ370438_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z6-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaacatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacattcga
>gnl|hbvcds|DQ370439_S_P-C Feature FT:CDS DQ370439_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Z6-2). Partial genome (Contains: MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacacgcgtgtcctggccaaaattcgc
agtccccaacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgattg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ377160_S_P-C Feature FT:CDS DQ377160_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT16). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtccagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgatgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ377161_S_P-C Feature FT:CDS DQ377161_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT14). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtctccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttcaaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ377162_S_P-C Feature FT:CDS DQ377162_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT20). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgccgctacgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ377163_S_P-C Feature FT:CDS DQ377163_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT32). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcacaaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ377164_S_P-C Feature FT:CDS DQ377164_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT5). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgttcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
tccctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ377165_S_P-C Feature FT:CDS DQ377165_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT35). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttg
tcctctacttccaggaacatcaactacccgcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtctctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412229_S_P-C Feature FT:CDS DQ412229_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S02006856). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctcgggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaaga
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412230_S_P-C Feature FT:CDS DQ412230_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S02011114). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctagraccccagctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcacaaacctcttgtcctccaatttgtcctggttatcgctggatgtgtcggcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatac
cgctattaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|DQ412231_S_P-C Feature FT:CDS DQ412231_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s02015687). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412232_S_P-C Feature FT:CDS DQ412232_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s02016679). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412233_S_P-C Feature FT:CDS DQ412233_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s02019165). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412234_S_P-C Feature FT:CDS DQ412234_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S02022149). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagtacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgactcctgctcaaggaacctctatgc
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412235_S_P-C Feature FT:CDS DQ412235_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S02023962). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412236_S_P-C Feature FT:CDS DQ412236_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s03000465). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttggggatacatttaa
>gnl|hbvcds|DQ412237_S_P-C Feature FT:CDS DQ412237_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s03001914). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412238_S_P-C Feature FT:CDS DQ412238_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S03003110). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaagttgtcctggttatcactggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttatac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412239_S_P-C Feature FT:CDS DQ412239_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s03003846). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaccaccacatcaggattcctaggacccctgcgcgtattacaggaggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcactcatgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttatcctggttatcgcttgatatatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttyggacggaaattgcacttgtattcccatcccatcatcttgggctttcgyaaga
ttcctatgggagtgggcctcagtccgtttctcctggstcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtytggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412240_S_P-C Feature FT:CDS DQ412240_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S03006015). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412241_S_P-C Feature FT:CDS DQ412241_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S03012130). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcccaggacccctgcgcgtgttacaggaggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtcagcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgccagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacgaaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtattcatttaa
>gnl|hbvcds|DQ412242_S_P-C Feature FT:CDS DQ412242_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S03014552). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
twcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412243_S_P-C Feature FT:CDS DQ412243_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S03015182). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattygc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttct
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412244_S_P-C Feature FT:CDS DQ412244_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S03018054). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412245_S_P-C Feature FT:CDS DQ412245_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S03020213). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctygttgacaagaatcctcac
aataccacagagtctagamtcgtggtggacttctctcaattttctaggggaarcacccrcgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgcttgatgtgtctgcggcgtttt
atcatmttcctcttcatcctgctgctatgcctcatcttcttgttggtwcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcgtgaagccctttttac
cgctattaccaattttcttttrtctttgggtatacatttaa
>gnl|hbvcds|DQ412246_S_P-C Feature FT:CDS DQ412246_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s03023664). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattygc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaytcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412247_S_P-C Feature FT:CDS DQ412247_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s03023763). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtcwgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412248_S_P-C Feature FT:CDS DQ412248_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S03024904). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412249_S_P-C Feature FT:CDS DQ412249_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s04008403). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggscaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412250_S_P-C Feature FT:CDS DQ412250_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s04012010). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacagcgtcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggstatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412251_S_P-C Feature FT:CDS DQ412251_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S04013570). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcacaaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctataaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412252_S_P-C Feature FT:CDS DQ412252_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S04014089). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgcycgggttacaggcggggttttccttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttccagggggaacaccaaagtgtcctggccwaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtcggcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctrcttccaggaacatcaaccacmagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccattgtttggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattactaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412253_S_P-C Feature FT:CDS DQ412253_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s04017049). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412254_S_P-C Feature FT:CDS DQ412254_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s04020623). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgwcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccarggtatgttgcccgtttg
tcctctacttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412255_S_P-C Feature FT:CDS DQ412255_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s04021028). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtcmccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttggggatacatttga
>gnl|hbvcds|DQ412256_S_P-C Feature FT:CDS DQ412256_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S04023536). Partial genome (Contains: LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
acggagagcaccacatcaggattcccaggacccctgcgcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtatctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatctgcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacaggaccatgccagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacgcaaattgcacttgtattcccatcccatcgtcttgggctttcgtaagc
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggtgccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412257_S_P-C Feature FT:CDS DQ412257_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s04023537). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgwcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccarggtatgttgcccgtttg
tcctctacttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttta
>gnl|hbvcds|DQ412258_S_P-C Feature FT:CDS DQ412258_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S04024246). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcraagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412259_S_P-C Feature FT:CDS DQ412259_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s04024338). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412260_S_P-C Feature FT:CDS DQ412260_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s04024460). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412261_S_P-C Feature FT:CDS DQ412261_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S04024773). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtktttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcacaaacctcttgtcctccaayttgtcctggttatcgctggatgtgtcrgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcgtgaagccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412262_S_P-C Feature FT:CDS DQ412262_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S04026172). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
tacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412263_S_P-C Feature FT:CDS DQ412263_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S04026935). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412264_S_P-C Feature FT:CDS DQ412264_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s05000569). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggrgacccaaccatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412265_S_P-C Feature FT:CDS DQ412265_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S05007223). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412266_S_P-C Feature FT:CDS DQ412266_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S05012582). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccrcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggsctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412267_S_P-C Feature FT:CDS DQ412267_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S05014765). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412268_S_P-C Feature FT:CDS DQ412268_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S05014766). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412269_S_P-C Feature FT:CDS DQ412269_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s05015378). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggrarcacccamgtgtsctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaacyaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctctgggtatacatttga
>gnl|hbvcds|DQ412270_S_P-C Feature FT:CDS DQ412270_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S05016361). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaamctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412271_S_P-C Feature FT:CDS DQ412271_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s05019936). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412272_S_P-C Feature FT:CDS DQ412272_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s05020592). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcacttacaaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaagccctttttac
ctctataaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412273_S_P-C Feature FT:CDS DQ412273_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s05023214). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ412274_S_P-C Feature FT:CDS DQ412274_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s06001514). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcrgggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412275_S_P-C Feature FT:CDS DQ412275_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s06001518). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ412276_S_P-C Feature FT:CDS DQ412276_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate s06002114). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaagagaactctayga
twccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggyattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ478885_S_P-C Feature FT:CDS DQ478885_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-D12). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaagtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacttgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ478899_S_P-C Feature FT:CDS DQ478899_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-D20). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtatctgcggcgtttt
atcatactcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgttcctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ478900_S_P-C Feature FT:CDS DQ478900_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-H172). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaggaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgcagctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccgtcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ478901_S_P-C Feature FT:CDS DQ478901_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-H155). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
aacatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcaacttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggaggatgtggtattgggggccaagactgtacaacatcttgactccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ536410_S_P-C Feature FT:CDS DQ536410_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ536411_S_P-C Feature FT:CDS DQ536411_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcaaccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ536412_S_P-C Feature FT:CDS DQ536412_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattccccttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ683578_S_P-C Feature FT:CDS DQ683578_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ890381_S_P-C Feature FT:CDS DQ890381_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcagggttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggttttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ922649_S_P-C Feature FT:CDS DQ922649_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtcggcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggccttagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ922650_S_P-C Feature FT:CDS DQ922650_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctacgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgcttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ922651_S_P-C Feature FT:CDS DQ922651_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggacgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ975272_S_P-C Feature FT:CDS DQ975272_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacttgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ975273_S_P-C Feature FT:CDS DQ975273_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ975274_S_P-C Feature FT:CDS DQ975274_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttcctagttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgcgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtaccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ980547_S_P-C Feature FT:CDS DQ980547_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggagcatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggccttagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ980549_S_P-C Feature FT:CDS DQ980549_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttcgagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttcccccttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggccttagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ980550_S_P-C Feature FT:CDS DQ980550_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ980551_S_P-C Feature FT:CDS DQ980551_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctcccaattttctagggggagcacccacgtgtcgtggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ986375_S_P-C Feature FT:CDS DQ986375_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaatctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ986376_S_P-C Feature FT:CDS DQ986376_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ctccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ993181_S_P-C Feature FT:CDS DQ993181_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctgtcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggcaactgcacttgtattcccatcccatcatcctgggctttcgcaagc
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ993690_S_P-C Feature FT:CDS DQ993690_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 204-1113-Nature1.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcatgattcctaggacccctgctcgtgatacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaattgtcctggccaaaattcga
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctactcccaggaacatcaaccaccagctggggtccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaaga
ttcctatgggagtgggccacagtccgtttctcctggttcagtttactagtgccatttgtccagtggttcgtagggctttc
ccccactgtatggctttcagttatatggatgatgtggtattgcgggccaagactgtacaacatcttgagtccctttttac
ctcaattaccaattttcttttgccattgggtatacatttaa
>gnl|hbvcds|DQ993691_S_P-C Feature FT:CDS DQ993691_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4007-0803-Nature2.2-unSero). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993692_S_P-C Feature FT:CDS DQ993692_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4007-0810-Nature2.1-unSero). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgaatcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993693_S_P-C Feature FT:CDS DQ993693_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 232-1125-Nature1.1-unSero). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF137802_S_P-C Feature FT:CDS EF137802_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgccgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccaccccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctggagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF137803_S_P-C Feature FT:CDS EF137803_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgctcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctggagtccctttttac
ctctattaccaattttcttttgtctttgggcatacatttga
>gnl|hbvcds|EF384200_S_P-C Feature FT:CDS EF384200_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CUIT-01). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF384204_S_P-C Feature FT:CDS EF384204_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CUIT-05). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgatggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF384206_S_P-C Feature FT:CDS EF384206_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CUIT-07). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgatggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF494377_S_P-C Feature FT:CDS EF494377_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TW1138). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaccacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacggagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF494379_S_P-C Feature FT:CDS EF494379_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TW8585). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF536065_S_P-C Feature FT:CDS EF536065_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaaccttttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF536066_S_P-C Feature FT:CDS EF536066_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacgacatcaggattcctaggacccctgctcgtgttgcaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgcggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaaccttttgtcctctaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcatggctcagtttcttagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF645260_S_P-C Feature FT:CDS EF645260_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggacgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggagcatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF645261_S_P-C Feature FT:CDS EF645261_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccacggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctccaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaatctgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF645262_S_P-C Feature FT:CDS EF645262_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF645263_S_P-C Feature FT:CDS EF645263_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF645264_S_P-C Feature FT:CDS EF645264_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtccagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatactgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatattgatgatgtggtattgggggccacatctgtacaacatcttgactccctttatac
cgctattaccaattttcttgtgtctttgggtatacatttga
>gnl|hbvcds|EF645265_S_P-C Feature FT:CDS EF645265_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctgtacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF645266_S_P-C Feature FT:CDS EF645266_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF645267_S_P-C Feature FT:CDS EF645267_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF645268_S_P-C Feature FT:CDS EF645268_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccagggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctactaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF645269_S_P-C Feature FT:CDS EF645269_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtattacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcagttttctaggaaaagcacccgcgtgtcctggccaaaattcgc
agtccccaacctgcaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttagttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttcgcttttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttacac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF645270_S_P-C Feature FT:CDS EF645270_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccacggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctccaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacagaatctgcacttgtattcccatcccatcatactgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EF688062_S_P-C Feature FT:CDS EF688062_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GZ28-1). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcactacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU075312_S_P-C Feature FT:CDS EU075312_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S194-A8). Partial genome (Contains: MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU075314_S_P-C Feature FT:CDS EU075314_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S194-A10). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctagctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttaggtatacatttaa
>gnl|hbvcds|EU075315_S_P-C Feature FT:CDS EU075315_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S194-A11). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaagctatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU075334_S_P-C Feature FT:CDS EU075334_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU075335_S_P-C Feature FT:CDS EU075335_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU075336_S_P-C Feature FT:CDS EU075336_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-49). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU075337_S_P-C Feature FT:CDS EU075337_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-B6). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU075338_S_P-C Feature FT:CDS EU075338_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-B9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU075339_S_P-C Feature FT:CDS EU075339_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-C4). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU075340_S_P-C Feature FT:CDS EU075340_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-C5). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU075342_S_P-C Feature FT:CDS EU075342_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S216-C14). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU082428_S_P-C Feature FT:CDS EU082428_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S245-A1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU082429_S_P-C Feature FT:CDS EU082429_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S245-A2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU082430_S_P-C Feature FT:CDS EU082430_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S245-A3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU082431_S_P-C Feature FT:CDS EU082431_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S245-B4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU082432_S_P-C Feature FT:CDS EU082432_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S245-B6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcacattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU082435_S_P-C Feature FT:CDS EU082435_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S245-B12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgtggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086837_S_P-C Feature FT:CDS EU086837_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S246-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU086838_S_P-C Feature FT:CDS EU086838_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S246-3). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU086839_S_P-C Feature FT:CDS EU086839_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S246-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU086840_S_P-C Feature FT:CDS EU086840_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086841_S_P-C Feature FT:CDS EU086841_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-A1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086842_S_P-C Feature FT:CDS EU086842_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-A6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086843_S_P-C Feature FT:CDS EU086843_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-A9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086844_S_P-C Feature FT:CDS EU086844_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-A12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086845_S_P-C Feature FT:CDS EU086845_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-B3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttcccccttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086846_S_P-C Feature FT:CDS EU086846_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-B4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086847_S_P-C Feature FT:CDS EU086847_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S249-B7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU086852_S_P-C Feature FT:CDS EU086852_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S251-C1). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctagttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|EU093881_S_P-C Feature FT:CDS EU093881_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S385-3). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctactatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtaatgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093882_S_P-C Feature FT:CDS EU093882_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S385-2). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctactatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtaatgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093883_S_P-C Feature FT:CDS EU093883_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S385-4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttcgggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgtacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093884_S_P-C Feature FT:CDS EU093884_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S399-1). Partial genome (Contains: MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgctcgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU093886_S_P-C Feature FT:CDS EU093886_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S399-4). Partial genome (Contains: MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcttggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgctcgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU093887_S_P-C Feature FT:CDS EU093887_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S399-5). Partial genome (Contains: MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgctcgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU093889_S_P-C Feature FT:CDS EU093889_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S399-9). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctagctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU093890_S_P-C Feature FT:CDS EU093890_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S399-B10). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgctcgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgctcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttaggtatacatttaa
>gnl|hbvcds|EU093892_S_P-C Feature FT:CDS EU093892_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S399-B19). Partial genome (Contains: MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgctcgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU093894_S_P-C Feature FT:CDS EU093894_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S399-B8). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctagctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttaggtatacatttaa
>gnl|hbvcds|EU093895_S_P-C Feature FT:CDS EU093895_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S402-13). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcaatggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093896_S_P-C Feature FT:CDS EU093896_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S402-14). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaa
tacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgc
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093898_S_P-C Feature FT:CDS EU093898_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S402-4). Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcaatggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttag
>gnl|hbvcds|EU093900_S_P-C Feature FT:CDS EU093900_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S403-6). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagaggctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtatctgcggggtttt
atcatattcctcttcatcctgctgctatgcctcatctgcttgttggttcttgtggactcccgaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacggggccctgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093902_S_P-C Feature FT:CDS EU093902_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S404-24). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttgctagtgacatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093903_S_P-C Feature FT:CDS EU093903_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S406-16). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttc
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttag
>gnl|hbvcds|EU093906_S_P-C Feature FT:CDS EU093906_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S406-13). Partial genome (Contains: SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagaatctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttag
>gnl|hbvcds|EU093907_S_P-C Feature FT:CDS EU093907_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S408-9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttag
>gnl|hbvcds|EU093908_S_P-C Feature FT:CDS EU093908_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S410-7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccctactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttag
>gnl|hbvcds|EU093909_S_P-C Feature FT:CDS EU093909_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate X441-8). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacgacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttag
>gnl|hbvcds|EU093910_S_P-C Feature FT:CDS EU093910_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S205-2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagcctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttcgggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093911_S_P-C Feature FT:CDS EU093911_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S205-3). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccgcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093912_S_P-C Feature FT:CDS EU093912_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S205-9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcggtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093913_S_P-C Feature FT:CDS EU093913_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S259-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
tcccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093914_S_P-C Feature FT:CDS EU093914_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S259-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccattcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093915_S_P-C Feature FT:CDS EU093915_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S259-12). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttcgggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggtccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagcgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093916_S_P-C Feature FT:CDS EU093916_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S265-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093917_S_P-C Feature FT:CDS EU093917_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S265-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttacccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgggtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU093918_S_P-C Feature FT:CDS EU093918_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S265-14). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU139510_S_P-C Feature FT:CDS EU139510_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-1). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgcttctatgcctcatcttcttgttggctcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
tccctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ccctattaccaatttcctgttgtctttggggatacatttaa
>gnl|hbvcds|EU139511_S_P-C Feature FT:CDS EU139511_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-2). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtgggcttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacatctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagctcgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU139512_S_P-C Feature FT:CDS EU139512_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctctccttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctactcccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccagtgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccgatttcctgttgtctttggggatacatttaa
>gnl|hbvcds|EU139513_S_P-C Feature FT:CDS EU139513_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-5). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgccatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagagctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttggggatacatttaa
>gnl|hbvcds|EU139514_S_P-C Feature FT:CDS EU139514_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-6). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgctggcaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctgtgcctctccttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgaacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU139515_S_P-C Feature FT:CDS EU139515_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-7). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagactagactcgtggtggacttctcccaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcccccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgtcgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttgtatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttggggatacatttaa
>gnl|hbvcds|EU139516_S_P-C Feature FT:CDS EU139516_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU139517_S_P-C Feature FT:CDS EU139517_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-10). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttctcttgttgacaagaatcctcac
aataccaaagagtctagactcatggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgctcggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU139518_S_P-C Feature FT:CDS EU139518_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-11). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggcatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU139519_S_P-C Feature FT:CDS EU139519_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-12). Partial genome (Contains: HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccagcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctgactcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgctaggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU139520_S_P-C Feature FT:CDS EU139520_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-13). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctgggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacatctctatgt
ttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtatcgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU139521_S_P-C Feature FT:CDS EU139521_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-14). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttggggatacatttaa
>gnl|hbvcds|EU139522_S_P-C Feature FT:CDS EU139522_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-15). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
agtaccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgtcgcccgtttg
tcctctacctccaggaacaccaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggcccagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU139523_S_P-C Feature FT:CDS EU139523_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-16). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttggggatacatttaa
>gnl|hbvcds|EU139524_S_P-C Feature FT:CDS EU139524_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-18). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgcttgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctctccttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactggtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU139525_S_P-C Feature FT:CDS EU139525_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-20). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagggtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggccttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU139526_S_P-C Feature FT:CDS EU139526_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-21). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcgcccacgtgtcccggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacatctctatgt
ttccctcttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattaggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU139527_S_P-C Feature FT:CDS EU139527_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-22). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggcccagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttggggatacatttaa
>gnl|hbvcds|EU139528_S_P-C Feature FT:CDS EU139528_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-23). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccgacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgcctttggggatacatttaa
>gnl|hbvcds|EU139530_S_P-C Feature FT:CDS EU139530_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-25). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
agtaccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgtcgcccgtttg
tcctctacctccaggaacaccaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggcccagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU139531_S_P-C Feature FT:CDS EU139531_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-27). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU139532_S_P-C Feature FT:CDS EU139532_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate hwd-28). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacatcgcatcaggattcctaggacccctgctcgtgctacaggcggggtttttcttgttgacaagaatcctcac
aataccaaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaaggcctgcacgactcctgctcgaaacacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagcccgtttcccctggctcagtttactagtgccatttgttcggtggttcgcagggctttc
ccccactgcttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU139536_S_P-C Feature FT:CDS EU139536_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate zxq-4). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccctaacctccaatcactcaccaatctcttgtcctccaatttgtcctggctatcgcttgatgtgtcggcagcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU139540_S_P-C Feature FT:CDS EU139540_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate zxq-8). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctagaacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccactgagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaatttcctgttgtctttgggcatacatttaa
>gnl|hbvcds|EU139541_S_P-C Feature FT:CDS EU139541_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate zxq-9). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacagaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccctaacctccaatcactcacaaatctcttgtcctccaatttgtcctggctatcgcttgatgtgtcggcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaaccaacagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU305540_S_P-C Feature FT:CDS EU305540_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G67-123). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU305541_S_P-C Feature FT:CDS EU305541_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G67-190). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctaggctcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccattatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU305542_S_P-C Feature FT:CDS EU305542_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G67-1251). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtctgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306671_S_P-C Feature FT:CDS EU306671_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctgtcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU306672_S_P-C Feature FT:CDS EU306672_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttct
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU306673_S_P-C Feature FT:CDS EU306673_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtccgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU306674_S_P-C Feature FT:CDS EU306674_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agcccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU306675_S_P-C Feature FT:CDS EU306675_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU306676_S_P-C Feature FT:CDS EU306676_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBe, HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU306685_S_P-C Feature FT:CDS EU306685_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306687_S_P-C Feature FT:CDS EU306687_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306688_S_P-C Feature FT:CDS EU306688_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306689_S_P-C Feature FT:CDS EU306689_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcgc
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306690_S_P-C Feature FT:CDS EU306690_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcgccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306691_S_P-C Feature FT:CDS EU306691_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaatctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306694_S_P-C Feature FT:CDS EU306694_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtttt
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306713_S_P-C Feature FT:CDS EU306713_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgccatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306714_S_P-C Feature FT:CDS EU306714_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306719_S_P-C Feature FT:CDS EU306719_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgtccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306720_S_P-C Feature FT:CDS EU306720_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306721_S_P-C Feature FT:CDS EU306721_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggatcatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306722_S_P-C Feature FT:CDS EU306722_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306724_S_P-C Feature FT:CDS EU306724_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctggtcgtgttataggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacctacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatccatttaa
>gnl|hbvcds|EU306725_S_P-C Feature FT:CDS EU306725_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttaccggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306726_S_P-C Feature FT:CDS EU306726_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306727_S_P-C Feature FT:CDS EU306727_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcacaaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggcccagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306728_S_P-C Feature FT:CDS EU306728_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306729_S_P-C Feature FT:CDS EU306729_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactactaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgatgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcccggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU410079_S_P-C Feature FT:CDS EU410079_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph109). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU410080_S_P-C Feature FT:CDS EU410080_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph76). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggaacatccacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU410081_S_P-C Feature FT:CDS EU410081_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph80). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctaattccaggaacatccacaacaagcacgggaccatgcaaaacctgcacgactcctgctcaaggcacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaa
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatctga
>gnl|hbvcds|EU439005_S_P-C Feature FT:CDS EU439005_S_P-C of [Viruses] Hepatitis B Virus genotype C. Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatccagctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439008_S_P-C Feature FT:CDS EU439008_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcctgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagcgggcctcagtccgcttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctctttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439009_S_P-C Feature FT:CDS EU439009_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctctc
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccctaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439010_S_P-C Feature FT:CDS EU439010_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcctgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactacacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctttttac
ctctattaccagttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439011_S_P-C Feature FT:CDS EU439011_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcctgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactacacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439012_S_P-C Feature FT:CDS EU439012_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcctgtcctccaatttgacctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgcttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439015_S_P-C Feature FT:CDS EU439015_S_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU439016_S_P-C Feature FT:CDS EU439016_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, Pol, HBSP). [Hepadnaviridae] (length=681 residues).
atggagaacataacatcaggattcctaggacccccgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgc
agtccccaacctccaatcactaaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccagggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttattgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU439025_S_P-C Feature FT:CDS EU439025_S_P-C of [Viruses] Hepatitis B Virus genotype C. Partial genome (Contains: HBx, HBSP). [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggttaaaattcgc
agtccccaacctccattcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgactgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgttta
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcatgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU498227_S_P-C Feature FT:CDS EU498227_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JL). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcaccacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaa
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttct
atcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttg
tcctctacttccaggaacaacaactaccagcaggggaccatgcaggacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaactttcggacgcaaattgcacttgtattcccatcccaacatctggggctttcgcaaaa
ttcctatgggggtcggcctcagtccgtttctcctggctcaattcactagtgccatttgttcagtggttcgaagagctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaagccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU522068_S_P-C Feature FT:CDS EU522068_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient 5N). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactcccgaggtatgttgcgcgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
atccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU522069_S_P-C Feature FT:CDS EU522069_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient 5T). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacggggccatgcaagaactgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctataaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU522071_S_P-C Feature FT:CDS EU522071_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient 7T). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
attaccacagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU547559_S_P-C Feature FT:CDS EU547559_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MC02). Non-functional genomic sequence. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggcaattgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU547562_S_P-C Feature FT:CDS EU547562_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MC05). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcac
aatactacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcrtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactrtcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggcccatgcaagacctgcacgactcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
cgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU554535_S_P-C Feature FT:CDS EU554535_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S472-20). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggagcctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU554536_S_P-C Feature FT:CDS EU554536_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S472-24). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagacttgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggagcatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggccccagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU554537_S_P-C Feature FT:CDS EU554537_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S541-13). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgccgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU554538_S_P-C Feature FT:CDS EU554538_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S541-15). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU554539_S_P-C Feature FT:CDS EU554539_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S541-21). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagaacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgt
ttccctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaga
ttcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttc
ccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttac
ctctattaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU554540_S_P-C Feature FT:CDS EU554540_S_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S304-10). Complete genome. [Hepadnaviridae] (length=681 residues).
atggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcac
aataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgc
agtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtttt
atcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttg
tcctctacttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgac