HBVdb

Dataset for nucleotide sequence Genomes of genotype C

[Download (right click)] [Alignment] [Repertoires]

2189 sequence(s)

>gnl|hbvnuc|AB014360_FT00000_P-C Feature FT:source AB014360_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 01D01HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctgcaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacggttcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtccaacatcttgagtccctttttacctctat
taccaattttctgttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaaatcaagcaatgttttcggaaactacct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaagccaccgtgaacgcccaccaggtcttgcccaagctcttgtataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctc
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatcaagcatccagggatttagtagtcag
ctatgtcaatgttaatatgggcataaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggcaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcccaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagcg
cctcctcctgcctccaccaatcggcagtccggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB014372_FT00000_P-C Feature FT:source AB014372_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 13D13HCC). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccaattccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatcctcacaatacc
acagagtctaractcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaaactctacgattccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggcagttggggtactttaccacaggaacatattgtattaaaacttaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttactcaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggccttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtytacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattctgtgggtcaccatattcttgggaacaagagctacagcaaacctcgaaaaggcatggggacgaatctttct
gttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccgccac
acggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagctcctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB014378_FT00000_P-C Feature FT:source AB014378_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 19Y01HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgttagatcccaaagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagaaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagaggctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtcggtacaacatcgtgagtccctttttacckctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggcagttggggtactttaccacaggaacatattgtccaaaaactcaagcaatgttttcggaaattgcct
gtaaatcgacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatatctgcacctttaccccgttgcacggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcgggactgacaattctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctgactctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttatataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacgtttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccccttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggaggtcttttggggcggagccctcaggctcaaggcatattgacaacagtgccagcggcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|AB026811_FT00000_P-C Feature FT:source AB026811_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Recipient 3;97.Feb.). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattatactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgcatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaacagacaactctgttgttctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacgcggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccggtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB105173_FT00000_P-C Feature FT:source AB105173_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hawaii 16). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttaggaaacttcct
acaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgccgctccctttacacaatgtgg
atacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattagatta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagactccggaacatagctcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcttcaatcctgaatggcaaactccctcttttccacacattcatttaaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatgtagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB112472_FT00000_P-C Feature FT:source AB112472_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-TH124). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggactgtactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaactaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggttctttaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgggg
gtacccagcattaatgcctttggatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgctcggcaacggccaggtctttgccaagtggttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgggggcacttcgctacacctctgc
acgaggcatggagaccaccgtgaacgcccgccaggtcttgcccaaggccttacataagaggactctgggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagatgggggaggagactagatta
aagatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgaataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgctcctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaattccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtccctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatatcatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaagctaggcattatttacatactctgtggaaggctggtatcttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggagcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaaccgtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatccgca
ggccatgcagtggaa
>gnl|hbvnuc|AB117758_FT00000_P-C Feature FT:source AB117758_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-CB10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccgcaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaactgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgaccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggatg
atggtctttgtactgggagggtgtacgcatacattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgcggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccatctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgtcaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttactttcggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatatcatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgataatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctgtccacctgtaagagacagtcatactca
ggccatgctgtggaa
>gnl|hbvnuc|AB195930_FT00000_P-C Feature FT:source AB195930_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaggctctactagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcgta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtacaaaaaattaagaactgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtctgggactctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgt
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcacctgcaccatgctactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacccatataa
agaatttggagcttctgctgagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagaatctcaagaacattgttcagctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacttgggtgggcagtaatttggaagacccagcatcccgggaattggtagtcag
ctatgtcaatgttaacatgggcctgaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcccaaccttactaaatatttgcccttggataaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactgcacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaactcaggtaggagcgggagcattcggac
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccacgcagtggaa
>gnl|hbvnuc|AB195936_FT00000_P-C Feature FT:source AB195936_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaactccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcgg
ctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactccttccgcttacagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcggat
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcgtcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|AB195947_FT00000_P-C Feature FT:source AB195947_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctcctagatcccagagtgaggggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttacctcaggaacatattgtacaaaaactaaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctttctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttactttcggaagagaaa
ctgttcttgagtatttggtgtcctttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaatattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB367394_FT00000_P-C Feature FT:source AB367394_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 3/Adefovir-treated Pt. 8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttcgggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgctggggatactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccttttacacaatgtgg
ctatcccgccttgatgcctttatatgcatgtatacaatctaaacaggctttcactttctcaccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagctaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB367427_FT00000_P-C Feature FT:source AB367427_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 36/Adefovir-treated Pt. 18). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaatcaaacgttggggttacacccttaacttcatgg
gttatagaattggaagttggggaactttaccacaagaacatattgtactaaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcgtgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcgtttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgataccg
cctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagttag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaaccccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB367803_FT00000_P-C Feature FT:source AB367803_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ADVT Pt. 13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccaaagtgaggggcctatattttcctgctggtggctccagttccggta
cagcaaaccctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagaggctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtggctgcggcgttctatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtgtggctttcagttatattgatgatgtggtattgggggccaaatctgtacaacatcttgagtccctttttacctctat
tacccattttcttttgtctttgggtatacatttaaaccctaataaaaccaagcgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcggcgcatgcgtggcgcctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttaggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaat
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggaattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggatccagcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcacatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgactacagtgccagcagcg
ccacctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670264_FT00000_P-C Feature FT:source AB670264_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.28). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttatctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggcagttggggtactctaccgcaggaacatattgtacaaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttctacgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacmcstataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcgattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatytggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgcgggccctcttacagctaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaaccaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670277_FT00000_P-C Feature FT:source AB670277_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaccctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattgaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgccaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatccactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcrgcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcctctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcaagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtgaacaatatgtgggccctcttacaactaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatacttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgaccacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670285_FT00000_P-C Feature FT:source AB670285_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.12). Complete genome. [Hepadnaviridae] (length=3194 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgstgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtacgttaccacaggaacatattgtacaaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgtcaacttacaaggcctttt
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggagct
cctagcagcttgttttgctcgcagccggtctggagcaacccttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggaacttaggggc
tgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcctact
gttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataaagaatttggagcttctgtgga
gttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccgcctctgctctgtatcsggagg
ccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctgtgttggggtgagttgatgaat
ctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcagctatgtcaatgttaatatggg
cctattaatcaggcaactattgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatttggtgt
cttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatcttatcaacacttccggaaactact
gttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcag
aagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttattcttct
actgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttacaggaggacattattaatagatg
tcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgctaggttytatccaaacc
ttaccaaatatttgcccttggataaaggtattaaaccttattatcctgaacatgtagttaatcattactttaaaactagg
cattatttacatactctgtggaaggctggcattctatataagagagaaactacccgcagcgcttcattttgtgggtcacc
atattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctttctgtt
cccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattgggactt
caaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggccagggttcaccccaccacacg
gcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcgcctcctcctgcctctaccaat
cggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB670298_FT00000_P-C Feature FT:source AB670298_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.25). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcgacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgcgttacaggcgggatttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacgaatcctgccaacggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggcatacatttgaaccctaataaaaccaaacgttggggctacacccttaacttcatgg
gatatgaaattggaagttggggtactttaccacaggaacatattgtattaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacambctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgcacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctcgcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtactctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcatctatcgtccccttcttcatctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtagaatggagaccaccgtgaacgcccaccaggtcttgcccaagctcttacataagagaactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcacaaacaccattcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgccgagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcgggaacattgttcagctcaccatacagctctcaggcaagctattctc
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacctttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcatagggtgggaaac
tttactgggctttattcttctactgtccctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattcttccccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaatcccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB697500_FT00000_P-C Feature FT:source AB697500_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No17). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggcagttggggtactttaccacaggaacatattatacaaaaacttaagcaatgttttcggaaattgcct
gtaaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcacggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcgggactgacaattctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcacctgcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcagcaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttacctttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcatttgggc
cagggttcaccccacctcacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AF223956_FT00000_P-C Feature FT:source AF223956_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea3). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtcattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttagaaaactgcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgccgctccctttacacaatgtgg
atacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcgggaccgacaactctgtcgtcctctctcggaaat
acacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggaatgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtggggagtaatttggaagacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttaaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcccaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacgaatctttct
gttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattcaaacaatccagattggga
cttcaaccccaacaaggatcaatggccagctgcaaatcaggtaggagtgggatcattcgggccggggttcactccaccac
acggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ089777_FT00000_P-C Feature FT:source DQ089777_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1159). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggtagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttgtcctct
gcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttaggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgccgctccctttacacaatgtgg
atacccagcattaatgcctttgtatgcctgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttggggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgtcgtcctctctcggaaat
acacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtccgcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcctggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggarttgggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgaccaggsatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaagttagacaactattgtggtttcacatctcctgtcttacttttggaagagata
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttaaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatacagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatgggaggttggtctgccaaacctcgacaaggc
atggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggacccggctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggaccaatggcctgcggcaaatcaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|DQ089779_FT00000_P-C Feature FT:source DQ089779_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK554). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttaggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgccgctccctttacacaatgtgg
atacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcacaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtccttkgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaraccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttaaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccctagataaaggcatcaaaccttattatcctgaacatatagtt
gatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ089795_FT00000_P-C Feature FT:source DQ089795_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1465). Complete genome. [Hepadnaviridae] (length=3218 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaagcttctcgaggactggggaccctgcaccgaacatggag
aacacaatatcargattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaaattcaacaaccaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctctatgtttc
cctcttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattc
ctatgggagtgggsctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccc
cactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctc
tattaccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaatttta
tgggatatgtaattggaagttggggtactttaccgcaggaacatattgtactcaaactcaagcaatgttttagaaaattg
cctgtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatg
tggctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcct
ttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaacc
cccactggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcgga
actcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcgga
aatacacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcg
gcgctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgac
cacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctc
tgcacgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcag
caatgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattagg
ttaatgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgccta
atcatctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccata
taaagaatttggagcatctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgaca
ccgcctctgctctgtatcgggaggccttggagtctccggaacattgttcacctcaccatacagcactcaggcgagctatt
ctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagt
cagctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagag
aaactgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatc
ttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacg
aaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggga
aactttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcattt
acaggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaatta
tgcctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgca
gttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacg
tagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaa
ggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaa
ctcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcg
ggccagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagca
gcacctccttctgcctccaccaatcggcagtcaggaagacagcctamtcccatctctccacctctaagagacagtcatcc
tcaggccatgcagtggaa
>gnl|hbvnuc|DQ089802_FT00000_P-C Feature FT:source DQ089802_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1371). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctttgctagatcccagagtgaggggcctgtatkttcctgctggtggctccagttccggag
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactctaccacaggaacatattgtgctaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcccgccttaatgcctctgtatgcatgtatacaggctaagcaggctttcactttctcgccaacttacaagacttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcaataggccataagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggaaccgacaactctgttgttctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcccgcggccgtttgggcctctatcgtccccttctacatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattaatagtcag
ctatgtcaatgttaatatgggcctraaaatcagacaattattgtggtttcacatttcctgycttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcacttgca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccctattatccggaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccckgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
caggattcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ089804_FT00000_P-C Feature FT:source DQ089804_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK262). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgttagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctagkacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctcgggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtccaccaatttgtcctggttatcgctggatgtgtctgcggcgttctatcata
ttcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttatgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
gttaatagacctattgattggaaggtgtgtcagagaattgtgggtcttctaggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcgggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactggggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtccccttctgcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttactgactgggaggagttgggggaggagatgaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctattgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggatgctctgcgcagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
ccactgctctgtatggggaggccttagagtctccggaacattgttcagctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatcaagcatccagggacttggtagtagg
ctatgtcaacgttaacatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagata
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccacmaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacccgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggcaggctggtattttatataagagagaaactacacgcag
tgcctcgttttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttcggttcccaatcctctgggattctttcccagtcaccagttggacccagcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatctttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ377161_FT00000_P-C Feature FT:source DQ377161_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WJT14). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtctc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttcaaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgctggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtactgaaactcaagcaatgttttcgtaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttcttcccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatctcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacgaatctttct
gttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagcacctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EF536066_FT00000_P-C Feature FT:source EF536066_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctgtactttcctgctggtggctccggttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgccaatcttctcgaggactggggaccctgcaccgaacatggag
aacacgacatcaggattcctaggacccctgctcgtgttgcaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgcggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaaccttttgtcctctaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttcttagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggaagttggggtactttaccgcacgaacatattgtacaaaaaatcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggacttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcctgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccgggcgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacgcgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgttaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttccccacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaagctaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU871998_FT00000_P-C Feature FT:source EU871998_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-00-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccatgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacctcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cttcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccataccgcactcaggcaagagattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcaa
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggggtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctttcctaaccttaccaaatatctgccattggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatctacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggcccgaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggaaccctcaggctcggggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|EU939538_FT00000_P-C Feature FT:source EU939538_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattatacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcaccaacttacaaagcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggtaccgacaactctgtggtcctctctcggaaat
acacctcgtttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcctaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggawttagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|EU939585_FT00000_P-C Feature FT:source EU939585_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B126). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaactaaacgctggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtactgaaaatcaagcaatgttttcgtaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggggcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtttggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacctatataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttttttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcctgaacattgtacacctcaccatacggcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactccccccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaagtcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|FJ386589_FT00000_P-C Feature FT:source FJ386589_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1830). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaactttccaccaggctctgctagatccaagagtgaggggcctatatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagagtcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggatatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatcatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtcaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgcaccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcagcg
ctgaacccagcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcataaaaccttattatccggaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
tgcatcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctccgggcatattgacatcagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386631_FT00000_P-C Feature FT:source FJ386631_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2359). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctttgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcgaaaattgcct
gtaaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttryataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgactcatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaattccctcctttcctcacattcatttaaa
ggaggacattattcatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcatgctcagggcatattgacaacagtgccaccagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
agccatgcaatggaa
>gnl|hbvnuc|FJ386632_FT00000_P-C Feature FT:source FJ386632_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2370). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagacttgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaraccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttacggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctcaaattaagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggarcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtaccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562225_FT00000_P-C Feature FT:source FJ562225_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I19). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttaggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcaacatctcctcgacaccg
cctctgctctctatcgggaggccttggagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgaggtgatgaatttggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttcacactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562291_FT00000_P-C Feature FT:source FJ562291_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I163). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgcccacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcgtgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaattctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggaccattggccagaggccaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ787456_FT00000_P-C Feature FT:source FJ787456_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1092-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttgtgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggaactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtggggcttttaggctttgctgccccttttacacaatgtgg
ctatcctgccttaaagcctttatatgcatgtatacaatctaagcaggctttctctttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtctgctgacgcaaccccc
actggctggggcttggctatgggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatacagcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtccccttcttcatctgccgttccgaccgaccac
ggggtgtacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
gcgtcgcatggagaccaccgtgaacgcccaccaggtgttgcccaaggtcttacataaaaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccgtctgacttctttccttctattcaagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcac
ccatgtcaatgttaacacgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattactttaaaactatgcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ787462_FT00000_P-C Feature FT:source FJ787462_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1357-3). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaagggacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccaccccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctcactcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgcatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaaactgatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccctgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaacccccttttttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctctcacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcacggggacaaatctttct
gttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagttgcacctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ787464_FT00000_P-C Feature FT:source FJ787464_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1371-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgccttacccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcctgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaaacaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcgaagaattgtaggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtattcaaactaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacacaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacttcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccatctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattaatagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcacccctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ787479_FT00000_P-C Feature FT:source FJ787479_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S157-7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctctacaacattccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgcttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctgataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggcaccttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggcttcgctgccccctttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgcccgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggggcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttgctgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggccttttggggtggagccctcaggctcaaggcacattgacaacagtgccagtaaca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|GQ372968_FT00000_P-C Feature FT:source GQ372968_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6380-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgcggggcctatattttcctgctggtggctccagttccggaa
cagtaagccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaagtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacttgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttacctcaggaacatattgtattaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagaccgattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtatctgccaagtgtttgctgacgcaaccccc
actgactggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcttgttttgctcacagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgatccgtctcggggccgtttggggctctatcgtcccctgcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagaatgggaggagttgggggaggagattaggtta
atgatctatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactattcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcaattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattaatagtcgg
ctatgtcaatgttaacatgggcctgaaaatcagacaactactgtggtttcatatttcctgtcttactttcggaagagaaa
ctgttcttgagtatttggtgtctttcggagtgtggattcgcactccttccggttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattatcaatagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagggctacagcatgggaggtccgtcttccaaacctcgacaaggc
atggggacgaatctttccgttcccaatcctctgggatcctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccggaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagcccccaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagcggaa
>gnl|hbvnuc|GQ377538_FT00000_P-C Feature FT:source GQ377538_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J52). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagtttcggaa
cagtacaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctgatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagcgaattgtgggtctgttaggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agagtttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttcctgaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagactaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcccttggacaaaggtattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377551_FT00000_P-C Feature FT:source GQ377551_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J82). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacttaaactcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgagacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactctcggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaatagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377554_FT00000_P-C Feature FT:source GQ377554_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J85). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacgacattccaccaagctctgctagatccaagagtgaggggtctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggcttttactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctcgcagcttgttttgctcgcagccggtctggggcgaaactcatcggaaccgacaactctgttgtcctctcccggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377562_FT00000_P-C Feature FT:source GQ377562_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J97). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatccaaaagtgaggggtctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggcagttggggtactttaccacaggaacatattgtactgaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccagatcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcaagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccctcttttccttacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggt
cagggttcaccccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377563_FT00000_P-C Feature FT:source GQ377563_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J98). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttcgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgtttgggtctctaccgtccctttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aagatctttgtactgggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgagtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctctcacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475308_FT00000_P-C Feature FT:source GQ475308_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR4CHB). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacatttcaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcgggactgacaactcggttgtcctctctcggaaat
acacctcattcccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaagattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475344_FT00000_P-C Feature FT:source GQ475344_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR40HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgccaggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctctttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
atatgtcaatgttaatatgggcctaaaagtcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctccttccctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcgtccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475346_FT00000_P-C Feature FT:source GQ475346_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR42HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactctcttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtaatgaaactcaagcaatgttttcggaaactacct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtctcttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcgtgttttgctcgcagccggtctggggcgacacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgcttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattaacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccgcctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475347_FT00000_P-C Feature FT:source GQ475347_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR43HCC). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccacttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtaatgaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacagtgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactcggttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatttttaatcctgaatggcaaactccctcctttcctaacattcatttaca
tgaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaacctcaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgaaaaggcatggggacgaatctttct
gttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagctcctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HM750132_FT00000_P-C Feature FT:source HM750132_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Tibet-165). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccttgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaactttatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcgggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctgtcacggaaat
acacatcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtgttgcccaaggtgttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
cggtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccgtggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctaccctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700563_FT00000_P-C Feature FT:source HQ700563_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BL9389_2002). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctttattatcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
ttcccattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgatggggatattcccttaatttcatgg
gatatgtaattggcagttggggtaccttaccacaagaacatattgtacgcaaaatcaaacaatgtttcagaaaacttcct
gtaaataggcctattgattggaaagtgtgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtattcaagctaagcaagctttcactttttcgtccacttacaaggtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggggtctatcgtccccttcttcgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagatcaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
cttcagctttgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagttgtcag
ttatgttaacattaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttaaa
agaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaagaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggggcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaacagtgcccgcagcg
cctcctcctgcctccaccaatcggcagtcaggacgacagcctactcccatctctccgcctctaagagatactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700576_FT00000_P-C Feature FT:source HQ700576_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To250_2006). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccaragtaargggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcactgaacatggag
aacacaacatcaggattccyaggacccctgctcgtatyacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
gcttccaggaacatcaactaccagcacgggaccatgcaagacctgcamgattcctgctcaaggaacctctatgtttccct
catgttgctgtwcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacckctat
taccaattttcttttgtctttgggtatacatttaaacmctrataagactaaaagatggggctattcacttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaagaacatattatacwaaaaatcaaacamtgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtctgttgggctttgctgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtattcaagcgaaacaagctttcactttttcgycmacttacaaagtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctccgctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcaaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctmcgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatstaccgtccccttctycgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcayctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagcttagatta
awgrtstttgtactaggaggctgtaggcataaattggtctgttcaccagyaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttcttcccatcgattcgagatctcctcgacaccg
cctcagctctgtaccgggaggctttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggcagtaatttggaagacccagcatccagagaattagtggtcag
ttatgtcaacrttaatatgggcctaaaaatcagacaactattgtggtttcacatttcytgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaygcagaggcaggtccactagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttgaa
agaggacattatcaataggtgtcaacaatwtgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
cagctaggttttatcctaaccttaccaaatatttgcctttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaatctggcattctatataagagagaaactacacgcag
cgcctcattttktgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccwgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcayawtgacaacagtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctackcccatytctccaccgctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JF828928_FT00000_P-C Feature FT:source JF828928_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggtctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcaacctgctgctatgcctcatcttcttgttggttcttcgggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcggttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattgaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctcagccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttattgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagccctcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcatatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ027320_FT00000_P-C Feature FT:source JQ027320_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctactagatcccagagtgaggggcctatactttcctgctggtggctccggttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcacyaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactrycaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgwttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttwtaccgctrt
taccaattttcttttgtctctgggtatacatttraaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
gtaaatagacccattgattggaaagtatgtcaaaggattgtgggtcttctgggctttgccgctccgtttactcaatgtgg
ttacccagcattaatgcccttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccctgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgtcgtactctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccmtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgwaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatccagggaattggtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaactcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttgaa
agaggatattatcgagagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacctaaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaaccacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaagctcagggcatattgacaacaataccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ027333_FT00000_P-C Feature FT:source JQ027333_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctaratcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctrt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattatacaaaaaatcaaacaatgctttcgaaaacttccc
gtaaatagacctattgattggaaagtatgtcaaaggattgtgggtcttttggggtttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatayctgaacctttaccccgttgctcggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcagctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagayccggcatccagggaattagtagtagg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcatattcatttgaa
agaggatatcatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcatcaaaccttattatccggaacatacagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcagtggccagcggcaaatcaggtaggagtgggatcattcgggc
cggggytcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|JQ040162_FT00000_P-C Feature FT:source JQ040162_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G216). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggctgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctcttgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgcctatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttctctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaaatttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtctaacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcaytaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacccgcag
cgcctcattttgtgggtcaccatattcttgggracaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ040172_FT00000_P-C Feature FT:source JQ040172_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G243). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgcccctttcacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacactctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtakgcataaattggtctgttcaccagcaccatgcaaatttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacmcgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctttggaaggctggcattctatataagcgagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtyggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggatcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagactgcctactcccatctctccacctctaagagacagtcatcctca
ggccatrcagtggaa
>gnl|hbvnuc|JQ801473_FT00000_P-C Feature FT:source JQ801473_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgttcaacatcttgaatccctttttacctctat
taccaattttctgttgtctttgggcatacatttaaaccctaataaaaccaagcgttggggttactcccttaacttcatgg
gatatgttattggaagttggggttccttaccacagcaacatattgtactaaaattgaaacaatgttttcgaaaacttcct
atcaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggttttgctgcaccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcacgacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagagaactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtattcaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtaaagggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtccattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttgtagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttacccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagcgggagcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcaaggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ801482_FT00000_P-C Feature FT:source JQ801482_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS27). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgagaggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggcaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttatccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagcaggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggagcgtgtgcacttcgcttcacctctgc
acgtctcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctcagctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcattaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggcaac
tttactgggctttattcttctacggtacctgtctttaatcctgactggcaaactccctcttttcctcaaattcatttgaa
agaggacattatcaacagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttacataagggcattaaaccttattaccctgaacatacagtt
aatcattatttccaaactagacattatttgcatactctgtggaaggctggtatcttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacgaggc
atggggacgaaccttgcggttcccaatcctctgggattctttcccgatcaccagttggacccagcgttccgagccaattc
aaacaatccagattgggacttaaaccccaacaaggatccatggccagaggcatggcaggtaggagtgggatcattcgggc
cagggttcactccaccccacggcaatcttttggggtggagccctcaggctcagggcatattgacaacactgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctgagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ801493_FT00000_P-C Feature FT:source JQ801493_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS41). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctttgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttctatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacgcaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgctcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatcccttttttcctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacgttgccacaggaacatattgtccaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgccaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatacgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtcccctactgcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacaaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttgcatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctccacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggatttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ801497_FT00000_P-C Feature FT:source JQ801497_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagcgctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttctgttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggcctctatcgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctcagctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcacttgaa
agaggacattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgaag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagccaaccaggtaggagtgggatcattcgggc
cagggttcactccaccccacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctcctccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|JQ801523_FT00000_P-C Feature FT:source JQ801523_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL31). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttcaggaa
tagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttaacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgcaccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgagggacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcacgacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtattcaaagactgggaggagttgggggaggagatagggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctcttctggatcccctctacaccg
cctctgctctgtatcgggaggccttaaagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccgcctgggtgggaagtaatttggaagacccagcatccagggaattattagtaag
ctatgtcaatgttaacacgggcctaaaaatccgacaactattgtggtttcacattacctgtcttactttaggaagagaaa
ctgttctggaggagttggtgccttttgcacggtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaacacccacgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttacccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggacgtcgatcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774182_FT00000_P-C Feature FT:source KC774182_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz1013). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgattatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctagattttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774220_FT00000_P-C Feature FT:source KC774220_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2152). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgccgttatatgcatgcattcaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcttctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatcagccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagttag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttactgggctttattcttctaccgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttacccaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774253_FT00000_P-C Feature FT:source KC774253_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1039). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctttacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
accacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcggtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgccaaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttgggggtactcccttaacttcatgg
gatatgtaattggtagttggggtaccttaccacaagatcatattgtactgaaaatcaaacaatgttttcggaaacttcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttttactttctcgccaacatacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccgtaggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggtacggacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctcagctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgtcgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtccg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttcttctgtacctatctttaatcctgagtggcaaactccctcttttcctcacattcatttgca
tgaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttacatactttgtggaagggtggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccgccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|KC774295_FT00000_P-C Feature FT:source KC774295_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1207). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtgctgaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctatgggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctttcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatacgctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcgtccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF214655_FT00000_P-C Feature FT:source KF214655_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IND-1963-11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctctgcaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacgttaccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgtcaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggcttctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtactgccaactggatcctccgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaacccccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcccaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctccttccctaacattcatttaca
ggaggacattattaacagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacacactctgtggaaatctggcattctatataaaagagaaactacccgtag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatcctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagaaagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873514_FT00000_P-C Feature FT:source KF873514_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 053_EA_Gap). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcattccatcaagctctgcaagatcccagagtaaggggtctgtattttcctgctggtggctccagttccgggg
cagtaaaccctgttccgaatactgtctctcccatatcatcaatcttcacgaagactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctaggggaagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcactaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggwtcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatccacacaaaacgaaaaggtggggttattctctccacttcatgg
gatatgtaattgggagctggggragcttaccgcaagatcatattatccaaaaactcaaacagtgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaaagaattgtgggtctcttgggcttcgctgcccctttcacacaatgtgg
gtatcctgcattaatgcctttgtatgcatgtatacattctaagcaagctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggcccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcatgcgkggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgtttcgctcgcagccggtctggggcgaaccttctcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaaccccgcggacgacccttctcggggccgcttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccacatgatcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggtta
aagrtytttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccktataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgtgatctcctcgacacag
ccgccgctctgtatcgagagkccttagagtctccggaacattgctcagctcaccatacagcactcaggcaagctattctr
tgttggggtgcgttaatgaatctggccacctgggtgggaagtaatttggacgacccagcatccagggaattagtagtcag
ytatgtcaatgttaatatgggcctacaaattagacaactattgtggtttcacatttcctgcctgacttttggaagaacca
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcaagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgatattcacttacg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaagacgattgaaattaattatgc
ctgcaaggttctatcctactcttaccaaatatttgcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctctataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggacctccaaacctcggaaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggggcgggagcattcgggc
cagggctcaccccaccacacggcggtcttttggggtggagcccgcaggcccagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatcacaccacccctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173306_FT00000_P-C Feature FT:source KJ173306_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NB023M(M23)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggcatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtgctaaaaatcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtactctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcatttgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcaacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaagggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173317_FT00000_P-C Feature FT:source KJ173317_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NH25C(e38)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcatcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcccggggccgtttgggactctatcgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctctacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcac
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatactatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatactcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
gtggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ410489_FT00000_P-C Feature FT:source KJ410489_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1202). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccagcactttccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaaaaatgttttcggaaacttccc
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttggggtttgccgctccctttacacaatgtgg
ttacccagcattaatgcctctgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctggacctttaccccgttgctcggcaacgggcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcattggcaccgacaactctgtcgtccttgctcggaaat
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgccccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcctgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttccattcgtgatctcctcgacaccg
caactgctttgtatcgggaggccttagagtctccggaacattgttcagctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagagaattagtagtagg
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacctttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctccaccttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtgttttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatcttgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598636_FT00000_P-C Feature FT:source KJ598636_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB1C4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctaccctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcttttc
tttgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctcccggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtctgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaaccgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctcagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598670_FT00000_P-C Feature FT:source KJ598670_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB38). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctgctagatcccagagtgaggggcctatacctccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcacggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcactaggccataagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctctaccgtccccttctttgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttatataagaggactattggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacctggcaacctgggtgggaagtaatttggacgacccagcatcccgggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggttccacatctcctgtcttacttttggaagagcaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattattgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgtccttggataaaggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|KJ598737_FT00000_P-C Feature FT:source KJ598737_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB624). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgattccct
cttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcacggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcactaggccatcagcgcctgcgtggaacctttgtggctcctctgccgattcatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctctaccgtccccttctgtgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccgttcgtgatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagatccagcatcccgggaattagtagtaag
ctatgtcaatgttaatatgggcataaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattatcgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803811_FT00000_P-C Feature FT:source KJ803811_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY511545). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttaacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaagggacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcctcttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcctgccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagacctcctcgacaccg
cctctgccttgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactgaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcggcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctaacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccagacgaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattttttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagcaaaccaggtaggagtgggagcattcggac
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148462_FT00000_P-C Feature FT:source KP148462_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y17-9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgagtctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactccttccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgccccgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148563_FT00000_P-C Feature FT:source KP148563_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y26-3-56). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttatctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacacattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaaatgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctatgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttaggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggcgcttctgtggagttactcccttttttgccgtctgacttctttcctgctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggcagtaatttggaagacccagcatccagggatttagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattctcctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactctaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013764_FT00000_P-C Feature FT:source KR013764_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacgacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgcggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttcctt
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtttgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccgagtgtttgctgacgcaaccccc
actggatggggcttggcagtaggccatcagcgcatgcgtggaacctttgtggctcctccaccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaactcattggaaccgacaactctgttgtcctctctcgaaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtcttcgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctccgtatcgggaggccttagagtctccggaacattgtccacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcttcaattctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccagcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccctctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013828_FT00000_P-C Feature FT:source KR013828_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattctta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggctgttggggtactttaccgcaagaacatattgtactcaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcatttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttggggggggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatctggtgtcttttggagtgtggattcgcactccccctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgctg
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013851_FT00000_P-C Feature FT:source KR013851_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaatcttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacgaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatattgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtcttcgtactaggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcattcagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttaagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcacaaggtgggaaac
tctactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcagcaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacgaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatcttcctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963881_FT00000_P-C Feature FT:source KU963881_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6_11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagttctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtacaaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacctcaccaaatatttgcccttggataaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaacac
aaacaatccagattgggacttcaacccaaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963898_FT00000_P-C Feature FT:source KU963898_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 7_13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaataggcctattgattggaaggtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaacttatcggcaccgacaactctgttgtactctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
atgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacatcg
cctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964023_FT00000_P-C Feature FT:source KU964023_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 16_4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacgttccaccaagctctgctagatcccagagtgaggagcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtgattgggagttggggtactttaccacaggaacacattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaagcctttc
tgtgtaaacaatatcttaacctctaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccccttctgagtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagagaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactatacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttactatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccacacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatactgacaacagtgccagcagcg
cctcctcctgccaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964036_FT00000_P-C Feature FT:source KU964036_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 17_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggttgttggggtactttaccgcaagaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcgtgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtacacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattcttaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggcgattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacacactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcgggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964052_FT00000_P-C Feature FT:source KU964052_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18_4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactcaaactcaagcaatgttttcgcaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctagtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttattatccggaacatgtagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccacacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatactgacaacagtgccagcagcg
cctcctcctgccaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964056_FT00000_P-C Feature FT:source KU964056_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactcaaactcaagcaatgttttcgcaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagctgcttgttttgctcgcagccggtctggagcaaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctagtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttattatccggaacatgtagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccacacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatactgacaacagtgccagcagcg
cctcctcctgccaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964209_FT00000_P-C Feature FT:source KU964209_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 28_10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctcacccatatcgtcagtcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagaggctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtactaaaaatcaagcaatgttttaggaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttgtatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctcagccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctacgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
ccacagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaaaagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964241_FT00000_P-C Feature FT:source KU964241_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 30_13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcaccaagctctactagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgattccct
cttgttgctgtacaaaaccttcggacagaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcacggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcactaggccatcagcgcctgcgtggaacctttgtggctcctctgccgattcatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctcttccgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtataggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctgctcgacaccg
ccactgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtaag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctctcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattatcgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctcggttcccaatcctctgggattctttcccgatcaccagttggatcctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX765832_FT00000_P-C Feature FT:source KX765832_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PID:0647). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtgaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccmcac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggaaaactccctcttttcctcccattcatttgaa
agaggatattatcaacagatgtcaacaatacgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY363286_FT00000_P-C Feature FT:source KY363286_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate geno20.3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctattcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaattcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttggtgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatcttaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccctactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctcacggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacctatataa
agaatttggagcttctgtggagttactctcttttttgcctactgacttctttccttcaattcgagatctcctcgacaccg
ccacagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcgg
ctatgtcaatgttaatatgggcctgaaaatcagacaacttttgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactcccccgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttccttccattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcggac
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470899_FT00000_P-C Feature FT:source KY470899_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 24-C10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcatgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagatttcta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaacttaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaacataagcaggctttcactttctcgccaacttacaaggcctttc
tttgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaaccttcgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatactccaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctccttgacaccg
cctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctt
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagcgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagtctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470974_FT00000_P-C Feature FT:source KY470974_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WR-20). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctgggctaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcactcgtattcccatcccatcatcctgggctttcgcaagattccaa
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtacttaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaagctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcagctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccctccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggtta
atgatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgagtattcggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881776_FT00000_P-C Feature FT:source KY881776_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate control-03). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccattcttctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881812_FT00000_P-C Feature FT:source KY881812_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggactcctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtatttccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacctcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtgctgaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtattcaatctaagcaggctttcactttctcgccaacatacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggcctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgacccgtctcggggccgcttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcatctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggtcttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacacttccagtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatacgctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggt
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881878_FT00000_P-C Feature FT:source KY881878_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-05). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggagcctatactttcctgctggtggctccagttccggaa
caggaaaccctgtcccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacagtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctgttcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttcgagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
cgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgccattagacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|LC279254_FT00000_P-C Feature FT:source LC279254_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23_hair). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacctccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggcagttggggtactttgccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgctccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgagtggaacctttgtggctcctctgccgatccatactgcggaact
cgtagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
agaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggagacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|LC279259_FT00000_P-C Feature FT:source LC279259_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 41_mother_nail). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctatcggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactcggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggtattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
tgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|LC279260_FT00000_P-C Feature FT:source LC279260_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 41_mother_serum). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctatcggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactcggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggtattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
tgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccacaggctcagggcgtattgacaaccgtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674408_FT00000_P-C Feature FT:source MF674408_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV040044). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccaaagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcrtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccctttacccaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctcacggaagt
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcctcttcttcgtctgccgttccgaccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgaatggaaaactccctcttttcctaacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaacagtaccaaatatttgcctttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcaccccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG826126_FT00000_P-C Feature FT:source MG826126_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate YNKM85). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcttggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgacacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctctgggtatacatttaaaccctaacaaaaccaaacgttggggctactctctcaactttatgg
gctatgtaattggaagttggggtacattgccacaggaacatattgtactaaaaatcaaacaatgttttaggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtatgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgcgtaaccaatatctgaacctttaccccgttgcccggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcactaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaacattatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggaatctaccgtccccttctgtgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccagggattgcccaaggtcttatataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatccagggaatcagtagtagg
ctatgtcaacgttaatatgggcataaaaattagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaagacattatcaatagatgccaacaatatgtgggccctctcacagttaacgaaaaaaggagattaagattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaatctacacgcag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagcccgcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MH891502_FT00000_P-C Feature FT:source MH891502_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hiroshima GtC CL5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccatcaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtctgccccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcacacctcccgcttacagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcggat
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctcctcctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB014394_FT00000_P-C Feature FT:source AB014394_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 35Y17HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaagggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggacttccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgctggggctactccctcaacttcatgg
gatatgtaattggaagctggggtactttaccgcaggaacatattgtattaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctwgcrgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtytacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgataccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctactctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggcagacccagcatccagggacttagtagtcaa
ctatgtcaatgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatacttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggcaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaytggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB014399_FT00000_P-C Feature FT:source AB014399_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 40Y22HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtaaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacckctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtgattggaagttggggtactttaccgcaagaccatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactgatcgggacagacaactctgttgttctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtaccccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttggacaagggcattaaaccatattatcctgaacatacagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB074756_FT00000_P-C Feature FT:source AB074756_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th55). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcgaaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcacagccggtctggagctaaacttatcggcaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtatttacagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctttgtatcgggaggccttagaatcttcggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttactttcggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
ggaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttacccctagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacactatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB111124_FT00000_P-C Feature FT:source AB111124_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatattgtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgctcggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgattcatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttcctaatattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttctccgcaccatacagcactcaggcaagctattctg
tgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacctcaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|AB198079_FT00000_P-C Feature FT:source AB198079_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccacaagatcatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
catctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcartggaa
>gnl|hbvnuc|AB198082_FT00000_P-C Feature FT:source AB198082_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttcttgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaaatcaagcaatgctttcgaaaactgcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttcgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatcggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggccgcttgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttggggctctatcgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctatctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgcctgcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB300363_FT00000_P-C Feature FT:source AB300363_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcctgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctaacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaacgaggcattatttacatactctgtggaaggctgggattttatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaaaaaggatcaatggccagcagcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagaaagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB367396_FT00000_P-C Feature FT:source AB367396_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctaccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctccgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggacccagcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtcggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB642097_FT00000_P-C Feature FT:source AB642097_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2003-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtatttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtktggctttcagttatatggatgatgtggtattggggrcaargtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgctggggctactcccttaacttcatgg
gatatgtaattggaagctggggtactttaccacaggaacatattgtattaaaaatcaagcaatgttttcggaaactacct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggccttttaggctttgctgccccgtttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaarcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggmacctttgtggctcctctgccgatccatactgcggaact
cttagcagcttgttttgctcgcagccggtctggagcaaaactgatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagtaccttgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtcgagttactctcttttttgcctwckgacttctttccttctattcgagatctcctcgataccg
ccgctgctctgtatcgggaggccttagagtctccggaacattgytcagctcaccatacagcactcaggcaagccattctr
tgttggggagagttgatgaatctggccacctgggtgggaagtaatttggamgacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttatgtttgggagagata
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgttagtatcccttggactcataaggtgggaaac
tttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
agaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaacttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcctaactaggcattatttacatactctgtggaaggctggyattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcanggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctcwaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670241_FT00000_P-C Feature FT:source AB670241_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcytgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgyagggctttcccccac
tgtttggctttcagttatatggatgatrtggtattgggggcmaagtctgtacaacatcttgagtccctttwtacctctat
taccaattttcttttgtctttgggtatacatttgaaycctaataaaaccaaacgktggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacrsaaamtcaagcaatgttttcgraaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcckttatatgcatgtatacamtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgcggaacctttgtggcttctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagagaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaacttagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattatcgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggacttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcatttgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccacacagtggaa
>gnl|hbvnuc|AB670297_FT00000_P-C Feature FT:source AB670297_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.24). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgccttacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtgtggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctattcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtacaaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggtactgacaactccgttgtcctctctcggaaat
atacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgataccg
cctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattstg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaactagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccckgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcggtc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctccgggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB900109_FT00000_P-C Feature FT:source AB900109_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ytccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgttggatgtgtctgcggcgttctatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttayaccgctat
taccaattttcttttgtctctgggtatacatttgaaccctaataaaaccaaacgttggggttattcccttaactttatgg
ggtatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcccgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaacctcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcatctatcgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aagatttttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttcttcgcagttactctcttttttgcctgctgacttttttccttctgttcgcgacctactcgacaccg
cctctgctctgtatggggaggccttagagtctccygaacattgttcacctcaccacacagcaatcaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgaccaaggatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaattcagacaactactgtggtttcacatttcctgtmttacctttggaagagaca
ctgtccttgagtatttggtgtcatttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccatcctttcctcacattcatttgca
ggaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgccagattctatcctaaccttaccaaatatttgcccttagacaagggcattaaaccttattatccggaacatgcaatt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattytgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccacacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaccaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcaaggcatactgacaacagtgccagcagca
cctcctcctgccaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB971714_FT00000_P-C Feature FT:source AB971714_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB11-1026). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacggggccatgcaggacctgcacgactcttgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
tacccattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttattggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcca
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcatctgtggagttactctcttttttgccttctgacttctttccgtccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcccgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacggttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttactaaatatttgccattagacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatatacttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatcctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AF363961_FT00000_P-C Feature FT:source AF363961_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccaaagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggcttccgcaagattccta
tgggagttggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcgcaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcgtgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccatatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctacggtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgccctcggacaaaggcattaaaccctattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcacatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtggca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY167099_FT00000_P-C Feature FT:source AY167099_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate IVb). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctaaactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaaatgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactctcttaacttcatgg
gatatataattggcagttggggcaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcagcggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcgtgttttgctcgcagcaggtctggagcaaacctcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atggtctttgtactgggaggctgtacgcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcaactgtggagttactctcttttttgccctctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctc
tgctggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacctttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattgtcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcatcaagccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcnacaaggc
atggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU306673_FT00000_P-C Feature FT:source EU306673_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcaccaagctttgctagatcccagagtgcggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtccgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaaacaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcgggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgtcgtcctctctcggaaat
acacatcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcgcctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ccgctagattctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttgggccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU306691_FT00000_P-C Feature FT:source EU306691_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaatctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagacttgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaatttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagcaggtctggagcaacactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtcccggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggacattatcaccagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggcgggtattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcagccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaagctcagggcatagtgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU439015_FT00000_P-C Feature FT:source EU439015_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacataacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaattaagcaatgttttcgcaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacagtatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccacctggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctgccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttatgtactaggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttctccccaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtacttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcccaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaagcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU554542_FT00000_P-C Feature FT:source EU554542_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S696-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccaaagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccacggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttttctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactgaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaaagcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatacaagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagatcaggtta
atgatttttgtactagggggctgtaggcataaattggtctgttcgccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacctaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttgatcctgagtggcaaactccctcttttcctcacattcattcaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgtagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU670263_FT00000_P-C Feature FT:source EU670263_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ph105). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgagaggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaaccttctcgaggactggggaccctgcactgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccatgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtactaaaaatcaagcaatgttttagaaaacttcct
gtaaatagacctattgattggaaagtgtgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatccggccttaatgcctttgtatgcatgtatacaagctaagcaggcttttactttctcgccaatttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
gctagcagcctgttttgctcgcagccggtctggagcaaagcttatcggcacggataactctgttgtcctctctcggaaat
acacctcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttcacatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctatacgagatctcctcgacaccg
cctcagctctatatagggaggccttagaatctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagatccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacctttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatccggaatggcaaactccctccttccctgatattcatttgca
ggaggatattatcaatagatgtcaacagtatgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggtattaaaccctattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcatactatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacctggcattccgagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcatggcaggtaggagtgggggcattcgggc
cagggttcaccccgccacacggaggtcttttggggtggagccctcaagctcagggcattttgacatccgtgccagcagcg
cctcctcctgcctccaccaatcggcagtcgggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU872004_FT00000_P-C Feature FT:source EU872004_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-97-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaaactctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctcacccatatcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaacagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctaatattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacatcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccaggatccagggaattagtagtcgg
ctatgccaatgttaatatgggcctaaaaatcagacaactcctgtggtttcacctttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactccacctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttccctttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattctttgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatgttgacaacagtgccagtagca
cctcctcctgcttccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|FJ032333_FT00000_P-C Feature FT:source FJ032333_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S359-7). Complete genome. [Hepadnaviridae] (length=3200 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatttccctgctggtggctccagttccggaa
cagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctctgggtatacatttgacccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagaccgattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggccttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcacggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtcttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcctttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtctttcggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttactgttgatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacacgcagtt
aatcattacttcaaaaccaggcattatttacatactctatggaaggctggcattctatataagagggaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatcaaacctcgacaaggcatggggacgaatctt
tctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaacccagattg
ggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagctggagcattcgggccagggttcaccccac
cacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagcacctcctcctgcctcc
accaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ562230_FT00000_P-C Feature FT:source FJ562230_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I38). Complete genome. [Hepadnaviridae] (length=3200 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaagttcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggatactcccttaacttcatgg
gatatgtaattggcagttggggtacattaccgcaggaacatattatactgaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaagcttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcatacagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgt
cctactgttcaagcctccaagctgtgccttggatggctttagggcatggacattgacccgtataaagaatttggagcttc
tgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcagctatgtcaatgttaa
tatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaactttactgggctttat
tcttccacggtacctgtctttaatcctgagtggcagactccctcttttcctcacattcatttacaggaggacattattaa
tagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgctaggttctatc
ctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagttaatcattacttccaa
actaggcattatttacatactctgtggaaagcgggcattctatataagagagaaactacacgcagcgcctcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggcatggggacgaatctt
tctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgtttggagccaactcaaacaatccagattg
ggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccac
cacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ787439_FT00000_P-C Feature FT:source FJ787439_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S157-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctctacaacattccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttctcctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctgataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggcttcgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggagcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcgagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattacgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggccttttggggtggagccctcaggctcaaggcacattgacaacagtgccagtaaca
cctccacctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|FJ787449_FT00000_P-C Feature FT:source FJ787449_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S567-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctctattctcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtcttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagcggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttctttggtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaaatcaagcaatgttttcggaaattacct
gtcaatagacctattgattggaaagtatgtcaaagaattgtgggacttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgcggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccgtctcggggccgtctgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccctctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccagcaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccgatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ787466_FT00000_P-C Feature FT:source FJ787466_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1371-11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccatagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgccttacccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcagggttcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggagcctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggattgggcctcagtccgtttctcatggctcagtttactagtgccacttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcctgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaaacaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtattcaaactaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacttcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccatctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattaatagtcag
ctatgtcaatattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ899775_FT00000_P-C Feature FT:source FJ899775_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C120-6). Complete genome. [Hepadnaviridae] (length=3200 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcatcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattatacaaaaactcaagcgatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcaccaacttacaaagcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaacttatcggtaccgacaactctgtggtcctctctcggaaat
acacctcgtttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcctaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatcagccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatcctccgggattctttcccgatcaccagttggacccggcgttcggagccaactcaaacaatccagattg
ggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccac
cacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatacagtggaa
>gnl|hbvnuc|GQ377546_FT00000_P-C Feature FT:source GQ377546_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J77). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttctgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcacccctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggacgacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377605_FT00000_P-C Feature FT:source GQ377605_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J169). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtstctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcyattggccatcrccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatccggaatggcaaactccctcttttcctcatattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggcatcaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatccgca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377608_FT00000_P-C Feature FT:source GQ377608_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J174). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagaccccaaagtgagaggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaagcttctcgaggactggggaccttgcaccgaacatggag
aacacaacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaaaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatttggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttctgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtcactgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttggaggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctactattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaacttctgtggtttcacatttcctgccttacttttggaagacaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcgcattcatttaca
ggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacgttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttccaagctaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctccttttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaacccaaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|GQ475314_FT00000_P-C Feature FT:source GQ475314_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR10CHB). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaamtcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagaaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475316_FT00000_P-C Feature FT:source GQ475316_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR12CHB). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtggggctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaaatcaagcaatgtttccgtaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacagtgtgg
ctaccctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaaacctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctcattcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcaaggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ924614_FT00000_P-C Feature FT:source GQ924614_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M31). Complete genome. [Hepadnaviridae] (length=3206 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaagttgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattatcttt
gtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgt
tcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttgg
agcttctgtggagttactctcttttttgccttctgacttttttccgtctattcgggatctcctcgacaccgcctctgctc
tgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctgtgttggggt
gagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaagctatgtcaa
tgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaactgttctag
agtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatcttatcaacactt
ccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatc
gccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaactttactggg
ctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaaagaggatat
tattaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgcctgctaggt
tctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttactatcctgaacatacggttaatcattac
ttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcagtgcctcatt
ttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacg
aacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattcaaacaatcc
agattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggagcattcgggccagggttca
ctccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcgcctcctcct
gcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgca
gtggaa
>gnl|hbvnuc|HM750134_FT00000_P-C Feature FT:source HM750134_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate QHX-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtgcaaaaaattcagcaatgttttcgaaaactgcct
gtcaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacagtgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaccctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcaataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
tctagcagcttgttttgctcgcagccggtctggagcaaaactgatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttcaactgtacctgtctttaatcctgattggcaaactccctcctttccgcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcacatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700504_FT00000_P-C Feature FT:source HQ700504_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_Ve_1992). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagrgtgaggggcctttattatcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcmtggmkcagtttactagcgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgatggggatattcccttaatttcatgg
gatatgtaattggaagttggggtaccttaccacaagaacatattgtacgcaaaattaaacaatgtttcagaaaacttcct
gtaaataggcctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtattcaagctaagcaagctttcactttttcgtccacttacaaggtttttc
tgtgtcaacaatatcttaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagatcaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
cctcagctttgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagttgtcag
ttatgttaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttaaa
agaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggggcattcgggc
caggattcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaacagtgcccgcagcg
cctcctcctgcctccaccaatcggcagtcaggacgacagcctactcccatctctccacctctaagagatactcatcctca
ggccatgcartggaa
>gnl|hbvnuc|JN827418_FT00000_P-C Feature FT:source JN827418_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 0904). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaacacattccaccaagctctgctagatcccagagtgagaggcctatactatcctgctggtggctcaagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcaagggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaagattccta
tgggattgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaccaatgttttcggaaacttcct
ataaatagacctattgattggaaggtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctcagctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcgctaaggcaagctattctg
tgctggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggacattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttttatcctaactttaccaaatatttgcccttagataaaggtattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgtag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccccacggcaatcttttgggatggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ027318_FT00000_P-C Feature FT:source JQ027318_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcgtggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactacaaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatcyctttataccgctat
taccaattttcttttgtctttgggtatacatttaaaccctactaaaactaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtaccttaccacaggagcatattgtacacaaaattaagcaatgttttcggaaacttcct
atcaatagacctattgattggaaagtctgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaaaacaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagcggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgyggagttactctcttttttgccttctgacttttttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgytctcctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacatttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaaccctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattattaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactagacattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacgaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggctccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatagtgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ040131_FT00000_P-C Feature FT:source JQ040131_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 125). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgcctcctgacttctttccttccattcgtgatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccmagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcacccctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgaag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|JQ801470_FT00000_P-C Feature FT:source JQ801470_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate AIDS1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggaccccttctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaactgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcgggtctttgccaagtatttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggtctctaccgtccccttctgcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggacttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ801518_FT00000_P-C Feature FT:source JQ801518_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL26). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctattcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacgggcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcacagacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattcggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctgttcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaattcagacaactattgtggtttcacgtttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatcttg
tcaacacgtccggaaactaatgttgttatacgacgaggcaggtcgcatagaagaagaactccctcgcatagcaaacgaag
gtctcaatcgtcgcgtagcagaagatgtcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttttactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaacctcaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagccttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX429915_FT00000_P-C Feature FT:source JX429915_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-SD-19). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccacggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggcatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcaattggccatcgccgcatacgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccctgcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcttaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgagcatacagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX560519_FT00000_P-C Feature FT:source JX560519_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHH76). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccgaaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggacttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacacaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
actagcagcttgttttgctcgcagccggtctggggcaagacttatcggaaccgacaactctgttgtcctctctcggaaat
acgcctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccac
agggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgtcttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgataccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaacatgggcctgaaagttagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtctttcggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggcccccttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcggtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX661496_FT00000_P-C Feature FT:source JX661496_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SH1208-C4). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaagggacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacattaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacaaatctttct
gttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcacctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774179_FT00000_P-C Feature FT:source KC774179_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SX11xa1580). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccccgactttccaccaagctccgctaaatcccagagtgaggggcctgtactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttaaatcctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaatttcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttatatgcatgtatacagtctaagcaggctttcactttctcgccaacatacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaccctcatcggaaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcttttttgccttctgacttctttccttcagtacgagatcttctcgacaccg
cctcagctctgtatcgggatgccttagagtctccggaacattgttctcctcaccatacagcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ctgttatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttacagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatttgca
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcactatttacatactttgtggaaggctggcatcttatataagagagaaactacatgcag
cgcctcattttgtgggtcaccatattcttggggacaagagctacagcatgggaggttggtctccaacacctcgacaaggc
aaggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccgtgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacatggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774207_FT00000_P-C Feature FT:source KC774207_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2084). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaaactctgctagatcccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggattggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccactgt
taccacttttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtactgaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttttactttctccccaacatacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagcaggtctggagcgaaacttatcggtacggacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccaagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatttgca
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggacttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774235_FT00000_P-C Feature FT:source KC774235_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1041). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcatcaagctctgctagatcccagagtgagaggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
tcttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaacgttggggctactctcttaactttatgg
gctatgtaatcgggagttggggtacattgccacaggaacacattgtactaaaaatcaagcaatgttttcggaaactacct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtctactgggctttgctgccccttttacacaatgtgg
ttatcccgccttaatgcctttgtatgcatgtatacaagccaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcgctaggccataagcgcatgcgtggaacctttgcggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtctggggctctaccgtccccttctttgtctgccgttccggccgacaac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcctttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaagacattatcaatagatgccaacaatatgtgggccctctcacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccctagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggcagacaacctactcccattactccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774278_FT00000_P-C Feature FT:source KC774278_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww2155). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctactagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcgcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatctaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactcaagcaatgttttagaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatccggccttgatgcctttgtatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttcacatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggtagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcacaccacctcacggcggtgttttggggtggagccctcaggctcagggcatattggcaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774306_FT00000_P-C Feature FT:source KC774306_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa2006). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacttttcaccaagctctgctagatcccagagtgaggggcctttaccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattctctagggggcgcacccgcgtgtcctggccaaaattcgcggtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaagctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctattcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaggaacatattgtacttaaaatcaaacactgttttcgaaaacttcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttttactttctcgccaacatacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaacttatcggtacggacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggtcgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctattcgagatcttctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggacgacccagcatccagggaattggtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggatattatcaatagatgtcagcaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagagaaaggtattaaaccttattatcctgaacatatagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttcgtattccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcacccctccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcg
cctcctcctgcctccaccaatcggcagtccggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774310_FT00000_P-C Feature FT:source KC774310_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa2022). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctgactctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgcgatctcctcgacaccg
cctcagctctgtatcgggaggccttggagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttaccgaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcatccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774338_FT00000_P-C Feature FT:source KC774338_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxn1027). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtgctaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgcctatttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggcaataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
tctagcagcttgttttgctcgcagccggtctggagcaaaactgatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtattaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcatcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatcctgcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttcaactgtacctgtctttaatcctgattggcaaactccctcctttccgcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173293_FT00000_P-C Feature FT:source KJ173293_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CX063C(e307)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattgaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcccgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgtattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173321_FT00000_P-C Feature FT:source KJ173321_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NH30C(e43)). Complete genome. [Hepadnaviridae] (length=3194 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagtacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattactgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactacct
gtcaataggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgcaccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatccaaacaggctttcactttctcgccaacttataaggcctttc
tatgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgacacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcttgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttagggactgggaggagttgggggaggtactaggaggc
tgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcctact
gttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttggagcttctgtgga
gttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtatcgggagg
ccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctgtgttggggtgagttgatgaat
ctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcagctatgtcaatgttaatatggg
cctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatttggtgt
cttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatcttatcaacacttccggaaactact
gttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcag
aagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttattcttct
actgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttacaggaggacattattaatagatg
tcaacaatatgtgggccctctaacagttaatgaaaaaaggagattaaaattaattatgcctgctaggttctatcctaacc
ttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagttaatcattacttcaaaaccagg
cattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcagcgcctcattttgtgggtcacc
atattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacaaatctttctgtt
cccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattcaaacaatccagattgggactt
caaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccacacg
gcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcacctcctcctgcctccaccaat
cggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ173435_FT00000_P-C Feature FT:source KJ173435_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate N06-M(166A)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctggaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatcatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagacttgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagacctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatcgatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgatcaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtggca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ410496_FT00000_P-C Feature FT:source KJ410496_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1095). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcactttccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcagcgacttgtggggcttctaggctttgccgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagccattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaagcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttgca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagaaacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598647_FT00000_P-C Feature FT:source KJ598647_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB2S3). Complete genome. [Hepadnaviridae] (length=3197 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctaccctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcttttc
tttgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctcccggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtctgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcttgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacgaatctttct
gttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagccctcaggctcagggcatattaacaaccgtgccagcagcacctcctcctgcctccacc
aatcggcagtcaggaagacagcccactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ598707_FT00000_P-C Feature FT:source KJ598707_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB56). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgcttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttctgttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggaactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtcaatagacctattgattggaaagtatgtcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgtttcgctcgcagccggtctggagcgaaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgactcgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
agaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccctggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggttttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagttaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598752_FT00000_P-C Feature FT:source KJ598752_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB720). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacttgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgacacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaca
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcacctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggcccgaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtattttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148562_FT00000_P-C Feature FT:source KP148562_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y26-3-55). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacacattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaggtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgtttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013813_FT00000_P-C Feature FT:source KR013813_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaatcttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggagtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaacctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcgacg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcacccctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcataaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgaag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atgggggcaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattaacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013844_FT00000_P-C Feature FT:source KR013844_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttgcaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgccatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggccccagtccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcccttcttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaacttaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaagcttttactttctcgccaacttacaaggcctttc
tgtgtaaacagtatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cttagcagcttgttttgctcgcagccggtctggagcaaaactgatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtttcggggccgtttgggcctctaccgtccccttcttcgtctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagacctccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactgttgtggtttcacatttcctgtcttacttttggaagggaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
agaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacattaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactagacattatttacatacgctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacttcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaacccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcactcgggc
cagggttcaccccaccacacggcggtcttttggggcggagccctcaagctcagggcatattgacaacagtgcctgcagca
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013854_FT00000_P-C Feature FT:source KR013854_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatacttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgtggacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgactccctttttaccgctat
taccaattttcttctgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctaacagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacctcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaggcccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tctactgggctttattcttctactgtccctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttgaa
agaagatatcatcaatagatgtcaacaatttgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaagacatcaaaccttattatccggaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtatattatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagcaaaccaggtaggagtgggatcattcgggc
cggggttcaccccaccacacggcaatcttttggggtggagccctcaggctcagggcatactgacaacagtaccagcagcg
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatatctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013943_FT00000_P-C Feature FT:source KR013943_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3188 residues).
ttccacaacattccatcaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcgaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgctggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtactgaaactcaagcaatgttttcgtaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcccggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccagaggactcttggactctcagcaatgtcaacgaccgaccttgaggcatact
tcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtactaggaggctgtagg
cataaattggtctgttcaccagcaccatgcaacttttgcacctctgcctaatcatctcttgttcatgtcctactgttcaa
gcctccaagctgtgccttgggtggctttggggcatggaccttgacacgtataaagaatttggagcttctgtggagttact
ctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgccactgctctgcatcgggaggccttag
agtctcctgaacattgttcacctcatcatacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggcc
acctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaa
aatcagacaactattgtggtttcacatctcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttg
gagtgtggattcgcactcctcccgcttacagacctccaaatgcccctatcttatcaacacttccggaaactactgttgtt
agacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatc
tcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttattcttctactgta
cctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttacaggaggacattattaatagatgtcaaca
atatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgccaggttctatcctaaccttacca
aatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagttaatcattacttcaaaactaggcattat
ttacatactctgtggaaggctggcattctatataagagagaaactacacgcagcgcctcattttgtgggtcaccatattc
ttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctttctgttcccaat
cctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattgggacttcaaccc
caacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccaggtttcaccccaccacacggcggtc
ttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagcacctcctcctgcctccaccaatcggcag
tcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KT284755_FT00000_P-C Feature FT:source KT284755_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 19168). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctctccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcttccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963892_FT00000_P-C Feature FT:source KU963892_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 7_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaataggcctattgattggaaggtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggggcgaaacttatcggcaccgacaactctgttgtactctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
atgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963907_FT00000_P-C Feature FT:source KU963907_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcatcaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcatcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaacgttggggctactctcttaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgacttgtgggtcttctgggctttgctgccccttttacgcaatgtgg
ttatcccgcattaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctaaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggcactaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtgttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgcgtggcaaactccctcctttcctcacattcatttgca
ggaagacattatcaatagatgccaacaatatgtgggccctctcacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcgtaccaaatattggcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggtgttctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtctgccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccattactccacctctcagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964055_FT00000_P-C Feature FT:source KU964055_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactcaaactcaagcaatgttttcgcaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctagtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttattatccggaacatgtagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccacacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatactgacaacagtgccagcagcg
cctcctcctgccaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964057_FT00000_P-C Feature FT:source KU964057_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18_9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactcaaactcaagcaatgttttcgcaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctagtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttattatccggaacatgtagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccacacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatactgacaacagtgccagcagcg
cctcctcctgccaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964170_FT00000_P-C Feature FT:source KU964170_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 26_2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtaaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctactaaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactgaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagacctccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattattgatagatgtcaacagtatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacaagcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964184_FT00000_P-C Feature FT:source KU964184_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 26_16). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatattgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctactaaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacggaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagacctccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattattgatagatgtcaacagtatgtaggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacaagcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggag
>gnl|hbvnuc|KU964190_FT00000_P-C Feature FT:source KU964190_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 27_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttctgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactcaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctgtatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatgtgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcatcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcaa
ctatgtcaatgttaatatgggcctaaaactcagacgactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaaccccctcatttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagattaaaattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccatattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcc
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964215_FT00000_P-C Feature FT:source KU964215_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 29_2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaacaaccagtacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggtagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgccaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcgtgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
ccgctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatttggccacctgggtgggaagtaatctggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctaacattcatttaaa
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggctcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964216_FT00000_P-C Feature FT:source KU964216_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 29_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatccaagagtgaggggcctatatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcgtgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctaacattcatttaca
ggaagacattattgagagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964222_FT00000_P-C Feature FT:source KU964222_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 29_9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatccaagagtgaggggcctatatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcgtgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|KU964230_FT00000_P-C Feature FT:source KU964230_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 30_2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactcccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgattccct
cttgttgctgtacaaaaccttcggacagaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcacggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcactaggccatcagcgcctgcgtggaacctttgtggctcctctgccgattcatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgattggggctctaccgtccccttctgtgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgtgatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtaag
ctatgtcaatgttaatatgggcataaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattatcgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964330_FT00000_P-C Feature FT:source KU964330_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 37_13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgagaggcctatacagtcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcaccgagcatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttataggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcgattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactcctgtggtttcacatttcctgtcttacttttggaagagata
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaagattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccatattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatcccgattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccaatagca
cctcctcctgtctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276836_FT00000_P-C Feature FT:source KX276836_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
cytcacaamattccacmaagctctgctaratcccaragtgaggggcctatactttcctgctggtggctccagttccggga
cagtaaaccctgttccgactactgyctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggcgsttggggtactttaccacaggaacatattgtactgaaaatcaagcaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgtcaacatacaaggcctttc
tgtgtaaccaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtrctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
mtgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctcnccatctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctggtcttgcccaaggtcttatataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgaccattataa
agaatttggagcttccgtggagttactctcttttttgcctkctgacttctttccttcgattcgagatctcctcgacaccg
ccactgctctgtatcgggaggcattagagtctccggaacatatttcacctcaccatacagccctcaggcaagcttttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctccyccttaccgaccacagaatgcccctatctta
tcaacacttccggaaactgctgttgttagacaacgragcaggtccmttagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctyratgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtaccygtctttaatcctgagtggcaarctccctcctttcctcacattcatttgma
ggaggacattatcaatagatgtcagcaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctaycctaaccttaccaaatatttgccctyagaaaaaggcattaaacctyattatccggagcatacagtt
gatcattacttcaaaactatgcattatttacatactctgtggaaggctggcattctatataagagagaaactrcacgcag
cgcctcattttrtgggtcaccatactcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcwatggccagrggcamatcaggtaggagtgggagcattcgggc
cagggttcaccccaccrcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgccgccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgmagtggaa
>gnl|hbvnuc|KX276839_FT00000_P-C Feature FT:source KX276839_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgttagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagtacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtctgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagkccctttwtacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgctggggctactcccttaacttcatgg
gatatgtaattggaagttggggtgctttaccgcaggaacatattgtactaaaacttaagcaatgttttcgaaaattgcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgcattgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcraaacttatcgggaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcatctgtggagttactctcttttttgcctgctgacttctttcctcctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcacttaggcaagctgttctr
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaattcagacaactattatggtttcacgtttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctatmgcttacagaccaccaaatgcccctatctta
tccacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccgtattatccggaacatgcagtt
actcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcttccaccaatcggcagtcaggaagacagcctactcccatctctccacctttaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276840_FT00000_P-C Feature FT:source KX276840_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaarctytgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaycacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtrtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgccwcatcttcttrttggttcttctggactaccaaggtatgttgcccgtgtgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggagcctctatgtttccct
cttgttgctgtacaaaaccttcggacgcaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcctgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccctgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacatgtttcatctcaccatacagcattaaggcaagctattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggatgacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattatggtttcacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctctcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaaycycaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcwcattcayttgaa
agaggatatyatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggkattttatataagagagaaactactcgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgrtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcaaggcatattgacarcagtaccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagamagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276841_FT00000_P-C Feature FT:source KX276841_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgcgtttcaggcggggtttttctygttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caatctgcaatcactcaccaacctcttgtcctcaaatttgtcctgggtatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttctkgttggttcttctggactaccraggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctacgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagcaggcctcagtccgtttctcctggctcaatttactagtgccayttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgaatccctttttaccgctat
tactaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gttatgtaattggaagttggggtaccttgccacaggaccatattgtacaaaaaatcaaacaatgttttcggaaacttcct
gtaaatagacctattgattggaaagtatgtcaaaggattgtgggccttttaggttttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggacatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtattyaaagactgggaggaactgggggaggagactaggtta
atgatctttgtactrggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatagggaggccttagagtctccggaacattgtacacctcaccatacagcactaagacaacagattctg
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccggcatccagggacgcagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaag
ttgttcttgagtatttggtgtcgtttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgctagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatccggaatggcaaactccctcttttcctcacattcatttgaa
agaggaycttatcaatagatgtcaacaataygtgggccctcttaccgttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaagcttaccaaatatttgcccttagagaaaggcatcaaaccttattatcctgaacatgtagtt
aatcattacttccaaactaggcattatttacatgttctgtggaaggctggtattttatataagagagaaactactcrcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276851_FT00000_P-C Feature FT:source KX276851_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaycaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccmtttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgcgg
ttacccagcattgatgcctttgtatgcatgtatacaaaataagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgacaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtattcaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctactattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattattactagatgtcaacaatatgtaggccctcttacagttaacgaaagaaggagattaaaattgattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX765833_FT00000_P-C Feature FT:source KX765833_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PID:0657). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggacgagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX765846_FT00000_P-C Feature FT:source KX765846_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PID:1395). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcaccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaacttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggccaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX765848_FT00000_P-C Feature FT:source KX765848_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PID:1422). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacactgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctcagctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttccccacattcatttgaa
agaggacattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccccacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctcctccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470883_FT00000_P-C Feature FT:source KY470883_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23-6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgttctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttaggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcaaaaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatccctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470886_FT00000_P-C Feature FT:source KY470886_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23-G07). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcagtcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaatttcctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatctgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttaggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactagggggctgtaggcataaattggtctgttcgccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcgatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcagatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcgggaagacagcctactcccatctctccacccctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470894_FT00000_P-C Feature FT:source KY470894_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 24-B3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttccagctggtggctccagttccggaa
cagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgtcttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaacttaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaacataagcaggctttcactttctcgccaacttacaaggcctttc
tttgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctaccgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctccttgacaccg
cctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctt
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatggaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagtctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470967_FT00000_P-C Feature FT:source KY470967_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WR-103). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccaa
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtacttaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaagctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgcccccttcttcagctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccctccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggtta
atgatttttgtactaggaggctgcaggcataaattgggctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttagtatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470970_FT00000_P-C Feature FT:source KY470970_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WR-107). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccaa
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccacaagaacatactgtacttaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaagctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactacggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcagctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccctccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggtta
atgatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatacgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatatacgagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagacaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881736_FT00000_P-C Feature FT:source KY881736_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate control-01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccattcttctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881749_FT00000_P-C Feature FT:source KY881749_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate control-02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccattcttctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881754_FT00000_P-C Feature FT:source KY881754_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate control-02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccattcttctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881763_FT00000_P-C Feature FT:source KY881763_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate control-03). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccattcttctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881919_FT00000_P-C Feature FT:source KY881919_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-07). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaaacaatgttttcgaaaactgcct
ataaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagttgca
cctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|KY881982_FT00000_P-C Feature FT:source KY881982_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaaacaatgttttcgaaaactgcct
ataaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctctggggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagttgca
cctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|KY881984_FT00000_P-C Feature FT:source KY881984_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgttggtggctccagttccggaa
caggaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttctaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaagttaattatgc
ctgccaggttctatcctaaccttaccaaatatttgccattagacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF488703_FT00000_P-C Feature FT:source MF488703_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate OHBV-PCP155). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
tacccattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggcagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
atacccagcattaatgcctttatatgcatgtatacaagcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctccgcctaatc
atcttttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcgactgtggagttactctcatttttgccttctgatttctttccgtctgtccgagatcttctaggaaccg
ccgctcctctgtatcgggaagccctaaagtctccggaactttgtagacctcttcgtacaggactaaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagaccaagcatccagggacttagtagtaag
ctatgtcaatgttaacatgggcctaaaactcagacaattattgtggtttcacgtttcctgtcttacttttggaagagaca
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaacgaggcaggccccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
ttcactgggctttattcttctactgtacctgtctttaattctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgccaacaatttgtgggtcctcttacagtgaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaacaaaaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtgttttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatggggacgaacctttctgttcccaatccgctg
ggattctttcccgggcaccagttggatccagcgttcggagccaattcaaacaatccagattgggacttcaaccccaacaa
ggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggccagggttcactcccccacacggcaatcttttgg
ggtggagccctcaggctcagggcatattgacaacagtgccagcagcgcctcctcctgcctccgccaatcggcagtcagga
agacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcaatggaa
>gnl|hbvnuc|MF674388_FT00000_P-C Feature FT:source MF674388_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV040015). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaagaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaggtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacccaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgaatggaaaactccctcttttcctcacattcacttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaagaagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaacgaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcaccccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674417_FT00000_P-C Feature FT:source MF674417_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV040065). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaacacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaagaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacccaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcctgagtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaat
tttactggactttattcttctactgtacctgtctttaatcctgaatggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttagataaaggcattaaaccttattatcctgaacatgtagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcaccccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaagcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG725248_FT00000_P-C Feature FT:source MG725248_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NHB17003). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcacaaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatataattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttataggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatccagcggacgacccctctcggggccgtttgggactctaccgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaattactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG826135_FT00000_P-C Feature FT:source MG826135_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate YNCX12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgacttctgcctctcctatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaagcgatggggctactcccttaactttatgg
gctatgtaattggaagttggggtactttaccgcaaaatcatattgtagaaaaactcaagcaatgttttagaaaacttcct
gttaatagacctattgattggaaggtctgtcaacgcattgtgggtcttttaggatttgctgccccttttacacaatgtgg
gtatccagccttaatgcctttgtatgcatgtatccactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgcaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaggtgtttgctgacgcaaccccc
actggatggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcggcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcgtttttgccttctgatttctttccatctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagttgtcag
ttatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtccctgtctttaatcctgagtggcaaactccctcctttcctgacatacatttgcg
ggaggacattatcaacagatgtcaacaatatgtaggccctcttacagttaatgagaaaagaagattatccttaatcatgc
cggctaggttttatcctaatattaccaaatatttgcccttagataaaggcattaaaccttattatcctaaccatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgaacaccagttggatcctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagtgggagcgttcgggc
cagggttcaccccaccacacggaagtcttttggggtggagccctcaggctcagggcatattgacaccagtgcaagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB014362_FT00000_P-C Feature FT:source AB014362_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 03D03HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggccccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
tacccattttcttttatctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggttctttmccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaaagcctttatatgcatgtatacaacctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctatcggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaacctccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttaccgttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
tgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcacattgacaaccgtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB014376_FT00000_P-C Feature FT:source AB014376_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 17T02HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaagggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaamtcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcatctaccgtccccttcttcatctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtc
tgttggggtgagttgatgaatctggccacatgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtctttcaaacctcgacgaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB111114_FT00000_P-C Feature FT:source AB111114_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagaggctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctcaaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacacattgtacaaaaactaaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcctgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcgcaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggcaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgagcatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacacag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttagacccagcgttcggagccaactc
aaacaatccagattgggacttcaatcccaacaaggatcactggccggaagcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggccttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctcctccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB222714_FT00000_P-C Feature FT:source AB222714_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate UZNVC7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgctggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattcaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtatcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttgtcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcctaagctcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB367422_FT00000_P-C Feature FT:source AB367422_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 31/Adefovir-treated Pt. 12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaaaatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctagtaaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaaattaagcaatgttttcggaagctgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttactcaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggccttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgagtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaataggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcatcgacactg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccatcacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB367424_FT00000_P-C Feature FT:source AB367424_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 33). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctcacccatatcgtcaaccttctcgaggattggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactgaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagcgaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacgatcaggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaccttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccaggtcttgcccaaggtcttacataagaggactcttggactctccgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattaatagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggacccagcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670249_FT00000_P-C Feature FT:source AB670249_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaayttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgaytcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtgtctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcntctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggaatgggaggagttgggggaggagattaggtta
aagatttatgtaataggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcttaaaactcagacaactactgtggtttcacgtttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaggcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670267_FT00000_P-C Feature FT:source AB670267_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.31). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcargacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcaggcaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacacag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcggtc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctccgggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670301_FT00000_P-C Feature FT:source AB670301_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.28). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgcttgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcgtgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctcttccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaa
tgtcaacgacctaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtaataggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctacggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacagcactcaggcaagctattctc
tgctggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670306_FT00000_P-C Feature FT:source AB670306_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.33). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgcaggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacccaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtccggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaargactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattcta
tgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactrttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttaatatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatccggagtggcaaactccctcttttcctaatattcatttaca
ggaggacattcttgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttytatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|AB675675_FT00000_P-C Feature FT:source AB675675_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A34). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacaactttccaccaagctctgctagatcccagagtaaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaccctctatgtttccct
cttgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccacttttcttttgtctttgggtatacatttaaatcccaataaaacaaagcgttggggctattcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaagtctgtcaaagaattgtgggtctgttgggctttgctgccccatttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggtactgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctactcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcaccgcaccatacagcactcaggcaagctattctg
tgttggggcgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattggtagtcag
ctatgtcaatgttaatatgggcctaaaaataagacaactattgtggtttcacatttcctgtcttactttcggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagattaaaattaataatgc
ctgctaggttttaccctaactttaccaaatacttgccattagataaaggcattaaaccttattatcctgaacatgtagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattttatataagagagaaactacacgcag
cgcctcattttgcggttcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagcgggagcattcgggc
cggggttcaccccaccacacggcagtcttttggggtggggccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB931171_FT00000_P-C Feature FT:source AB931171_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2S_HB11-0922). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcctcaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaagggacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttattcccttcactttatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcccgccttaaagcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaaccgacaactcggttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtccccttctacatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcaacga
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagacctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatacta
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaagcagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttcctgaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcctcacattcatttgaa
ggaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaacaaggagattaaaattaattatgc
ctgccagattctatcctaaacttaccaaatatttgcccttagacaaaggcattaaaccttattatccggaacatgtagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
ctggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaccaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcggtc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcaaactgacatcaatgccagcagca
cctcctcctgccaccaccaatcggcagtcaggaagacggcctactcccatcactccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY206381_FT00000_P-C Feature FT:source AY206381_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagataccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataagaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggaagctggggtactttaccgcaagaacatattgtactaaaaatcatgcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtctgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttatatgcatgtatacagtctaagcaggctttcactttcccgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcaattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccatcaaatgcccctatctta
tcaacacttccggagacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcacagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaaa
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatttctccacctctaagagaaagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ089768_FT00000_P-C Feature FT:source DQ089768_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1814). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgatagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaaccttttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttytatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
atcaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgccgccccctttacacaatgtgg
gtacccagcattaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggcaataggccatcagcgcgtgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcramacttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccgacaagtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aagatctttgtactgggaggctgtaggcataaattggtctgttcaccagaaccctgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttcttcggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cttctgctctgtatcgggaggccttagaatctccggaacattgtacacctcaccatacagcaataaggcaagctattcta
tgttggggwgagttgatgaatctggccacctgggtgggaagtaatttggaagayccaggatccagggaattagtagtagg
ctaygtcaatgtcaatatgggcctaaaattcagacaactattgtggtttcacatttcctgccttacttttggaagacaaa
ctgttctggagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagattgaaattgattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactagaag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaaccctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaacccaaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgtcaacagtaccagcagcg
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccacacagtggaa
>gnl|hbvnuc|EF536065_FT00000_P-C Feature FT:source EF536065_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaaccttttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggacttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcctgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatcaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacgcgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgttaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttccccacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaagctaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU522071_FT00000_P-C Feature FT:source EU522071_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient 7T). Complete genome. [Hepadnaviridae] (length=3194 residues).
ctccacaacattccaacaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccaattccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacattacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttgccacaggaacatattgtactcaaaattaagcaatgttttcggaaacttcct
gtaaatagacctattgattggaaagtatgtcaacggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgccgttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
atacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcatctatcgtccccttctgtctctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccggccttgaggcgtacttcaaagactgtgtgtttaaggactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctccttgacaccg
cctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccccgcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaaactcagacaactattgtggtttcacctttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattctactactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagtaaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaacttaccaaatatttgcccttagacaaaggcattaaaccttattatccggaacatacagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcattcgcaaaggcatggggacgaatctttcggtt
cccaatcctctgggattctttcccgatcaccagttggacccagcgttcggagccaactcaaacaatccagattgggactt
caaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggccagggttcaccccaccacacg
gcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcgcctcctcctgcctccaccaat
cggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctcaggccacgcagtggaa
>gnl|hbvnuc|EU562217_FT00000_P-C Feature FT:source EU562217_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 16). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacagggacatattgtgcaaaaactcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgcatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcaaccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcccggagccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatactgcactccggcaagctattctt
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
gggagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagactaaaattaattatgc
ctgctaggttctatcctaacctcaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atgggaacgaatctctctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggaccattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU881996_FT00000_P-C Feature FT:source EU881996_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient17). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccaaagtgaggggcctatatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacggggacatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttatgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaagctcaagcaatgttttcgtaaattgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggcgcatctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggtctttattcttctactgtacctgtctttaatcccgagtggcaaattccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaactaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggcccgtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatccctggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcttccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU916223_FT00000_P-C Feature FT:source EU916223_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S6.1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccatcaagctctgctagatcccaaagtgaggggcctatattttcctgctggtggatccagttcaggaa
cagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggactgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcggaaactgcct
gtaaatagaccgattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatacgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtctttcggagtgtggattcgcactcctctcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaaaatgcagct
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcaggagcattcgggc
taggattcacccccccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939567_FT00000_P-C Feature FT:source EU939567_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C91). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggcgaagtctgtacaccatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtactaaaactcaaggaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcaacgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccgctgctctgtatcgggaggccttagagtctccggaacactgttcacctcaccatacagcactcaggcaagctaatctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaattactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccccaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctatcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggtggtcttttggggtggagccctcaggctcagggcatgctgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939605_FT00000_P-C Feature FT:source EU939605_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C200). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggccttcc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcataaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaatacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccacaggctcagggcctattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagggacagtcatcctca
ggccagtcagtggaa
>gnl|hbvnuc|EU939652_FT00000_P-C Feature FT:source EU939652_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D107). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgctggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtactgaaactcaagcaatgttttcgtaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggggcaaaacttatcggcaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcctcttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtttggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactccttccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ023641_FT00000_P-C Feature FT:source FJ023641_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1237). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctaytcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactmaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
cagttctagagtatttggtgtcttttggagtgtggattcgcactccccccgcntacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctgacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccataccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ032338_FT00000_P-C Feature FT:source FJ032338_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S462-7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccaaagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgacccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggccttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcgtgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcgtgcgtggaacctttgtggctcctctgccaatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggaatctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagctgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagtcgatgaatctggccacctgggcgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttagaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcatgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggcccccttacagtgaatgagaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaagggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaagactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggcccgtcttccaaacctcgacgaggc
atggggacaaatcttgctgttcccaatcctctgggattctttcccgatcaccagttggaccttgcgttccgagccaactc
aaacaatccagattgggacttcaaccccaacaaggatccttggccagaggcaaatcaggtaggagcgggagcattcgggc
caggtttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagggacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386577_FT00000_P-C Feature FT:source FJ386577_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1747). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacaacattccaccaaactctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctacacccttaacttcatgg
gatatagaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaaagcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcatgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacatcagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386601_FT00000_P-C Feature FT:source FJ386601_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1912). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccgcaacgttccaccaagctctgctagatccccgagtgaggggcttatattttcctgctggtggctccttctccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattactgctcaaggaacctctatgtttccct
cttgttgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggatactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccgcaggaacatattgtacaaaaaatcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggtctttc
tgtataaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggatggggcttggccctaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctrgcagcttgtttcgctcgcagcaggtctggagcgaaacttatcggaaccgacaactcggtcgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggacccttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcagactccctcttttcctaaaattcatttaca
ggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaagcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgtttggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcatgtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttgggggggagccctcatgctcagggcatattgacaacaatgccaatatca
cctcctcctgcatctaccaatcggcaggcaagaagacggactactcccatctctccacctctaatagacagtcatcctca
ggccatccaatggaa
>gnl|hbvnuc|FJ386607_FT00000_P-C Feature FT:source FJ386607_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1967). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcactcaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggattgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctcataaaaccaagcgttggggctactcccttaacttcctgg
gatatgtaattggaagttggggcactttaccgcaggaacatattgtacaaaaaatcaagcaatgttttcggaaattgcct
gtaaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggggcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagacctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcacaccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386620_FT00000_P-C Feature FT:source FJ386620_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2121). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacgttccaccaagctctgctagatccaaaagtgaggggcctctattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagtacgggaccctgcaagacctgcacggttcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcccggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggaattactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcctttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacgaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtattttggggtggagccctcaggcccagggcacattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386662_FT00000_P-C Feature FT:source FJ386662_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S269). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacttaaactcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgcccacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggcctctgccaagtatttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcacctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactctcggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcwtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacctgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctgctattcgagacctcctcgacaccg
cctctgctctgtatcgggaggccctagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgataaatctggccacctgggtgggaagtaatgtggaagatccagcatccagggaattaatagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaatcctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386665_FT00000_P-C Feature FT:source FJ386665_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S359). Complete genome. [Hepadnaviridae] (length=3200 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatttccctgctggtggctccagttccggaa
cagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctctgggtatacatttgacccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagaccgattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcacggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcacatttcctgtcttacttttgggagagaaa
ctgttcttgaatatttggtgtctttcggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttactgttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacacgcagtt
aatcattacttcaaaaccaggcattatttacatactctatggaaggctggcattctatataagagggaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcataaaacctcgacaaggcatggggacgaatctt
tctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaacccagattg
ggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagctggagcattcgggccagggttcaccccac
cacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagcacctcctcctgcctcc
accaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ386671_FT00000_P-C Feature FT:source FJ386671_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S586). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caatctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gctatgtaattggaagttggggtactttaccgcaggaacatattgtattaaaactcaagcaatgttttcgaaaactgcct
gtaaatagaccgattgattggaaagtatgtcaacgaattgtgggtctcttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatwggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtgctaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcgg
ctatgtcaatgttaatatgggcctgaaactcagacaactactgtggtttcatatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattatcaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562333_FT00000_P-C Feature FT:source FJ562333_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I78). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagccctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttcgagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggatactcccttaacttcatgg
gatatgtaattggcagttggggaacattaccgcaggaacatattgtactaaaaatcaagcattgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcttgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccctcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaagtcttgcccaaggtcttatataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcagactccctcttttcctaacattcatttaaa
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttactaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacacgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgtttggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ787452_FT00000_P-C Feature FT:source FJ787452_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S955-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttatctttgggcatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcctgg
gatatgtaattggcagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtttgtcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgcattaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggctattggccattgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatattgacgtgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggtctattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|FJ787454_FT00000_P-C Feature FT:source FJ787454_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1049-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttccctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
cgacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggtttgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcctgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatttgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaaccttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcatatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcgttggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ899789_FT00000_P-C Feature FT:source FJ899789_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C226-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacaggaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggattgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtattaaaactcaagcaatgttttcgaaaactgcct
gtaaatagaccgattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcttgttttgctcgcagccggtctggagcaaacctcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgatccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattaatagtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcatatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtctttcggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaaccccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacggttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttcgtattccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggatcctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377533_FT00000_P-C Feature FT:source GQ377533_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J39). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgctgtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttagaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttgtatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccgtctcggggccgtttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattagagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggacgagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgtcaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtgttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377624_FT00000_P-C Feature FT:source GQ377624_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J221). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctcttctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcatcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgcccctttcacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgattcatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcacccctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475351_FT00000_P-C Feature FT:source GQ475351_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR47HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccaaagtgaaaggcctatattttcctgctggtggctccagttccggaa
cagtacaccctgttccgactactgccttacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggatcatattatacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctctgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctttctcgcaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctctggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtctcacttttggaagagcta
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaatattcatttaca
ggaggacattattaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaagattaattatgc
ctgctaggttctatcctaacctcaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700490_FT00000_P-C Feature FT:source HQ700490_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_NZL_WH23_1993). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacagcattccaccaagctctgctagatcccagagtaaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaaccttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataagacaaaaagatggggctattcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaagaacatattatactcaaaatcaaacactgttttcggaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtattcaagctaagcaggctttcactttttcgtcgacttacaaagtttttc
trtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcyattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggggcgaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccccttcttcgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagcttagatta
aagttgtttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgaccattataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagacctcctcgacaccg
cctcagctctgtacagggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagtggtcgg
ttatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgaatggcaaactccctctttccctgacattcatttaaa
agaagacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttagataaaggcattaaaccctattatcctgaacacgcggtt
aatcattactttaaaactaggcattatttacatactctgtggaaagcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggctcaccccaccacacggaggtcttttggggtggagccctcaagctcagggcatattgacaacagtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|HQ700558_FT00000_P-C Feature FT:source HQ700558_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BD5375_2001). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtaaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataagaccaagagatggggctattcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaagaacatattagactaaaaatcaaaaactgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtattcaagctaaacaagctttcactttttcgtcaacttacaaagtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggggcgaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtccccttctccgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagacctcctcgacaccg
cctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagtggtcag
ttatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttgaa
agaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgccgttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaatctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700566_FT00000_P-C Feature FT:source HQ700566_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_JN1142_2004). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtaagggscctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaagtatgttgcccgtttgtcctct
acttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataagaccaagagatggggctattcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaagaacatattagactaaaaatcaaaaactgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtattcaagctaaacaagctttcactttttcgtcaacttacaaagtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggggcgaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccccttctccgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagacctcctcgacaccg
cctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagtggtcag
ttatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttgaa
agaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgccgttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaatctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggatttcaaccccaacaaggatcaatggccagaagcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ801495_FT00000_P-C Feature FT:source JQ801495_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctactagatcccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaacccttctaaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaagaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgacaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctatggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctcgccacctgggtgggaagtaatttggaagacccaggatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccttcttttcctcatattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttacaaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctatctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggcctggaagtggaa
>gnl|hbvnuc|JQ801513_FT00000_P-C Feature FT:source JQ801513_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL21). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaagcgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
atcaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtccccttctacgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggtctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattggttatgc
ctgctaggttctatcctaaccttaccaaatatttgcccctagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccccacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX429903_FT00000_P-C Feature FT:source JX429903_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-HZ-42). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggactatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgccttacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgccctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttacccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccgtttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtgttgaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaacacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgcttgagactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatacgctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacgggggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX507214_FT00000_P-C Feature FT:source JX507214_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 99). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgttagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaactaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
ataaatagacccattgattggaaagtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtgg
ttacccagcactaatgcctttgtacgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgatgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagattg
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacaacactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagacaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggcccgcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccgtaccaagtatttgcccttaaataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatcaagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatatctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX661497_FT00000_P-C Feature FT:source JX661497_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SH1228-C14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccataacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaatacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctctgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacacattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ctatcctgccttaaagcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggctattggccatcgccgcatgcgtggaacctttgtggctccgctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaacagacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggcctctgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgaccattataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
ccacagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagcttttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctgtattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagctaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcgatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgtctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggctgcgcagtggaa
>gnl|hbvnuc|KC774211_FT00000_P-C Feature FT:source KC774211_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2114). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtaaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgccttacccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaccctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggatactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccgcaggaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacgcagtgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacgatcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
tctagcagcttgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacttcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgccaaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatatttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctc
tgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacctttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcacacctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
ttctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacccgtctttaatcctgagtggcagactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgtttggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagca
cctcctcctgccttcaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774216_FT00000_P-C Feature FT:source KC774216_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2126). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctagtaaaaccaaacgttggggctattcccttaacttcatgg
ggtatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaaatcaaggaatgttttcggaaactgcct
gtaaatagacctattgattggaaaatatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagagcaagcgtggaacctttggggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactcggttgtcctctctcggaaat
acacctcttttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacctttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattgaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgtcaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcaggcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774217_FT00000_P-C Feature FT:source KC774217_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2129). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcctgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatcatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacagcatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaactaaacgttggggctactcccttaactttatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacacaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctgttgattggaaaatatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgctttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgtttgggtctctaccgtccccttcttcatctgccgttccagccgacaac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggtcttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcgtgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacatgcac
gctctcattttgtgggtcaccgtatttttgggaaccaggactacagcatgggaggttggtcttccaaacctcgtcaacgc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774240_FT00000_P-C Feature FT:source KC774240_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1066). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgctggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagagcatattgtgcataaactcaagcaatgttttcgtaaactgcct
gtaaatagacctatcgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttaaagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattaatattctc
ttatgtcaatgttaatatgggcctaaaaatcaaacaactattggggtttcacatctcctgtcttacttttggaaaaaaaa
ctgttcttgagtatttggggtcttttggagtggggattcccactcctcccgcttacaaacctccaaatgcccctatttta
tcaacacttccggaaactactgttgttaaacgacaaggcaggtcccctgaaaaaaaaactccctcgcctcaaaaacaaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggggggaaac
tttactgggctttattcttctactgagcctgcctttaatcctgagtggcaaactccctcctttcctcatattcatttaca
ggagcacatttttaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatccaaccctcaactattatttgccctgggacaaaggtaaccgatcttattatcctgaacatgcagtt
aattcttacttcaaaactagtcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattttcgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774250_FT00000_P-C Feature FT:source KC774250_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1029). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggatactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccgcaggaacatattatactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaagcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcgacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttactttcggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcagactccctcttttcctcatattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaatcttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagagggaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgtttggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774259_FT00000_P-C Feature FT:source KC774259_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1061). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcgaaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaattctgaatggcaaactccctcatttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctaccctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774334_FT00000_P-C Feature FT:source KC774334_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxn1007). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctcccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagggcatgcgtggaacctttgtggctcctctggcgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaaatctgttgtcctctctcggaaat
acacctcctttccatggatgctagggtgtgttgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctgtctttacgcggtctccccgtctgtgccttctcatccgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactattggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccacacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtcgtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcacctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcatttacg
ggaggacattattgatagatgtcagcaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctagattctatcctaacctcaccaaatatttgcccttggataaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774342_FT00000_P-C Feature FT:source KC774342_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxn1044). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttagaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttgtatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaaacctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtgcctgtctttaatcctgagtggcaaactccttcctttcctcacattcatttaca
ggaggacatcattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacattaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtgttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774358_FT00000_P-C Feature FT:source KC774358_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cyc1098). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaaactctgctagaccccagagtgaggggcctataccttcctgctggtggctccggttcaggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcaccaaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagagcatattgtactaaaacttaagcaatgtttccgtaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggccttcc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
actagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacgactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatagtgacaacaatgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC875267_FT00000_P-C Feature FT:source KC875267_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV33). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcatgattactgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactactgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggagaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattactttcaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacaggcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873526_FT00000_P-C Feature FT:source KF873526_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 040_K_Laj). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcctcagcattccatcaagctctacaagatcccagagtaaggggtctgtattttcctgctggtggctccagttccggaa
cagtaagccctgttcagaatactgtctctcacatctcatcaatcttcacgaagactggggaccctgctacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgacatggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggcatacatctaaatcctcacaaaacaaaaagatggggttattcccttaacttcatgg
gatatgtaattggtagctggggaagcttaccacaagatcatattgtacaaaaaatcaaacactgttttagaaaaatacct
gttaataggcctattgactggaaagtgtgccaaagaattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttttcctgccttgatgcctttgtatgcatgtatacaagctaagcaggcttttagtttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcggggaacctttgtgtctcctctgccgatccatactgcggaact
cctagcagcctgtttcgctcgcagccggtctggagcgmaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgccgacgacccttctcggggccgcttgggactttaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
rcgtcgcatggagaccaccgtgaacacccacctgatcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
awgrtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttcagtggagttactctcttttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggcgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatctagagaattagtagtaag
ttatgtcaatgttaatatgggcctaaaaattcgacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcctttggagtgtggattcgcactcctmccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgatattcatttacg
ggaggacattatcaataggtgtcaacaatacgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctacccttaccaaatatttgcccttggacaaaggcattaagccttattatcctgaacatgcagtt
aatcattacttcaagactaggcattatttacatactctatggaaggctggtattctatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcttccaaacctcgcaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagcccgcaggcccagggcatattgacaacagtgccagcagcg
cctcctcctgcctccgccaatcggcagtcaggaagacagcccactcccatatcaccacctctaagagtcactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173305_FT00000_P-C Feature FT:source KJ173305_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NB023C(m24)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtctccct
cttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggcatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtgctaaaaatcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtactctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcatttgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcaacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaagggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccatcaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173335_FT00000_P-C Feature FT:source KJ173335_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate YY010C(e112)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcatcaagctctactagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccctttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactccctgaacttcatgg
gatatgtaattgggagttggggtaccttaccacaggaacatattgtacttaaaatcaggcaatgttttcgaaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttactgcctttgtacgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaccctttaccccgttgccaggcaacggccgggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggggcaaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccaatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcctttggggtgtggattcgcacaccccccgcatataggccgccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatatacatttgca
ggaggatattattactagatgtcaacaatttgtgggccctcttactgtaaatgagaaaaggagattaaagttaattatgc
ccgctagattttttcctaaccgtaccaaatatttgcccttagagaaaggtattaaaccttactatcctgaacatacagtt
aatcattacttcaaaacgaggcattatttgcataccctttggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcacaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggcccagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173394_FT00000_P-C Feature FT:source KJ173394_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Vac04-C(m612)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctctgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactgaaaatcaagcagtgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttcacgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgataccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccatcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaatattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagca
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598646_FT00000_P-C Feature FT:source KJ598646_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB2S1). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctaccctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcttttc
tttgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctcccggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtctgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtccgttcacaagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcttgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaacatgcagtt
actcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattg
ggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccac
cacacggcggtcttttggggtggagccctcaggctcagggcatattaacaaccgtgccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ598664_FT00000_P-C Feature FT:source KJ598664_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB312). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctgctagatcccagagtgaggggcctatacctccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcacggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcactaggccataagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctctaccgtccccttctttgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttatataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacctggcaacctgggtgggaagtaatttggacgacccagcatcccgagaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggttccacatttcctgtcttacttttggaagagcaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattattgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgtccttggataaaggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgttccaaatccgctgggattccttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|KJ598666_FT00000_P-C Feature FT:source KJ598666_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB3A1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctgctagatcccagagtgaggggcctatacctccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcacggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcactaggccataagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctctaccgtccccttctttgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttatataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacctggcaacctgggtgggaagtaatttggacgacccagcatcccgagaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggttccacatttcctgtcttacttttggaagagcaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattattgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgtccttggataaaggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttaaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|KJ598686_FT00000_P-C Feature FT:source KJ598686_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB411). Complete genome. [Hepadnaviridae] (length=3194 residues).
ttccacaacattccaccaagctctactagaccccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctagaacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgtgggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaagaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccactgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggaactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaagccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggtactaggaggc
tgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgtcctact
gttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataaagaatttggagcttctgcgga
gttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccgcctcagctctgtatcgggagg
ccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctgtgttggggtgagttgatgaat
ctggccacctgggtgggaagtaatttggaagatcaagcatccagggaattagtagtcggctatgtcaatgttaatatggg
cctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatttggtgt
cttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatcttatcaacacttccggaaactact
gttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcag
aagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaacttcactgggctttattcttct
actgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttacaagaggacattattaatagatg
tcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgctaggttctatcctaacc
ttaccaaatatttgcccctggacaaaggcattaaaccatattatcctgaacatgcagttaatcattacttcaaaactagg
cattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcagcgcctcattttgtgggtcacc
atattcttgggaacaagagctacagcatgggaggtcggtcttccaaacctcgacaaggcatggggacgaatctttctgtt
cccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattgggactt
caaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccacacg
gcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcaactcctcctgcctccaccaat
cggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ803779_FT00000_P-C Feature FT:source KJ803779_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY814443). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaactaaacgttggggctactctcttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacacaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtggggcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaggctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcacatggagaccaccgtgaacacccgacaggtcttgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccctcaccatgcaactttttcacctttgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttttttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttagaagacccagcatccagggaattagtagtaag
ctatgtcaacgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcatgtcttacttttggaagagaaa
ttgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccatcaaatgcccctatctta
tcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttgttatcccttggactcataatgtggtgaac
tttattggggtttattcttcttctgtagctgtcgttaatcctgatgggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctctcacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttataatcgcgaacatgtagtt
aatcattacttcaaaactaggcattatttacatactttggggaaggctggcattcggtataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaacagcaacagcatgggaggttggtcttccaaacctcgacaaggc
atggggaccaatctttctgttcccaatcctctgggattctttcccgatcaccaattggaccctgcattcggagccaactc
agaaaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtgggagtgggatccttcgggc
cagggttcactccacctcacggcaatcttttggggtggagccctcaagctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcaccctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148473_FT00000_P-C Feature FT:source KP148473_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y177-11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcaccctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggagcctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcttgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacccctctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgctttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctcgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP784761_FT00000_P-C Feature FT:source KP784761_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6130). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctctgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactgaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtaggtctgttgggctttgccgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaagaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013791_FT00000_P-C Feature FT:source KR013791_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccatcaagctctgctagatcccagagtgaagggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaatatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgctggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgctggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtattgaaactcaagcaatgttttcgtaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagtattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcccggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgcgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagacctccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
caagtttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013812_FT00000_P-C Feature FT:source KR013812_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtctctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcgaca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcacccctcctgcttacagaccaccaaatgccccaatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacccataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcataaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgaag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattaacaacagtgccagtagca
cctcctcctgcccccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013837_FT00000_P-C Feature FT:source KR013837_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcgcccatatcgtcaatctactcgaggactggggaccctgcaccgaatatggag
agcactacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgccctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacgtttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagctggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacccaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
cgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagctcgttttgctcgcagccggtctggggcgaaactcatcggcaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcac
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatatcctcgacaccg
cctctgctctatatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcgcacctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattggtcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatcattcgggc
cagggttcaccccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcagcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013848_FT00000_P-C Feature FT:source KR013848_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgccagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtgcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcccttcttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaacttaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaggtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaagcttttactttctcgccaacttacaaggcctttc
tgtgtaaacagtatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cttagcagcttgttttgctcgcagccggtctggagcaaaactgatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagacctccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggggattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaatctccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacattaccaaatatttgcctttggacaaaggcattaaaccgcattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatacgctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcaggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggcggagccctcaagctcagggcatattgacaacagtgcctgcagca
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013875_FT00000_P-C Feature FT:source KR013875_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggcggacttctctcaattttccagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttattgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactgaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgtcgtcctctctcgcaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaacgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggagtctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgtagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcccctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013984_FT00000_P-C Feature FT:source KR013984_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggactctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcccggctatcgctggacgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaacgaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggttctttaccacaagaacatattgtactaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgactggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcgaagcaggctttcactttcccgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctaacgcaaccccc
actggatgggacttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gcctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatattggcccttggacaaagacattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcatcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacaaatctatct
gttcccaatcctctgggattctttcccgatcaccagttggaccctgccttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcgctggccagaggcaaatcaggtaggagcgggagcattcgggccagggctcaccccacctc
acggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcacctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU051427_FT00000_P-C Feature FT:source KU051427_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MMHBV002). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgatgcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactccctccacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcgcaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcatcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963899_FT00000_P-C Feature FT:source KU963899_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 7_14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaataggcctattgattggaaggtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaacttatcggcaccgacaactctgttgtactctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
atgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963918_FT00000_P-C Feature FT:source KU963918_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 9_4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctccaattccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaaacacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgctccgtttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagct
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaacttagacaactactttggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattgaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacacgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964039_FT00000_P-C Feature FT:source KU964039_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 17_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttctcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggttgttggggtactttaccgcaagaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcgtgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattcttaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggcgattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacacactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcgggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964070_FT00000_P-C Feature FT:source KU964070_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 19_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctgtactttcctgctggtggctccagtttcggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctcgactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattgactgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
agggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagctctcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatacgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964185_FT00000_P-C Feature FT:source KU964185_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 27_1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttctgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactcaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctgtatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcatcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcaa
ctatgtcaatgttaatatgggcctaaaactcagacgactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaaccccctcatttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagattaaaattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccatattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcc
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964192_FT00000_P-C Feature FT:source KU964192_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 27_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttctgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactcaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctgtatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatgtgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaaccccctcatttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagattaaaattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccatattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcc
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964210_FT00000_P-C Feature FT:source KU964210_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 28_11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctcacccatatcgtcagtcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagaggctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtcattggatgttggggtactttaccacaagaacatattgtactaaaaatcaagcaatgttttaggacattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttgtatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctcagccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctacgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttatttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
ccacagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaaaagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964226_FT00000_P-C Feature FT:source KU964226_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 29_13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaacaaccagtacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggtagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcgtgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcannnnnnnnnnnnnnnnnnaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964228_F