HBVdb

Dataset for nucleotide sequence Genomes of genotype C

[Download (right click)] [Alignment] [Repertoires]

3069 sequence(s)

>gnl|hbvnuc|AB367418_FT00000_P-C Feature FT:source AB367418_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 27/Adefovir-treated Pt. 21). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacatttcaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaacatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatttggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggcctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcgggactgacaactcggttgtcctctctcggaaat
acacctcattcccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacatccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctggagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaagattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670274_FT00000_P-C Feature FT:source AB670274_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtcagcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatatggtattgggggcaaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgktggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacwmaaaatcaagcaatgttttcgraaaytgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcckttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggrgcaaamcttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctccttgacaccg
catctgctctatatcgggaggccttagagtctccacaacattgttcacctcaccatacagcactccggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggacgaccaggcatccagggatttagtagtcgg
ctatgtcaatgttaatatgggcctgaaactcagacaactmttgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtrtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactrttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcmgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgttartatcccttggactcataaggtgggaaac
tttactggrctttattcttctactgtacctgtctttaatccggagtggcaaactccctcttttcctaatattcatttaca
ggaggacattcttgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaagctggcattctatataagagagaaactacacacag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU562216_FT00000_P-C Feature FT:source EU562216_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatccgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttgactttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacgcaatgtgg
ctatcctgccttgatgcctttatatgcatgcatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgccctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcccggggccgtttgggcctctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccttctattcaagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatactgccctccggcaagctattctt
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatacgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctacggtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaagagactaaaattaattatgc
ctgctaggttctatcctaacctcaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgcgggtcaccatattcttgggaacatgagctacagcatgggaggttggtcttccaaacctcgacaaggc
atgggaacgaatctctctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggaccattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatttctccacctctaagagacagtcctcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670273_FT00000_P-C Feature FT:source AB670273_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.37). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaggttctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaaytcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccacaagaccatattgtacaaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatacatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattstg
tgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaagacccagcatcccgggaattagttgtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaactttaccaaatatttgcccttggataaaggcattaaaccgtattatcctgacaatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattttatataagagagaaactacacggag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcatttggac
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatgttgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccacgaagtggaa
>gnl|hbvnuc|AY641558_FT00000_P-C Feature FT:source AY641558_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He74). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccccgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgctggggctactcccttaatttcatgg
gatatgtaattggaagctggggtactttaccacaggaacatattgtattaaaactcaagcaatgttttcggaaactgcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacatgcacctgtaccccgttgcccggcaacggcctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcaacacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgcaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgtgtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcaagatcgcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|D28880_FT00000_P-C Feature FT:source D28880_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Plasma 1992-085-9434). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagacttgtggtggacttctctcaattttctagggggagcacccaagtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctcgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacaccaactaccagcacaggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcatttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagaactgttttcgaaaactgcct
gtaaatagacctattgattggaaagtctgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatccaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgcgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcgtgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacaacccgtctcggggccgtttgggactctaccgtccccttcttcgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccagaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacgaggc
atggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgcactgacaaccgtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|D23684_FT00000_P-C Feature FT:source D23684_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C6-TKB588). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
accacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaccaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaacggacaactctgttgttctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttaggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatactttaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacgtttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttgcatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggtgcattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|EU939543_FT00000_P-C Feature FT:source EU939543_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C38). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccacagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacatgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctaaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggttttgctgccccttttacacagtgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctgggtggctcttctgccgatccatactgcggaaat
cctagcagcttgttttgctcgcagccggtatggagcgaaacttatcgccaccgacaattctgttgtcctctctcggaaat
acacctcctttccatggctggtaggctgtgctgccaaatggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
atgaatcccgcggacgaccggtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccacagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagragattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacacactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggatttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386638_FT00000_P-C Feature FT:source FJ386638_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2015). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtctttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgacctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaatctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccga
tgggagtgggcctcagtccgtttctcctgactcagtttactagtgccatttgttcagtgattcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttgtgtctttgggtatacatttgaaccctaacaaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtattaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacctataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcctcttcttcgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggwctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatyttctcgacaccg
cctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagttgtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcatctactgtacctatctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggcaaggc
atggggacgaatctttctgttcccaaccctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ975274_FT00000_P-C Feature FT:source DQ975274_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaccattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttcctagttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgcgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtaccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaacaaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctcttgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgcggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcccggggccgtttgggactctaccgtccccttcttcatttgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcgagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcccgaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtacttgagtatttggtgtcttttggagtgtggattcgcactcttcttgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatcccaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcccaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagct
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
gcccatgcagtggaa
>gnl|hbvnuc|FJ023642_FT00000_P-C Feature FT:source FJ023642_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1257). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctattcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgcccgactac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccaacaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcgtacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctaacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccataccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ787452_FT00000_P-C Feature FT:source FJ787452_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S955-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttatctttgggcatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcctgg
gatatgtaattggcagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtttgtcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgcattaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggctattggccattgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggatattgacgtgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggtctattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|EU939541_FT00000_P-C Feature FT:source EU939541_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C25). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgctggggatactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtattaaaactcaaacaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctcagccgatccatattgcggaact
cctagcagcttgttttggtagcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatccttcgcgggacgtcctttgtatacgtcccgtcggcg
ctgaatcgcgcggacggcccgtctcggggccgttgggggctctaccgtccccttcttcctcggccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctcc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttaaagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaaaacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcaaacaactattgtggtttcacatttcctgtcttacttttggaaaaaaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcacacctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacaaggcaggtcccctaaaaaaaaaactccctcgcctcgcaaacaaag
gtctcaatcgccgcgtcgcaaaaaatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcatttaaa
agaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctatcctaatcttaccaaatacttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacgaatctttct
gttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagcacctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ562252_FT00000_P-C Feature FT:source FJ562252_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I85). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttaggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatacgcatgtatacaatctaagcaggctttcactttctcgccgacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaagactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JN400088_FT00000_P-C Feature FT:source JN400088_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-77-Baby). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccccgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgctggggctactcccttaatttcatgg
gatatgtaattggaagctggggtactttaccacaggaacatattgtattaaaactcaagcaatgttttcggaaactgcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacatgcacctgtaccccgttgcccggcaacggcctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcaacacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgcaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgtgtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcaagatcgcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JF828931_FT00000_P-C Feature FT:source JF828931_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES71-15). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggtctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttcttagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattgaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttattgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggccgtttgggcctctaccgtccccttcttcctctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagccctcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcatatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatccgaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaagctaggcattatttacatactttgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtgaaa
>gnl|hbvnuc|JQ707769_FT00000_P-C Feature FT:source JQ707769_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S50_13A). Complete genome. [Hepadnaviridae] (length=3191 residues).
ctccagcacattccaccaagctctgatagatcctgctggtggctccagttccggaacagtaaaccctgttccgactactg
cctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcaggattcctagga
cccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggac
ttctctcaattttctagggggaacacccacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacct
cttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgc
ctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccag
cacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcgg
acggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttc
tcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatattgat
gatgtggtattgggggcgaaatctgtgcaccatcttgaatccctttttaccgctgttaccaattttcttttgtctttggg
tatacatttaaaccctactaaaactaaacgttggggctactcccttcacttcatgggatatgtcattggaagttggggta
ccttaccacaggatcatattgtacacaaaatcaaacaatgttttcggaaacttcctacaaatagacctattgattggaaa
gtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgta
tgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttctgtgtcaacaatatctgaaccttt
accccgttgctcggcaacggtctggtctttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggc
catcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcag
ccggtctggagcaacacttatcggcaccgacaactctgttgtcctctctcggaagtacacctcctttccatggctgctag
gctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccgtct
cggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggt
ctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtgaa
cgcccgacaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgaccttgaggcat
acttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggttaatgatctttgtactaggaggctgt
aggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgtt
caagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttggagcttctgtggagtt
actctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggcct
tggagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctgtgttggggtgagttgatgaatctg
gccacctgggtgggaagcaatttggaagacccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcct
gaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatcttatcaacacttccggagacttgtgtt
gttagacaacgaggcaggtccactagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaag
atctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttattcttctact
gtacctgtctttaatcctgactggcaaactccctcctttcctgacattcatttgaaagaggatattattaatagatgtca
acaatatgtaggccctcttacagttaacgaaaaaaggagattaaaattgattatgcctgctaggttctatcctaaccgta
ccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagttaatcattacttccaaactagacat
tatttacatactctgtggaaggctggtgttttatataagagagaaactacacgcagcgcctcattttgtgggtcaccata
ttcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctttctgttccc
aatccgctgggattctttcccgatcaccagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaa
ccccaacaaggatcaatggcccgcggcacaccaggtaggagtgggatccttcgggccagggttcactccaccacacggca
atcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctcctcctgcctccaccaatcgg
cagtcaaggagacagcccactcccatctctccacctctaagagacagtcatcctcaggccatacagtggaa
>gnl|hbvnuc|JX504535_FT00000_P-C Feature FT:source JX504535_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-HZ-31). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccagcactttccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaatttgcagtccc
caacctccaatcactcacaaacctcttgtcctccaatttgtcctggttatcgctggatgtgtcggcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctctgggtatacatttaaaccctactaaaactaaacgttggggctactcccttgacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgccgctccatttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccctcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcacaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtctcactgttcaagcctccaagctgtgccttgggtggctttgaggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccctacagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctg
tgttcgggtgagttaatgaatctggccacctgggtgggcagtaatttggaagacccagcatccagagaattagtagtagg
ctatgtcaatgttaatatgggcttaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagacaaa
ctgttactgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcttcaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattctcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaagcttaccaaatatttgcccttagataaaggcattaaaccttattatccggaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggtacattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ801505_FT00000_P-C Feature FT:source JQ801505_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttactcaatgtgg
ttacccagcattaatgcctctatatgcgtgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgtggtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctacgcggaacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagacctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttcttctgtacctgtctttaatcctgactggcaaactccctcttttcctcaaattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagggaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774313_FT00000_P-C Feature FT:source KC774313_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa2032). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaatcctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaagctcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctcgcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacatcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtcaatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagaaaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagacgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagactaaaattaattatgc
ctgctagattctatcctaaccttaacaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactcggcactatttacatactctgcggaaggctggcattctatataagagagaaactacacgcaa
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctactgtctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803799_FT00000_P-C Feature FT:source KJ803799_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY677465). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcactacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacacattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttcacggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaaccctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggtcctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttactatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964062_FT00000_P-C Feature FT:source KU964062_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18_14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactcaaactcaagcaatgttttcgcaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctagtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttattatccggaacatgtagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccacacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatactgacaacagtgccagcagcg
cctcctcctgccaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881942_FT00000_P-C Feature FT:source KY881942_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-07). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaatcaaacaatgttttcgaaaactgcct
ataaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggcaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttactcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagttgca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|LC318703_FT00000_P-C Feature FT:source LC318703_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate L_2nd_child_DUC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaatatcaggattcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgcccctttcacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgttctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcc
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatagggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccctgcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctacgagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013762_FT00000_P-C Feature FT:source KR013762_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatatc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtttgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccgtaggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggggcgaaactcattggaaccgacaactctgttgtcctctctcgaaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaattgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcttcaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccagcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439460_FT00000_P-C Feature FT:source MZ439460_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2013-Quasi-6). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggttgacttctctcagttttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttatcccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaagagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagcaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439589_FT00000_P-C Feature FT:source MZ439589_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2019-Quasi-10). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgtttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgactggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattgatcatgc
ctgctaggttttatcctaaacgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttggcgatcaccagttggacccggcattcagagccaattc
aaacaatccagattgggaccgcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcgtgttgacaacagtgccagcggcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148561_FT00000_P-C Feature FT:source KP148561_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y26-3-50). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagtacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacgggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagcctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacacattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaccaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
accggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcgggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963874_FT00000_P-C Feature FT:source KU963874_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6_4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtacaaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatgtggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacctcaccaaatatttgcccttggataaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaacac
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT645022_FT00000_P-C Feature FT:source MT645022_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB1). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgctccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaaccttttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtatctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcaattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgcaaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccgctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttgcaagacccaacatccagggaagcagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
cggttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattactagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgaccaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|GQ924620_FT00000_C-C Feature FT:source GQ924620_FT00000_C-C of [Viruses] Hepatitis B Virus genotype C (isolate M38). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcatcaagctctgctagatcccagagtaaggggcctatacttccctgctggtggctccagttccggaa
caacaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctaacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattsgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacaactcmtgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagcccgtttctcttggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttatctttgggtattcatttaaaccctaataaaaccaagcgttggggctactccctacacttcatgg
gatatgtaattggaagttggggtaccttaccgcaggaacatattgtatcaaaaatcaagcagtgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacagtgtgg
ttatcctgccttactgcctttgtatgcatgtatacaagctaagcaggckttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaccctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcggcgcatgcgtggaaccttcgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggggcgaaactcattggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccctctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccaacctggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctataccgggatgccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctactctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggttcttgagtatttggtgtccttcggggtgtggattcgcacaccccccgcatataggccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggcaac
tttactgggctttattcttcttctgtacctgtctttaatcctgagtggcaaactccctcttttcctgatatacatttgca
ggaggacattattaatagatgtcaacaatttgtgggccctcttactgtaaatgaaaaaaggagattaaagttaattatgc
ccgctagattttttcctaaccttactaaatatttgcccttagataaaggtattaaaccttattatcctgaacatatagtt
aatcattacttcaaaactaggcactatttgcataccctttggaaggctggcattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcaaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaccagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|KY881738_FT00000_P-C Feature FT:source KY881738_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate control-01). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccattcttctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881817_FT00000_P-C Feature FT:source KY881817_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcacagaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgccatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaacatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggtctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaacctcaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtgctgaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacatacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggcctttgccaagtgtttgctgacgcaaccccc
attggatggggattggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttataggaaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatccagcggacgacccgtcgcggggccgcttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagttctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttctattcgagatcgcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaactatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcactatttacatacgctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
acggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattggggcttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013842_FT00000_P-C Feature FT:source KR013842_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattaccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggttcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtcccttcttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaacttaagcaatgtcttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaagcttttactttctcgccaacttacaaggcctttc
tgtgtaaacagtatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cttagcagcttgttttgctcgcagccggtctggagcaaaactgatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagacctccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgttcaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctatttgagatctcctcgacaccg
cctctgctctgtatcgggaggcctcagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtattcggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaaccccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacattaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatacgctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggcaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggcggagccctcaagctcagggcatattgacaacagtgcctgcagca
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY363254_FT00000_P-C Feature FT:source KY363254_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate geno2.6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatctgcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaatagaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattatactaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcgggactgacaactcggttgtcctctctcggaaat
acacctcattcccatggctgctagggtgtgctgccaactggatcctgtgcggggcgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggtcaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgtccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
catctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagactaagattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctttggaaggctggcattttatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaacac
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcaaca
ccccctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctgagagacagtcatcctca
ggccacgcagtggaa
>gnl|hbvnuc|MZ439454_FT00000_P-C Feature FT:source MZ439454_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2007-Quasi-18). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttatcccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgaatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgctgaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcggtggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|FJ386591_FT00000_P-C Feature FT:source FJ386591_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1869). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaaggcctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcggtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggctgttggggtactttaccgcaagaacatattgtactgaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatccta
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcccaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagggaaactacccgaag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439457_FT00000_P-C Feature FT:source MZ439457_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2013-Quasi-3). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttatcccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcagagccaattc
caacaatccacattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|MZ439461_FT00000_P-C Feature FT:source MZ439461_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2013-Quasi-7). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaagccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagaactgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacagaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttatcccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcaggtattttatataagagagaaactactcgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtgcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|AB202071_FT00000_P-C Feature FT:source AB202071_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaaattaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggccttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaggccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aagatttatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattatg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttgttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccatcacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881962_FT00000_P-C Feature FT:source KY881962_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-09). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
caggaaaccctgttccgactactgcctcacccatgtcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaagaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacgcaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcgggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgacctcgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgctcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttccgacttctttccttctgttcgagatctcctcgacaccg
cctcagctctgtatcggtaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgtctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgccattagacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagcccgcaggctcagggcgtattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|MZ439598_FT00000_P-C Feature FT:source MZ439598_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2019-Quasi-19). Complete genome. [Riboviria] (length=3197 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagcttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtagacataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgtttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaagaagattaaaattgatcatgc
ctgctaggttttatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacgaatctttct
gttcccaatcctctgggattctttcccagtcaccagttggacccggcattcagagccaattcaaacaatccagattggga
cctcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggaccagggttcactccaccac
acggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB670240_FT00000_P-C Feature FT:source AB670240_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.4). Complete genome. [Hepadnaviridae] (length=3215 residues).
gtccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttctgttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacactctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgcggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaacacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtaytaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagmtattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcggat
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgaagtggaa
>gnl|hbvnuc|MF925359_FT00000_P-C Feature FT:source MF925359_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BD-HBV02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctctacttacctgctggtggctcaagttccggaa
ctgtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaagcgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacagtgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagcaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcagactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggccaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT645037_FT00000_P-C Feature FT:source MT645037_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB5). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacattccgccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgccttacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttctatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgctcctggttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggaactttaccgcaagaacatattgtcctaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtggggcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtgttgcccaaggtcttatataaacggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccatccgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctatatcgagaggccttagagtctccggaacattgcacacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttgcaagaccaagcatccagggaattagtagtcaa
ctatgtcaatgttaacatgggcctaaaattcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaaa
ggaggacattattaatagatgtcaacaatatgtgggccctctcacagttaatgaaaaaaggagattaaaattaattatgc
ctgcaaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagggaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtctgccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattcttccccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacactgacaacagtgccagtagca
cctcctcctgcctccgccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670241_FT00000_P-C Feature FT:source AB670241_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcytgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgyagggctttcccccac
tgtttggctttcagttatatggatgatrtggtattgggggcmaagtctgtacaacatcttgagtccctttwtacctctat
taccaattttcttttgtctttgggtatacatttgaaycctaataaaaccaaacgktggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacrsaaamtcaagcaatgttttcgraaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcckttatatgcatgtatacamtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgcggaacctttgtggcttctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagagaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaacttagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattatcgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggacttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcatttgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccacacagtggaa
>gnl|hbvnuc|FJ023654_FT00000_P-C Feature FT:source FJ023654_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1412). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctcttctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggga
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgatgcaaccccc
actggctggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggactggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggtagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattattaccagatgtcaacaatttgtgggccctcttacagttaacgaaaaaaggagactaaaattgattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ924615_FT00000_P-C Feature FT:source GQ924615_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M32). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggtagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggyctttc
tgtgtaaacaatatctaaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactccgttgtcctctcccggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgtctgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactcggtta
aagatttatgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcatatcaccatacagcactaaggcaagctgttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtagg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgcctttcctttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctaacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacggttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcataaaaccttattatcctgaacatacagtt
aatcattacttccaaacgaggcattatttacacactttgtggaaggctgggattttatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttccaaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagcaaaccaggtaggagtgggagcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475321_FT00000_P-C Feature FT:source GQ475321_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR17CHB). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccacggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactaaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctctctatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactcggttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctccttgacaccg
cctctgctctgtatagggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctccttccctaacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacacag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcatttgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276837_FT00000_P-C Feature FT:source KX276837_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ytccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcataatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagtacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcscgtttgtcctct
acttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtdcaacatcttgagkccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctmataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttrccgcaggaacatattgtactaaaamtcaagcaatgttttcgaaaattgcct
gtmaatagacctattgattggaaagtatgtcaamgaattgtgggtcttttgggctttgctgccccttttacrcaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgcgtaatcaatatctgaacctttaccccgttgcccggcaacggtcwggtctatgccaagtgtttgctgacgcaaccccc
actggmtggggcttggccatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttmtcggwaccgacaactctgtkgtcctctctcggaaat
acacctcctttccatggctgctaggrtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggycttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagdytaggtta
aagatttwtgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtyctactkttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcatctgcggagttavtctcttttttgccttctgacttctttccttctrttcgagatctcatcgacaccg
cctcwgctttrtatcgggaggccttagagtctccggaacatwkytcasctcaccatacagcaatcaggcaagcycttctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggatgacccarsatccagggawkyagtagtcar
cyatgtcaatgttaatatgggcmtaaaaatcagacarctattgtggtttcacatttcctgtcttacttttggaagavmwa
ctgttcttgagtwtttgrtatcytttggagtgtggattcgcactcctgycgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactrctgttgttagaccacgakgcaggycccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagawctcrgtctcgggawtctcaatgttagtatcccttggackcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccytcctttcctcacattcatttama
ggaggacattattaatagatgtcaacaatatgtgggccctcttacggttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttytatcctaaccttactaaatatttgcccttagacaaaggcattaaaccgtattatcctgaacatgcartt
aatcattacttcaaaactaggcattatttacatacwctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttckgttcccaatcctctgggattctttcccgatcaccagttggaccckgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggtggtcttttggggtggagccctcaggctcagggcayattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagccyactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439676_FT00000_P-C Feature FT:source MZ439676_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2007-Quasi-10). Complete genome. [Riboviria] (length=3200 residues).
ctccaacacattccaccaagctctgccagatcccagagttcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcaccaaggtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataaagaatttggagcttc
tgtggagttaatctcttttttgccttctgacttctttcctaatattcgtgatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttggacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttat
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagaggagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggacggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaattccaacaatccagattg
ggatctcaaccccaacaaggatcaatggacagcggcaaatcaggtaggagtaggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU939584_FT00000_P-C Feature FT:source EU939584_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate B107). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcagcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttaggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccaacccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttcaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagtaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctactctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacgactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacattaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
caggattcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386664_FT00000_P-C Feature FT:source FJ386664_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S310). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaatttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctactcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaaacactgttttcgcaaacttcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttgtacgcatgtatacaatctaagcaggcttttactttctcgccaacatacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccaccagcgcatgcgtggtgcctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggtacggacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtctgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aagatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacggttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
caacaatccagattgggacttcaaccccaacaaggatcactggccagaagccaatcaggtaggagtgggagcattcgggc
cagggttcaccccgccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439488_FT00000_P-C Feature FT:source MZ439488_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2013-Quasi-34). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttatcccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattctcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtgcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|EU939657_FT00000_P-C Feature FT:source EU939657_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D139). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactctacttttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaggccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagtgggggtactttaccgcaagaacatattgtacaaaaaattaagcaatgttttagaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggcttcgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgaccactataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagctctcaggcaagctattatt
tgttggggtgagttgatgaatctggccacctgggtgggaggaaatttggacgacccagcatccagggaagcagtagtcaa
ctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagaacaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcaggcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaattccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctctcacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtcccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagctttcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700555_FT00000_P-C Feature FT:source HQ700555_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BD4171_2001). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtaaggggcctttactttcctgctggtgrctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcryggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataagaccaagagatggggctattcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaagaacatattagactaaaaatcaaaaactgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtattcaagctaaacaagctttcactttttcgtcaacttacaaagtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggggcgaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtccccttctccgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgrgccgtgtgcacttcgctwcacctctgc
acgtcgcatggaraccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagacctcctcgacaccg
cctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagtggtcag
ttatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttgaa
agaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaarggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgccgttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaatctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcrccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803770_FT00000_P-C Feature FT:source KJ803770_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY836190). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaggctctgctagatcccaaagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcggtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgcaaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatccatttaaacccttcgaaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaagaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
gtaaatagacctatttcttggaaagtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtcaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgatgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcgaggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcacatggcgaccaccgtgaacgccccacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaatgggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctatggagttactctcttttttgcctgctgacttctttccttccattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattgtg
tgttggggtgaggtgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattggtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaag
ttgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacccataaggtgggaaac
ttcactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcatattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccatacaaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcgaagaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670254_FT00000_P-C Feature FT:source AB670254_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.18). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctcgat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaytaggtta
atgatctttgtactcggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctrttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttacccttggataaaggcattaaaccttattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacwacagtgccatcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964030_FT00000_P-C Feature FT:source KU964030_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 16_11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacgttccaccaagctctgctagatcccagagtgaggagcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtgattgggagttggggtactttaccacaggaacacattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatcttaacctctaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccccttctgagtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagagaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactatacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagacaaaggcattaaaccttactatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccacacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatactgacaacagtgccagcagcg
cctcctcctgccaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964363_FT00000_P-C Feature FT:source KU964363_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 39_15). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccgccaagctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caatctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactctcttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaactccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctctgcattgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtccctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcc
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386618_FT00000_P-C Feature FT:source FJ386618_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2111). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaraatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtacaaaaactaaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgccagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgacactcataggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagagaactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattacgtta
atactctgtggactaagaggctgtaggaataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcacttaca
ggaggacattattaatagatgtcaacaatatgtgggccctctgacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagggaaactacacgaag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX026888_FT00000_P-C Feature FT:source JX026888_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-NJ-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcgctttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgccaggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttttggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagccctcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttgcaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatccgacaactattgtggtttcacatttcctgtcttacttttggaagagata
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcccaccgcttacagactaccaaatgcccctatctta
tcaactcttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccttcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggatattattgatagatgtcaacaatatgtgggacctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaaaatgtagtt
aatcattacttcaaaactaggcattatttacatactctgtggagggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaagatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggccttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagggacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148463_FT00000_P-C Feature FT:source KP148463_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y17-13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgagtcatacttcaaagactgtgtatttaaagactgggaggagttaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562295_FT00000_P-C Feature FT:source FJ562295_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I169). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcctttagcggggggcctatattttcctgcaggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattgggagttggggtactttaccgcaagaacatattgtattaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatgggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcctcttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatcccgggaattagttgtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcctctactgtacctatctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcccaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccgaacctcgataaggc
atggggaccaatctttctgttcccaaccctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcacgtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaactgtggcctcagca
cctcctcctgcctccacaaatcctaagtcaggaagacagcctactcccatctctccacctctaagagacagtcgtcctca
cgccatgcaccggaa
>gnl|hbvnuc|KJ598752_FT00000_P-C Feature FT:source KJ598752_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB720). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacttgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgacacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaca
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcacctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggcccgaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtattttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881989_FT00000_P-C Feature FT:source KY881989_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
caggaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgagaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctgttcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattcttcacctcaccatacagcactcaggcaaactattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaagatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacgatatgtgggccctcttacagttaatgagaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgccattagacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598739_FT00000_P-C Feature FT:source KJ598739_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB627). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgattccct
cttgttgctgtacaaaaccttcggacagaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcgttaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcacggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcactaggccataagcgcctgcgtggaacctttgtggctcctctgccgattcatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctctatcgtccccttctttgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggcattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctgctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtaag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctctcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtgcctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattatcgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG571345_FT00000_P-C Feature FT:source MG571345_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23023). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagaacattccaccaagctctgttagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcaccgaatatggag
agcgccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaaaatacc
acagaatctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttgtcctct
aattccagaaccatcaaataccagcaagggaccatgcaagacctgcacgatttctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttcggctttcgtaagattccta
tgggagttggcctcagtccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgctgctccctttacacaatgtgg
ttacccagcattgatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccggaccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctctgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcctttggagtgaggattctcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaacgaggcaagccccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctctgacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattaccctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtgttttatataagagagaaactactcgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439419_FT00000_P-C Feature FT:source MZ439419_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2004-Quasi-13). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttatcccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgaatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcaggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB198082_FT00000_P-C Feature FT:source AB198082_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
caataaaccctgttccgactactgcctctcccacatcgtcaatcttcttgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaaatcaagcaatgctttcgaaaactgcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttcgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggatggggcttggccatcggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggccgcttgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttggggctctatcgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctatctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgcctgcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173293_FT00000_P-C Feature FT:source KJ173293_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CX063C(e307)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattgaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcccgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgtattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439306_FT00000_P-C Feature FT:source MZ439306_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BL71-2019-Quasi-17). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctataccatcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttcttgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttctatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
actaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgccgttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccagggctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatagcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaagtcttgcccaaggtcttacataagagaactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgaagacttctttccttccgttcgtgatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccacacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaattagtagtacg
ctatgtcaacgttaatatgggcctaaagttcagacaactattgtggtttcacatttcctgtcttacttttggacaacaag
ttgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaccacgaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatttgtaggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatattctatggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccccacggcaaccttttggggtggagccctcaggctcagggcacattgacaacagcaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcccacgcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ315783_FT00000_P-C Feature FT:source DQ315783_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI03188). Complete genome. [Hepadnaviridae] (length=3212 residues).
ctccagcacattccaccaggctctactagatcccagagtgaagggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcaccgacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaacccgaataaaaccaaacgttggggctactcccttaacttcatgg
gatacgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaaggattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctttatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtggtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacctttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaatacatagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacatggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtg
>gnl|hbvnuc|DQ993692_FT00000_P-C Feature FT:source DQ993692_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 4007-0810-Nature2.1-unSero). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcatctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttctcctcaccatacagcactcaggcaagctattctg
tgttgggttgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaataagacaactattgtggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcccgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacggttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttactaaatatttgccattagacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939647_FT00000_P-C Feature FT:source EU939647_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D90). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctggatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgccttacccatatcgtcaatcttctcgaggattggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggggcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatccgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaacgactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ttatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctacggtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatcgatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttacccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcaggcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ899770_FT00000_P-C Feature FT:source FJ899770_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C76-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaaacacccaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgcaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcctgtatacaatctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgcccgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaaaactgtttgtttaaagactgagagaagttaggggaggagactaggtta
ataatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctggagagttactctcttttttgccttctgacttctttccttctattcgagaactcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcataaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatccggagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattacaattagttatgc
cggctaggttctatcctaaacttaccaaatatttgcccttagataaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgaag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattcttccccgatcaccagttggacccggcgttcggagccaactt
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcaggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|GQ475342_FT00000_P-C Feature FT:source GQ475342_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR38HCC). Complete genome. [Hepadnaviridae] (length=3194 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcaccggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgtcaacttataaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctgtgcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggacctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaaccacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcactcgacaaggcatggggacgaatctttctgtt
cccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattgggactt
caaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggccagggttcaccccaccacacg
gcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcgcctcctcctgcctccaccaat
cggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KY470905_FT00000_P-C Feature FT:source KY470905_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 24-D12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcatccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaacttaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaacataagcaggctttcactttctcgccaacttacaaggcctttc
tttgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggttttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctccttgacaccg
cctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctt
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB014371_FT00000_P-C Feature FT:source AB014371_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 12D12HCC). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgcttgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
amttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttgccacaagaacatattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgtcaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcgaaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatgggcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactct
cagcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagtct
aggttaatgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgc
ctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgaccc
gtataaagaatttggagcttctgtggagttactctcttttttgcctcatgacttctttccttccattcgagatctcctcg
acaccgcttcagctctgtatcgggaggccttggagtctccggaacattgttcacctcaccayacagcactcaggcaagcc
attctgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttagaagacccaacatccagggaagcagt
agtcggctatgtcaacgttaatatgggcttaaaactcaggcaactactgtggtttcacatttcctgtcttacttttggaa
gagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaggcttacagaccaccaaatgcccct
atcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggacgcataaggtg
ggaaactttactggcctttattcttctactgtacctgtcttcaatcctgagtggcaaactccctcctttcctcacattca
tttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattgaaattaa
ttatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacat
gcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactac
acgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcga
cacggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccagcgttcggagc
caactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcat
tcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgcca
gtagcacctcctcctgcatccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774220_FT00000_P-C Feature FT:source KC774220_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2152). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgccgttatatgcatgcattcaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcttctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatcagccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcctacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagttag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttactgggctttattcttctaccgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttacccaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276853_FT00000_P-C Feature FT:source KX276853_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaagatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggytcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatrtggtattgggggccaagtctgtacaacatctkgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttgcctcagcaacatattgtacaaaaaatcaaacaatgttttcggaaactgcct
rtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggttttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagcaaagcaggctttcactttctcgccracttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatrggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagcaggtctggagcaaaccttatcggcactgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccwgcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgygvakttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctktatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggargtaatttgracgaccaggcatccagggaactagtagtaar
ctatgtcaaygttaatatgggcctgaaaatcagacaactattgtggtttcatatttcctgtcttacttttggaagagmca
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccccttayagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttrttagaggacgwggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
rtctcaatcgccgcgtcgcagaagatctcmatctcgggrmtcycaatgttagtatcccttggactcataaggtgggaaac
ttcactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccrtaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatacagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtrttttatataagagagaatctactcgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacttaaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagttccagcagcg
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB697500_FT00000_P-C Feature FT:source AB697500_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate No17). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggcagttggggtactttaccacaggaacatattatacaaaaacttaagcaatgttttcggaaattgcct
gtaaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcacggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcgggactgacaattctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcacctgcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggggaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcagcaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttacctttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcatttgggc
cagggttcaccccacctcacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475348_FT00000_P-C Feature FT:source GQ475348_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR44HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaactaaagcactgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcgtgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatatatgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcggcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtcttcaatcctgagtggcaaactccctccttccctaacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacacag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcagtggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggtccaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774214_FT00000_P-C Feature FT:source KC774214_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2124). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgttagatcccagagtaaggggcctatattttcctgctggtggctccagttccgaaa
cagtaaaccgggttccgactactgccttacccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacaacaactaccagtacgggaccatgcaagacctgcacgattcctgctcacggaccctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaaagttggggatactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccgcaggaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
atatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggccttta
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttggcaagtatttggttacgcaaccccc
aaaggatggggcttaaaaataggccatcaaagcatgcgaggaacctttgtggctcctctgccgatccatactgcggaact
acaagcagcttgtttcgctcgcagcaggtctggagcgacacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggatgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccacccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatatttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctc
tgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcacacctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacccgtctttaatcctgagtggcagactccctcctttcctcacattcatttaca
ggaggacattatcaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaaatacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgtttggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctccttctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB014383_FT00000_P-C Feature FT:source AB014383_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 24Y06HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtaaggggcctctaccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcacagaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattatacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaacagacaactctgttgttctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccattcctgccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagaktaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctatacgagatctcctcgacaccg
ccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaagcagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatctcctgtcttacttttggaagagaca
ctgttcttgagtacttggtgtctttcggagtgtggattcgcactcctactgcttacagaccaacaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgcattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700559_FT00000_P-C Feature FT:source HQ700559_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BD5561_2001). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtaaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctgrctcagtttactagcgccatttgttcagtggttcgyagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataagaccaagagatggggctattcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaagaacatattagactaaaaatcaaaaactgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtattcaagctaaacaagctttcactttttcgtcaacttacaaagtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggggcgaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggmtctaccgtccccttctccgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttamagactgggaggagttgggggaggagattagatta
aaggtstttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagacctcctcgacaccg
cctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagtggtcag
ttatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctmccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttgaa
agaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgccgttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaatctggcattctatataagagagaaactacacgcag
crcctcattttgtgggtcaccatattcttgggaacaagagctacggcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccrctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ675789_FT00000_P-C Feature FT:source MZ675789_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Viet_ocHBV55). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtattcatttaaaccctactaaaaccaaacgctggggttactccctcaatttcatgg
gatatgtaattggaagttggggtaccttaccacaagagcatattgtacaaaaaattaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaacgcattgtggggcttctgggttttgccgctcccttcacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgctcggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatacgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcacaactcatcggcaccgacaactctgtcgtgctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacacaagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactgggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacagatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagaccacgaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttgcactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtgaacaatatgtaggccctcttacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacctgaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaaccacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcaccccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY167090_FT00000_P-C Feature FT:source AY167090_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Ib). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattgcaccaagctctgctagaccccagagtgagggggctatacttccctgctggtggctccagctccggaa
cagtaaaccctgttccgactattgtctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
ttccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacggtggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaataggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacatttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgtcgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattatgtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacgactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatattctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcgtccacacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaacta
aaacaatccagattgggacttcaaccccaacaaggatcaatggccacaggcacatcatgttggagcgggagcattttggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcatgctcagggcatattgacaacagcgccagtagta
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctgtccacctctaagagacagccatcctca
tgccatgcagtggaa
>gnl|hbvnuc|JQ688403_FT00000_P-C Feature FT:source JQ688403_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBVC1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439631_FT00000_P-C Feature FT:source MZ439631_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BO129-2019-Quasi-8). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacctttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccaactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctgt
taccaattttcttttatctttgggtatccatttaaaccctaataaaaccaagcgttggggctactccctgaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttactgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaccctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
accggttggggcttggccatgggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgttctctctcggaaat
acacctcgttcccatggctgctcggctgtgctgccaactggatcctgcgcgggacatcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggtcgcttggggatctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgccaatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggttcttgagtatttggtgtccttcggggtgtggattcgcacaccccccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcttcaatcctgaatggcaaactccctcttttcctgatatacatttgca
ggaagacattattaatagatgtcaacaatttgtgggccctctaaatgcaaatgaaaaaaggagattaaagctaattatgc
ccgctagattttttcctaaccttaccaaatatttgccattggataaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcctcaaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcctgcccgaccatcagttggacccggctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggt
cagggttcaccccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB300365_FT00000_P-C Feature FT:source AB300365_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaggtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacactctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacagtatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctctgacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaatagca
cctcctcctgcatccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|LC279249_FT00000_P-C Feature FT:source LC279249_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18_serum). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttactctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttctccgcaccatacagcactcaggcaagctattctg
tgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattataaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtctggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439575_FT00000_P-C Feature FT:source MZ439575_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2007-Quasi-5). Complete genome. [Riboviria] (length=3200 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtacagggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaagaagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatcaaacctcgacaaggcatggggacgaatctt
tccgttcccaatcctctgggattctttcccagtcaccagttggacccggcattcagagccaattcaaacaatccagattg
ggacctcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggaccagggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB670283_FT00000_P-C Feature FT:source AB670283_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctc
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggccggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562313_FT00000_P-C Feature FT:source FJ562313_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I204). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaawtttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgcagctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggatactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggycttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctttgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatccgaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctctacaaggc
acggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagctgcaaatcaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774345_FT00000_P-C Feature FT:source KC774345_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxn1076). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctactagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcgcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatctaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttagaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttgtatgcatgtatacaatctaagcaggctttcactttttcgccgacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccgacaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaaatctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttcacatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtgcctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtgttttggggtggagccctcaggctcagggcatattggcaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB642097_FT00000_P-C Feature FT:source AB642097_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2003-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtatttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtktggctttcagttatatggatgatgtggtattggggrcaargtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgctggggctactcccttaacttcatgg
gatatgtaattggaagctggggtactttaccacaggaacatattgtattaaaaatcaagcaatgttttcggaaactacct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggccttttaggctttgctgccccgtttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaarcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggmacctttgtggctcctctgccgatccatactgcggaact
cttagcagcttgttttgctcgcagccggtctggagcaaaactgatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagtaccttgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtcgagttactctcttttttgcctwckgacttctttccttctattcgagatctcctcgataccg
ccgctgctctgtatcgggaggccttagagtctccggaacattgytcagctcaccatacagcactcaggcaagccattctr
tgttggggagagttgatgaatctggccacctgggtgggaagtaatttggamgacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttatgtttgggagagata
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcaatgttagtatcccttggactcataaggtgggaaac
tttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
agaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaacttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcctaactaggcattatttacatactctgtggaaggctggyattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcanggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctcwaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939605_FT00000_P-C Feature FT:source EU939605_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C200). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggccttcc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcataaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaatacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccacaggctcagggcctattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagggacagtcatcctca
ggccagtcagtggaa
>gnl|hbvnuc|GQ377584_FT00000_P-C Feature FT:source GQ377584_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J133). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagaaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtacttaaactcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggcctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactctcggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaataggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaacttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377529_FT00000_P-C Feature FT:source GQ377529_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J34). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgttcaacatcttgagtccctttttaccactgt
taccgcttttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctactcccttaacttcatgg
gttatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaaacaatgttttcggaaacttcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttttactttctcgccaacatacaaggcctttc
tatgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggtacggacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttggggctataccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgtccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatctggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377593_FT00000_P-C Feature FT:source GQ377593_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J150). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctattcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacacattgtaacgaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtattcaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatacggcggaact
cctggcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctggtagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccctgcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccatcctttcctcacattcatttaca
ggaggacattattaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaagtatttgccattggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcgaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
ccgcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439566_FT00000_P-C Feature FT:source MZ439566_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2004-Quasi-15). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgaactcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctcttctg
tgttggggtgagttgatgactctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaagaagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaagaggc
atggggacgaatctttctgttcccaatcctctgggattctttggcgatcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JF436920_FT00000_P-C Feature FT:source JF436920_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SZ6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaacaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcgtcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccattcgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttttacctctat
taccaattttctgttgtctttgggtatacatttgaaccctaataaaaccaaacgctggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcaccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcagactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaagtatttgcccttggacaaaggcattaaaccctattatcctgaacaggcagtt
aatcattacttcaaaactaggcattatttacacaccttgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgctcggagccaactc
aaacaatccagattgggacttcaatcccaacaaggatcattggccagaggccaatcaggtaggagcgggagcattcgggc
cagggttcaccccatcacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctacgcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY363257_FT00000_P-C Feature FT:source KY363257_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate geno3.6). Complete genome. [Hepadnaviridae] (length=3182 residues).
ctcaacaacattccaccaagctcctgctggtggctccagttccggaacagtaaaccctgttccgattactgcctcaccca
tatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctgctc
gtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaa
ttttctagggggagcacccacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctc
caacttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcaccttc
ttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggacc
atgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaact
gcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctc
agtttactagtgccatttgttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatattgta
ttgggggccaagtctgtacaacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacattt
gaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccac
aggaacatattgtattaaaactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaa
agaattgtgggtcttttgggctttgctgccccttttacacaatgtggctatcccgccttgatgcctttatatgcatgtat
acaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtgtcaacaatacctgcacctttaccccgttg
cccggcaacggtcaggtctctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgc
atgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctgg
agcgaaacttatcgggactgacaactctgttgtcctctctcggaaatacacctccttcccatggctgctcgggtgtgctg
ccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgttgaatcccgcggacgacccgtctcggggccgt
ttgggcctctaccgtccccttcttgctctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtgaacgcccacca
ggtcttgcccaagctcttacataagaggactcttggactctcagcaatgtcaacgacctaccttgaggcatacttcaaag
actgtttgttcaaagactgggaggagttgggggaggagactaggttaatgatctttgtactaggaggctgtaggcataaa
ttggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcctacggttcaagcctcc
aagctgtgccttgggtggctttgggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttt
tttgccttctgacttttttccttctattcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctc
cggaacattgttcacctcaccatacagcactcaggcaagctgttctgtgttggggtgagttgatgaatctggccacctgg
gtgggaagtaatttggaagatccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaaaatcag
acaactattgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgt
ggattcgcactcctcccgcttacagaccacaaaatgcccctatcttatcaacacttccggaaactactgttgttagacga
cgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatc
tcgggaaccccaatgttagtatcccttggactcataaggtgggaaactttactgggctttattcttctactgtacctgtc
tttaatcctgagtggcaaacaccctcctttcctaacattcatttacaggaggacattattgatagatgtcaacaatatgt
gggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgctaggttctatcctaaccttaccaaatatt
tgcccttggataaaggcattaaaccttattatcctgaacatgcagttaatcattacttcaaaactaggcattatttacat
actctgtggaaggctggcattctatataaaagagaaactacacgcagcgcttcattttttgggtcaccatattcttggga
acaagagctacagcatgggaggttggtcttccaaacctcggcaaggcatggggacgaatctttcggttcccaatcctctg
ggattctttcccgatcaccagttggaccctgtattcggagccaactcaaacaatccagattgggacttcaaccccaacaa
ggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccacacggcggtcttttgg
ggtggagccctcaggctcagggcacattgacaacagtgccaacagcgcctcctcctgcctccaccaatcggcagtcagga
agacggcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MZ439643_FT00000_P-C Feature FT:source MZ439643_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2004-Quasi-4). Complete genome. [Riboviria] (length=3200 residues).
ctccagcacattccaccaagctctgccagatcccagagtttctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcaccaaggtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcctgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataaagaatttggagcttc
tgtggagttactctcttttttgccttctgacttctttcctaatattcgtgatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttggacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttat
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagaggagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggacggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaattccaacaatccagattg
ggatctcaaccccaacaaggatcaatggacagcggcaaatcaggtaggagtaggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ089775_FT00000_P-C Feature FT:source DQ089775_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK290). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccccgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgstgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacacattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggacttttgggttttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacttttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggccttgcctaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacagcactaaggcaagctattgtg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggatgatccggcatccagggaagtagtagtaaa
ctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctgtcttacttttggaagacaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagaggacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggcccccttacagttaacgaaaaacggagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtycccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacmatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcaaggcatattgacaacagtaccagcagcg
cctcctcctgcctctaccaaacggcagccaaaaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ410519_FT00000_P-C Feature FT:source KJ410519_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Occult_HK514). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggcagttggggtaccttgccacaggaacatattgttcaaaaaatcaaacaatgttttaggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctcccttcacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttaca
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaaccttttggggtggagcccccaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013780_FT00000_P-C Feature FT:source KR013780_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctaagtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggccccagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacattcgaaccctaataaaaccaaacgatggggctattcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacacattatactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttgggctttgctgccccttttacgcaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacactcgaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactgaatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtcggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaattcggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgttttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggagtctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcccatggacaagggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttgcatactctatggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaagccccgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcgaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173335_FT00000_P-C Feature FT:source KJ173335_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate YY010C(e112)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcatcaagctctactagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtgaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccctttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactccctgaacttcatgg
gatatgtaattgggagttggggtaccttaccacaggaacatattgtacttaaaatcaggcaatgttttcgaaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttactgcctttgtacgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaccctttaccccgttgccaggcaacggccgggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggggcaaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccaatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcctttggggtgtggattcgcacaccccccgcatataggccgccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatatacatttgca
ggaggatattattactagatgtcaacaatttgtgggccctcttactgtaaatgagaaaaggagattaaagttaattatgc
ccgctagattttttcctaaccgtaccaaatatttgcccttagagaaaggtattaaaccttactatcctgaacatacagtt
aatcattacttcaaaacgaggcattatttgcataccctttggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcacaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggcccagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598713_FT00000_P-C Feature FT:source KJ598713_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB518). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagttgttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttctgttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggaactttaccgcaagaacatattgtactaaaaatccagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgactcgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
agaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccctggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggttttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggctcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagttaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY882002_FT00000_P-C Feature FT:source KY882002_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggagcctatactttcctgctggtggctccagctccggaa
caggaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattaggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
ggtatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaaccttttccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgccccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctgttcgagatctcctcgacaccg
cctcagctctgtatcgggtggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattggtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgccattagacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|HQ700502_FT00000_P-C Feature FT:source HQ700502_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_Is_1991). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctttattatcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacctcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgatggggatattcccttaatttcatgg
gatatgtaattggaagttggggtaccttaccacaagaacatattgtacgcaaaattaaacaatgtttcagaaaacttcct
gtaaataggcctatcgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtattcaagctaagcaagctttcactttttcgtccacttacaaggtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctatcgtcccctccttcgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagatcaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttccgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
cctcagctttgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagttgtcag
ttatgttaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttaaa
agaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattgaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaagctggcattctgtataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggggcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattaacaacagtgcccgcagcg
cctcctcctgcctccaccaatcggcagtcaggacgacagcctactcccatctctccacctctaagagatactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ027318_FT00000_P-C Feature FT:source JQ027318_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcgtggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactacaaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatcyctttataccgctat
taccaattttcttttgtctttgggtatacatttaaaccctactaaaactaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtaccttaccacaggagcatattgtacacaaaattaagcaatgttttcggaaacttcct
atcaatagacctattgattggaaagtctgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaaaacaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagcggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgyggagttactctcttttttgccttctgacttttttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgytctcctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacatttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaaccctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattattaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactagacattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacgaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggctccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatagtgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173391_FT00000_P-C Feature FT:source KJ173391_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Vac01-M(m601)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtgaatagacctattgattggaaagtatgtcagagaattgtaggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagccctcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccgccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598706_FT00000_P-C Feature FT:source KJ598706_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB54). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagttgttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttctgttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggaactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgactcgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttgcactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
agaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccctggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggttttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964071_FT00000_P-C Feature FT:source KU964071_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 19_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctgtactttcctgctggtggctccagtttcggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctcgactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattgactgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
agggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagctctcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatacgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacagtgccagtagca
cctcctcctgcctccacaaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439663_FT00000_P-C Feature FT:source MZ439663_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2004-Quasi-24). Complete genome. [Riboviria] (length=3200 residues).
ctccagcacattccaccaagctctgccagatcccagagtttctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcctgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataaagaatttggagcttc
tgtggagttactctcttttttgccttctgacttctttcctaatattcgtgatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttggacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttac
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagaggagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggacggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcagagccaattcaaacaatccagattg
ggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ032356_FT00000_P-C Feature FT:source FJ032356_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1030-9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccccaacattccaccaagctctgctagaccccagagtgaggggcctacactttcctgctggtggctccggttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcactgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggcggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcactattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggactgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacacattgtactaaagctcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcggcaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcgcctcaccatacagcactcaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tccacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaaccctgaatggcaaactccctcctttcctcacattcatttgca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaagccatattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcgttctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttccgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagtggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475318_FT00000_P-C Feature FT:source GQ475318_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR14CHB). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccacatttcaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtaatcaaactcaagcaatgttttcggaaactacct
gtaaatagacctattgattggaaagtttgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcgggactgacaactcggttgtcctctctcggaaat
acacctcgttcccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcggctgccgttccgaccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccatcaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgtccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctatggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttgcatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtattttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ924609_FT00000_P-C Feature FT:source GQ924609_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M17). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccaactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcagagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
gtatccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgtcaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcac
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtctcctagaagaagaactccctcgcctcgcagangaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatstcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgttcctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctctgacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggtatcaaaccttattatcctgaacatacagtt
aatcattacttccaaaccagacattatttacatactctgtggaaggctggtattttatataagagagaaactacccgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148567_FT00000_P-C Feature FT:source KP148567_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y26-3-60). Complete genome. [Hepadnaviridae] (length=3194 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcccctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttggtctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacacattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccgtggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttaggggaggtactaggaggc
tgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcctact
gttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttggagcttctgtgga
gttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtatcgggagg
ccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctgtgttggggtgagttgatgaat
ctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaagctatgtcaatgttaatatggg
cctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaactgttctagagtatttggtgt
cttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatcttatcaacacttccggaaactact
gttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcag
aagatctcaatctcgggaatcttaatgttagtatcccttggactcataaggtgggaaactttactgggctttattcttct
actgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaaagaggatattatcaacagatg
tcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgcctgctaggttctatcctaacc
ttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagttaatcattacttccaaactagg
cattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacgcagtgcctcattttgtgggtcacc
atattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaacctttctgtt
cccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattcaaacaatccagattgggactt
caaccccaacaaggatcattggccagcggcaaaccaggtaggagtgggatccttcgggccagggttcactccaccacacg
gcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcgcctcctcctgcctccaccaat
cggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU679951_FT00000_P-C Feature FT:source KU679951_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 112_CA_Her). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcctcagcattccatcaagctctacaagaccccagagtaaggggtctgtattttcctgctggtggctccagttccggaa
cagtaagccctgttccgaatactgtctctcacatctcatcaatcttcacgaagactggggaccctgcgacgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcarttttctagggggagctcccgcgtgtcgtggccaaaattcgcagtccc
aaacctccaatcactcactaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgatmactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgyaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgayctggtattgggggccaartctgtacaacatcttgagtccctttttaccgctgt
tacyaattttcttttgtctctgggtatacatctaaatcctcacaaaacaaaacgatggggttattcccttaacttcatgg
gttatgtgattggtagctggggaagcttaccacaggatcatattgtacaaaaaatcaaacactgttttagaaaacttcct
gttaataggcctattgattggaaagtatgccaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttgatgcctttgtatgcatgtatacaagctaagcaggctttcattttttcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgctcggcaacgggctggtctttgccaagtgtttgctgacgcaacgccc
actggctggggcttggccataggccatcagcgcatgcggggaacctttgtggctccgctgccgatccatactgcggaact
tctagcagcctgtttcgctcgcagccggtctggagcgaaccttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgcttgggkctctaycgtccccttctccgtytgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatytgccggaccgtgtgcacttcgcttcacctytgc
acgtcgcatggagaccmccgtgaacgcccmcctgatcttgcccaaggtyttacataagaggactcttggactctcaacga
tgtcaacgaccgaccttgaggcatatttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggrcatggacattgacccttataa
agaatttggagcttccgtcgagttactctcttttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
cctccgctctgtttcgggakgccttagaatctccggaacattgywcacctcaccatacagyactcaggcaagctattctg
tgttggggcgagttaatgaatctggccacctgggtgggargtaatttggaagaccmagcatccagagawttagtagtaag
ttatgtcaatgytaatatgggcctaaaacttagacaaatattgtggttycacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcatttggagtgtggattcgcactcctrctgcttatagaccwrcmaatgcccctatccta
tcaacgcttccggaractactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgatattcatttacg
ggaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaagaaractaaaattaattatgc
ctgctaggttctatcctacactcaccaaatatttgcccttggacaaaggcattaagccttattatcctgaacatrcagtt
aatcattacttcaaaactagrcattatttacatactctatggaaggcgggtattctatataagagagaaactacacgcag
cgcctcattytatgggtcaccatattcttgggaacaagagctacagcatgggaggttggkcttccaascctcggaaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcaggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccgccaatcggcagtcaggaagacagcccactcccatatcacaacctytaagagtcactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439642_FT00000_P-C Feature FT:source MZ439642_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2004-Quasi-3). Complete genome. [Riboviria] (length=3200 residues).
ctccagcacattccaccaagctctgctagatcccagagttcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcctgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataaagaatttggagcttc
tgtggagttactctcttttttgccttctgacttctttcctaatattcgtgatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttggacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctattgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttat
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagagaagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatccgctgggattctttcccgatcaccagttggacccggcattcagagccaattcaaacaatcccgattg
ggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctcaggccatgcagtggaa
>gnl|hbvnuc|KY470936_FT00000_P-C Feature FT:source KY470936_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KXY-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccgtatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gctatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagccttaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcgacaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccgactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcatagattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaaccagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881751_FT00000_P-C Feature FT:source KY881751_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate control-02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccattcttctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MH818373_FT00000_P-C Feature FT:source MH818373_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hiroshima GtC CL3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggatactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctc
tgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggacgacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttactttcggaagagata
cggttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcatactccctcctttcctaacattcatttaaa
ggaagacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX504544_FT00000_P-C Feature FT:source JX504544_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-SD-14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcttatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaagcttaaacaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggcttcgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggccttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacttttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcgaaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctccgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctt
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatttaca
ggaggacattattactagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774202_FT00000_P-C Feature FT:source KC774202_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2048). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctactcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgcccctttcacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatcgaagcaggctttcactttttcgccaacttataaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgatagctgacgcaaccccc
actggatggggtttggccgtaggccatcagcgcatacgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggtactgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgcttgggactctaccgtccccttctccgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttttcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaataagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcatttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactataccggtctttaatcctgagtggcaaactccctcctttccttacattcatttgca
ggaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaataatgc
ctgctaggttttatcctaaccttaccaaatatttgccattagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctcctcctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013832_FT00000_P-C Feature FT:source KR013832_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcaccctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggctgttggggtactttaccgcaagaacatattgtactcaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccccttcttcatcggccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgcgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctcctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AF384371_FT00000_P-C Feature FT:source AF384371_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G376-7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
caccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtgtctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattcta
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaagaaggagattaaaattaattatgc
ctgctagattttatcctaacattaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377543_FT00000_P-C Feature FT:source GQ377543_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J63). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatyaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactcaaaatcaagcaatgttttcgaaaactgcct
gtacatagacctattgattgaaaagtatgccagagaattgtgggtcttttgggcttcgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcctgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgtccaccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctgctcgacaccg
cctcagctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatattaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtagtgccgtgagcctccgcaa
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439721_FT00000_P-C Feature FT:source MZ439721_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2019-Quasi-1). Complete genome. [Riboviria] (length=3200 residues).
ctccaccacattccaccaagctctgctagatcccagagttcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcctgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataaagaatttggagcttc
tgtggagttaatctcttttttgccttctgacttctttcctaatattcgtgatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttgaacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttat
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagagaagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgaagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatccgctgggattctttcccgatcaccagttggacccggcattcagagccaattcaaacaatcccgattg
ggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774199_FT00000_P-C Feature FT:source KC774199_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2040). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaagaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccgtttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctataggccatcagcgcatacgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggtaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccctactccatctgccgttccgaccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttttcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaacatgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaacgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggtcctcttacagttaatgaaaaaaggagattgaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccgtggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccgccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873541_FT00000_P-C Feature FT:source KF873541_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 042_DR_Wad). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacagcatttcaccaagctctgcaagatcccagagtaaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaatactgtctctcacatctcatcaatcttcacgacgactggggaccctgcaacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaatctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgatcactgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatctggtattgggggccaagtctacacaacatcttgagtcccttttttccgctgt
taccacttttcttttgtctttgggtatacatttaaatccccacaaaacaaaacgatggggttattccctcaacttcatgg
gatatgtgattggtagctggggaagcttaccacaagatcatattgtacaaaaaatcaaacacagttttagaaaacttccc
gttaataggcctattgattggaaagtatgtcaacgaattgtcggtctcttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaagctaaacaggcttttactttctcgccaacttacaaggcctttc
tgtgcaaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcagcgcctgcggggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactccgttgtcctttctcggaaat
acacctcctttccatggctgctcggttgtgctgcgaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaaccccgcggacgacccgtctcgcggccgcttggggmtctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
atgtcgcatggcgaccaccgtgaacgcccacatgatcttgcccaaggtcttacataagaggactcttggactctcaacga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
awgrtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccattataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagatctccttgacactg
cctccgctctatatcgggatgccttagartctccggaacattgttcacctcaccatacagccctcaggcaagctattctg
tgttggggtgagttaatgaatctggctacctgggtaggaagtaatttggaagatccagcatccagggaattagtagtcgg
ttatgtcaatgttaatatgggcctaaaaattagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccgtggactcataaggtgggaaat
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctgatattcatttaaa
agaagacattatcaataggtgtcaacaatatgtgggcccccttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaacattaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaagactaggcattatttacatactctgtggaaggctggtattctatataagagagaaaccacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcattcgggc
cagggttcactcccccacacggaggtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674399_FT00000_P-C Feature FT:source MF674399_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV040030). Complete genome. [Hepadnaviridae] (length=3194 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcactaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaaccaaacgttggggttactcccttcacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcgggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagaggc
tgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcccact
gttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttggagcttctgtgga
gttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccgcctctgctctatatcgggagg
ccttagagtctcctgaacattgttcacctcaccatacagcactaaggcaagctatcctgtgttggggtgagttgatgaat
ctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaagctatgtcaatgttaatatggg
cctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatttggtgt
cttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatcttatcaacacttccggaaactact
gttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcag
aagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttattcttct
actgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaaagaggatattatcaatagatg
tcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgcctgctaggttctatcctaacc
ttaccaaatatttgcccttagataaaggcattaaaccttattatccggaacacatagttaatcattacttccaaactagg
cattatttacatactctgtggaaggctggtattttatataaaagagaaactactcgcagcgcctcattttgtgggtcacc
atattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctttctgtt
cccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaattcaaacaatccagattgggactt
caaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggccagggttcactccaccacacg
gcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctcctcctgcctccaccaat
cggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ377553_FT00000_P-C Feature FT:source GQ377553_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J84). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatttccctgttggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatctacttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatctgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagcaggtctggagcgaaacttatcggaactgacaactctgtcgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggggagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcgaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcgtcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439465_FT00000_P-C Feature FT:source MZ439465_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2013-Quasi-11). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaagatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttctattgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctacgcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttatcccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtgcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439581_FT00000_P-C Feature FT:source MZ439581_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2019-Quasi-2). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
gtaaaaagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgtttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaagaagattaaaattgatcatgc
ctgctaggttttatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX504537_FT00000_P-C Feature FT:source JX504537_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-HZ-49). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcaccaagctctgctagatcccagagtgcggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggattggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctactcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaaccaaacgttggggctactctcttaactttatgg
gctatgtaatagggagttggggtacattgccacaggaacatattgtactgaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcctgcattaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccgacaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcactaggccaccggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtgtgtgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctgaaaatcagacaactcttgtggttccacatttcttgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaagacattatcaatagatgccaacaatatgtgggccctctcacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcattaaaccttactatcctgagcatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcatcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964340_FT00000_P-C Feature FT:source KU964340_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 38_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctgtactttcctgctggtggctccagtttcggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctcgactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattgactgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
agggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagctctcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatacgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439552_FT00000_P-C Feature FT:source MZ439552_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2004-Quasi-1). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctcttctg
tgttggggtgagttgatgactctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaagaagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774252_FT00000_P-C Feature FT:source KC774252_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1031). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactgggggccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgcccgtttgtcctct
acttccaggaacctcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaaagatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattatactaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttaggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaccaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaacatcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470890_FT00000_P-C Feature FT:source KY470890_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23-H07). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccgtgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtcaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttaggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcccttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatgtgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439678_FT00000_P-C Feature FT:source MZ439678_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2007-Quasi-12). Complete genome. [Riboviria] (length=3200 residues).
ctccagcacattccaccaagctctgctagatcccagagttcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctctct
ctacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctcttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataaagaatttggagcttc
tgtggagttaatctcttttttgccttctgacttctttcctaatattcgtgatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttggacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctattgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaactttactgggctttat
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagagaagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatccgctgggattctttcccgatcaccagttggacccggcattcagagccaattcaaacaatcccgattg
ggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ040162_FT00000_P-C Feature FT:source JQ040162_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G216). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggctgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctcttgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgcctatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttctctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaaatttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtctaacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcaytaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacccgcag
cgcctcattttgtgggtcaccatattcttgggracaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013797_FT00000_P-C Feature FT:source KR013797_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggaactttaccacaggaacatattgtaatgaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctgttgattggaaagtctgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtattcaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccgactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccccgcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggccccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccatcctttcctcacattcatttaca
ggaggacattattaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgccattggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcgaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
ccgcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964327_FT00000_P-C Feature FT:source KU964327_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 37_10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgagaggcctatacagtcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcaccgagcatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaacgaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttataggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttaggggaggagactaggtta
atgatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcgattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactcctgtggtttcacatttcctgtcttacttttggaagagata
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaagattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccatattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatcccgattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggtccaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013785_FT00000_P-C Feature FT:source KR013785_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactagtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctctcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctattcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacacattatactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttgggctttgctgccccttttacgcaatgtgg
ctatcctgccttgatgcctttatatgcatgtacacactcgaagcaagctttcgctttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtcggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcccttggacaagggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctatggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcgaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276839_FT00000_P-C Feature FT:source KX276839_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgttagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagtacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtctgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagkccctttwtacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgctggggctactcccttaacttcatgg
gatatgtaattggaagttggggtgctttaccgcaggaacatattgtactaaaacttaagcaatgttttcgaaaattgcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgcattgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcraaacttatcgggaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcatctgtggagttactctcttttttgcctgctgacttctttcctcctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcacttaggcaagctgttctr
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaattcagacaactattatggtttcacgtttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctatmgcttacagaccaccaaatgcccctatctta
tccacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccgtattatccggaacatgcagtt
actcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcttccaccaatcggcagtcaggaagacagcctactcccatctctccacctttaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|S75184_FT00000_P-C Feature FT:source S75184_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgggttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagacttgtggtggacttctctcaattttctagggggagcacccaagtgtcctggcctaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctcgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacaccaactaccagcacaggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcatttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagaactgttttcgaaaactgcct
gtaaatagacctattgattggaaagtctgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatccaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgcgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcgtgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacaacccgtctcggggccgtttgggactctaccgtccccttcttcgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccagaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacgaggc
atggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgcactgacaaccgtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU872008_FT00000_P-C Feature FT:source EU872008_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 252A-8). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaaattcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgctggggctactcccttaacttcatgg
gatatgtaattggctgttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccgacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctcgcagcttgttttgctcgcagccggtctggagcaaaacttattggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggaatctaccgtccccttcttcgtctgccgtaccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaggactgtttgtttaaggactgggaggagttgggggaggagaccaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cttcagctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctggagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaaa
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagtaaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacaaagctttct
gttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccac
acggcggtctttcggggtggagccctcaggctcagggcatattgacaacagtgccagtagcacctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KR013789_FT00000_P-C Feature FT:source KR013789_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcccggctatcgctggatatatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctagctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattggggaccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtccttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtattaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgtagcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcgtgttttgctcgcagccggtctggagcgaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcctcttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcaccactgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtacttggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccgtctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtccccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagttgtcaa
ctatgtcaatgttaatatgggcctaaaaattagacaactgttgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagatgtcgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcctctactgtacctatctttaaccctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacacactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctccacaaggc
atggggacgaatctttctgttcccaaccctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagca
cctcctcctgcctccaccaatcggaagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534678_FT00000_P-C Feature FT:source MK534678_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D541). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtcggcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctcataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccgggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtgttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aagatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgatttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaagcagtagtgag
ctatgtcaatgttaacatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaaaggaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
ggaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaaattgattatgc
ctgctaggttctatcctacccttaccaaatatttgcccttagagaaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattctgcgaaacctcgcaaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccacgaagtggaa
>gnl|hbvnuc|KC774280_FT00000_P-C Feature FT:source KC774280_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1053). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctactcccttaacttcatgg
gctatgtaattggaagttggggcaccttaccacaggaacatattgtactaaaaatcaaacactgttttcgaaaacttcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttgtacgcatgtatacaatctaagcaggcttttactttctcgccaacatacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaacttatcggtacggacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggactttaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatcttctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtattaaaccttattatcctgaacatgttgtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
caacaatccagattgggacttcaaccccaacaaggatcactggccagaagccaatcaggtaggagtgggagcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964347_FT00000_P-C Feature FT:source KU964347_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 38_14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctgtactttcctgctggtggctccagtttcggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctcgactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattgactgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
agggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagctctcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatacgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470916_FT00000_P-C Feature FT:source KY470916_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 7-6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatattttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttactcaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaggcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactcggttgtcctctctcggaaat
acacttcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactcggtta
atgatctttgtactgggaagctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagcttttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtagg
ctatgtcaatgttaatatgggcctaaaactcagacgactattgtggtttcacatttcctgtctaacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcaaattcatttgaa
ggaggacattatcaccagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaatcttactaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatatctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB367402_FT00000_P-C Feature FT:source AB367402_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaagggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagttcactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaaagatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacagtgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcacaacttattgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcctaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcccaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013804_FT00000_P-C Feature FT:source KR013804_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggatcctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcgattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaacgaccagcacgggaccatgcaagacctgcacgatccctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggttctttaccacaagaacatattgtactaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcgaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatagctgctggggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgccgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacactg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacccgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatattggcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcatcattttgcgggtcaccatattcttgggaacaagagctaccgcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctatccgttcccaatcctctgggattctttcccgatcaccagttggaccctgccttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcaaggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881769_FT00000_P-C Feature FT:source KY881769_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate control-03). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccattcttctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ478899_FT00000_P-C Feature FT:source DQ478899_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CHN-D20). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctccagttccggaa
cagtacaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtatctgcggcgttttatcata
ctcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgttcctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaatcctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacggattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgccaggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgataactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
ccgctgctctgtatcgggaggccttagagtctccagaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtcgtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gcctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcccttggacagaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439408_FT00000_P-C Feature FT:source MZ439408_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2004-Quasi-2). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgtagtt
aatcattacttccaaaccaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttttgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagcaccagcagcg
cctcctcctgcctccaccaagcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439472_FT00000_P-C Feature FT:source MZ439472_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2013-Quasi-18). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaagccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaagatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagaactgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttcct
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgaatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcattaaggaagacagcgtactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598730_FT00000_P-C Feature FT:source KJ598730_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB617). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactcccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgattccct
cttgttgctgtacaaaaccttcggacagaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcacggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcactaggccatcagcgcctgcgtggaacctttgtggctcctctgccgattcatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgattggggctctaccgtccccttctgtgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgtgatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtaag
ctatgtcaatgttaatatgggcataaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattatcgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964224_FT00000_P-C Feature FT:source KU964224_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 29_11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctcgcagcgtgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagactaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439438_FT00000_P-C Feature FT:source MZ439438_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2007-Quasi-2). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttatcccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgaatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcggtggcctgcggcaaaccaggtaggagtgggagccttcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctctggctcagggcatattgacaacactaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|FJ386594_FT00000_P-C Feature FT:source FJ386594_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1878). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttccacaacattccaccaagctctgctagaccccagagtgcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagaacacaacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctattaccaattttctttt
gtctttgggtatacatttgaaccctaataaaaccaaacgttggggatactcccttaactttatgggatatgtaattggaa
gttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaattgcctgtaaatagacctatt
gattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtggctatcctgccttgat
gcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaagcaatatc
tgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaacccccactggatggggcttg
gctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcgaaaatacacctcctttccat
ggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtacta
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgt
cctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataaagaatttggagcttc
cgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgctcagctcaccatacagcactcaggcaagctattctgtgttggggtgagttg
atgaacctggccacctgggtgggaagtaatttggaagacccagcatccagggaagcagtagtcagctatgtcaatgttaa
catgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaacggttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcaggcttacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaactttactgggctttat
tcttccactgtaccagtctttaatcctgagtggcaaactccttccttccctcaaattcatttacaggaggacattattaa
tagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgccaggttctatc
ctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagttaatcattactacaaa
actatgcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcagtgcctcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacaaatctt
tctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattg
ggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccwc
cacacggaggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagcacctcctcctgcctcc
accaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ598728_FT00000_P-C Feature FT:source KJ598728_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB613). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctactagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgattccct
cttgttgctgtacaaaaccttcggacagaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcacggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcactaggccatcagcgcctgcgtggaacctttgtggctcctctgccgattcatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctctaccgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctgctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtaag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctctcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtgcctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattatcgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctcggttcccaatcctctgggattctttcccgatcaccagttggatcctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963898_FT00000_P-C Feature FT:source KU963898_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 7_13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaataggcctattgattggaaggtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaacttatcggcaccgacaactctgttgtactctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
atgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacatcg
cctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963887_FT00000_P-C Feature FT:source KU963887_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 7_2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaataggcctattgattggaaggtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccgatctggggcgaaacttatcggcaccgacaactctgttgtactctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
atgaatcccgcggacgacacgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470895_FT00000_P-C Feature FT:source KY470895_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 24-B5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcatgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagatttcta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaacttaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaacataagcaggctttcactttctcgccaacttacaaggcctttc
tttgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaaccttcgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatactccaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctccttgacaccg
cctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctt
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagcgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagtctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674444_FT00000_P-C Feature FT:source MF674444_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV050052). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctctactttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagaggctagactcgtggtgggcttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccccaataaaaccaaacgttggggatactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcagagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctttctcggaagt
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactatcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacacag
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatctcgggaattagtagtaag
ccatgtcaatgttaatatgggtctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactcccacttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattgaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598746_FT00000_P-C Feature FT:source KJ598746_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB710). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctcgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtctgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacttgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcaccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaacacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaca
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcacctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctgtctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggcccgaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtattttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881776_FT00000_P-C Feature FT:source KY881776_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate control-03). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccattcttctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881918_FT00000_P-C Feature FT:source KY881918_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-07). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaatcaaacaatgttttcgaaaactgcct
ataaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcgggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataagggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggctgtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagttgca
cctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|DQ089781_FT00000_P-C Feature FT:source DQ089781_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1476). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttgggttttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccaacggcaaaccaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ410496_FT00000_P-C Feature FT:source KJ410496_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1095). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcactttccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcagcgacttgtggggcttctaggctttgccgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccttctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagcttagatta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagccattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaagcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttgca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagaaacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964027_FT00000_P-C Feature FT:source KU964027_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 16_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacgttccaccaagctctgctagatcccagagtgaggagcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtgattgggagttggggtactttaccacaggaacacattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatcttaacctctaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccccttctgagtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagagaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactatacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttactatccggaacatgcagtt
aatcattacttcaaaactcggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccacacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatactgacaacagtgccagcagcg
cctcctcctgccaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT644995_FT00000_P-C Feature FT:source MT644995_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GX10). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccaaagtgcggggcctctaccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttcct
atcaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctaggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatccagcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaagatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaccgtaccaaatatttgcctttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgaag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atgggaacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggcctgcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatccgca
ggccacgcagtggaa
>gnl|hbvnuc|MZ439479_FT00000_P-C Feature FT:source MZ439479_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2013-Quasi-25). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaagccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaagatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagaactgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacagaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttctattgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttatcccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgaatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtgcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcattaaggaagacagcgtactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439665_FT00000_P-C Feature FT:source MZ439665_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2004-Quasi-26). Complete genome. [Riboviria] (length=3200 residues).
ctccagcacattccaccaagctctgacagatcccagagtttctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcctgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataaagaatttggagcttc
tgtggagttactctcttttttgccttctgacttctttcctaatattcgtgatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttggacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaacttcactgggctttac
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagaggagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggacggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaattccaacaatccagattg
ggatctcaaccccaacaaggatcaatggacagcggcaaatcaggtaggagtaggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB670252_FT00000_P-C Feature FT:source AB670252_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.16). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgttgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctrttctc
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagggaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttacccttggataaaggcattaaaccttattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattttttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactgtccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacamggcggtsttttggggtggagccytcaggctcagggcayattgwcaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtsaggaagacagcctactsccatstctccacctctaasagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562250_FT00000_P-C Feature FT:source FJ562250_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I83). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtaaggggcctttactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgkgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgactccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctacaaccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaaacaatgttttcggaaacttcct
gtaaatcggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttaaacctttaccccgttgcccggcaacggcctggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccgtaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggtactgacaactccgttgtcctctcacggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggtctctaccgtccccttcttcgtctgccgttccgaccgacgac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcaacga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctactgacttctttccttctattcgagatctactcgacaccg
cctctgctctgtatcgggaggccttagagtctccgcaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaag
ttgtccttgagtatttggtatcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcctctattcttctactatacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttgca
ggaggacattatcgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggcattaaaccctattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttccgttcccaatcctctgggattctttcccgatcatcagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccaaaagccaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccactaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439681_FT00000_P-C Feature FT:source MZ439681_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2007-Quasi-15). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgacccggcatccagggaagcagtagtagg
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcttgtcttacttttggaagacaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaagagaagattaaaattgatcatgc
ctgctaggttctatcctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggacccggcattcagagccaattc
aaacaatcccgattgggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB675674_FT00000_P-C Feature FT:source AB675674_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A33). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacaactttccaccaagctctgctagatcccagagtaaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaccctctatgtttccct
cttgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccacttttcttttgtctttgggtatacatttaaatcccaataaaacaaagcgttggggctattcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaagtctgtcaaagaattgtgggtctgttgggctttgctgccccatttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggtactgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctactcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcaccgcaccatacagcactcaggcaagctattctg
tgttggggcgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattggtagtcag
ctatgtcaatgttaatatgggcctaaaaataagacaactattgtggtttcacatttcctgtcttactttcggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagattaaaattaataatgc
ctgctaggttttaccctaactttaccaaatacttgccattagataaaggcattaaaccttattatcctgaacatgtagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattttatataagagagaaactacacgcag
cgcctcattttgcggttcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagcgggagcattcgggc
cggggttcaccccaccacacggcagtcttttggggtggggccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964174_FT00000_P-C Feature FT:source KU964174_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 26_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatattgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctactaaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactgaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagacctccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattattgatagatgtcaacagtatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacaagcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|LC279248_FT00000_P-C Feature FT:source LC279248_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18_nail). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttactctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttctccgcaccatacagcactcaggcaagctattctg
tgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatctggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattataaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtctggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB014394_FT00000_P-C Feature FT:source AB014394_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 35Y17HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaagggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggacttccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgctggggctactccctcaacttcatgg
gatatgtaattggaagctggggtactttaccgcaggaacatattgtattaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctwgcrgcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtytacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgataccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctactctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggcagacccagcatccagggacttagtagtcaa
ctatgtcaatgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatacttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggcaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaytggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ787486_FT00000_P-C Feature FT:source FJ787486_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S2235-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
caccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtgtctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattcta
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaagaaggagattaaaattaattatgc
ctgctagattttatcctaacattaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439478_FT00000_P-C Feature FT:source MZ439478_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2013-Quasi-24). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaagatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagaactgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacagaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttctattgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttatcccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgaatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcaggtattttatataagagagaaactactcgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtgcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ032346_FT00000_P-C Feature FT:source FJ032346_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S732-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcatctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtataaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgctggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtactgaaaatcaagcaatgttttcgtaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgaggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactccgttgtcctttctcggaaat
acacctcatttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctccgtctgccgttccggccgacctc
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacatcgacccatataa
agaatttggagcttccgtggagttactctcttttttgcctactgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173306_FT00000_P-C Feature FT:source KJ173306_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NB023M(M23)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggcatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtgctaaaaatcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtactctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcatttgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcaacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaagggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598678_FT00000_P-C Feature FT:source KJ598678_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB3C2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctgctagatcccagagtgaggggcctatacctccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaaatctgtacaacaccttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcacggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcactaggccataagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctctaccgtcccattctttgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttatataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacctggcaacctgggtgggaagtaatttggacgacccagcatcccgagaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggttccacatttcctgtcttacttttggaagagcaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattatcgatagatgccaacaatatgtaggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgtccttggataaaggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaaccagacattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgttccaaatcctctgggattctttcccgagcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|GQ377599_FT00000_P-C Feature FT:source GQ377599_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J160). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctygttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
caccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtgtctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
ccgctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaattcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
ttcactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggctcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctacgcccatctctccacctctaagagacagtcaccctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173307_FT00000_P-C Feature FT:source KJ173307_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NB255C(m256)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgctccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctgtctcgcaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccagtttttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctacggtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcgtattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY363284_FT00000_P-C Feature FT:source KY363284_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate geno19.1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacaacattccaccaagctctgctagatcccagagtgagaggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagtacgggaccatgcaagacatgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gctatgtaattggaagttggggtactttaccacaggatcatattatacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctctgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgtttcgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctttctcgcaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccgaccgaccac
ggggcgcacctctctttccgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggtggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggcttcggggcatggacattgacccgtataa
agaatttggagcctctgtggaattactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtctcacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaatattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaagattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccaggggcaaatcaggtaggagtgggagcattcgggc
cagggttcacccctccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagctgcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcctatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC875269_FT00000_P-C Feature FT:source KC875269_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV62). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcaggccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgcggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgactctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagagaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattactttcaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964218_FT00000_P-C Feature FT:source KU964218_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 29_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcgtgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagactaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|MZ439511_FT00000_P-C Feature FT:source MZ439511_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2019-Quasi-20). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccgccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttcct
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|EU939619_FT00000_P-C Feature FT:source EU939619_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C233). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctttgctagaccccaaagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcggtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgcacaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactcaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaactccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcggcttgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccatgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcgcattcatttaca
ggaggacattattaatagatgtgaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcgaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagcccgcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439334_FT00000_P-C Feature FT:source MZ439334_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN216-2004-Quasi-3). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatctttggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtcattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagcaaattc
aaacaatccagattgggacttcaaccccaacaaggatccatggccagcggcaaatcaggtaggagtaggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439434_FT00000_P-C Feature FT:source MZ439434_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2004-Quasi-28). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaatttcagacgactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaaccaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttttgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB642099_FT00000_P-C Feature FT:source AB642099_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BFJT2005-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctcgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcggaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcttaaaaatcagacaactactgtggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcttgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgccgaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774268_FT00000_P-C Feature FT:source KC774268_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1085). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagaatctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaataggcctattgattggaaagtatgtcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgcattgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctgttggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgccgacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccattccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
cgaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggctttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggatttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaaccgtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881743_FT00000_P-C Feature FT:source KY881743_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate control-02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccattcttctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964229_FT00000_P-C Feature FT:source KU964229_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 30_1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcaccaagctctactagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgattccct
cttgttgctgtacaaaaccttcggacagaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcacggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcactaggccatcagcgcctgcgtggaacctttgtggctcctctgccgattcatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcctgcggacgacccgtctcggggtcgtttggggctctaccgtccccttctgtgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtataggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctgctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtaag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctctcgcttacagaccaccaaatgcccctatctta
tccacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtgcctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattatcgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctcggttcccaatcctctgggattctttcccgatcaccagttggatcctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcacattgacaacagtgccagcagcg
cctcctcctgcctccaccaaccggcagtcaggaagacagcctactcccatttctccacctctaagagacactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439508_FT00000_P-C Feature FT:source MZ439508_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2019-Quasi-17). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaagatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagaactgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttcct
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgaatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcaggtattttatataagagagaaactactcgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtgcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|MZ439611_FT00000_P-C Feature FT:source MZ439611_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BO129-2007-Quasi-11). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacatttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaaaatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgtaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactccctaaacttcatgg
ggtatgtaattggaagttggggtaccttgccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgctccttttacacaatgtgg
ttatcctgccttactccctttgtattcatgtatacaagctaagcaggcttttactttttcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaagt
acacctcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctaaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttaggacatggacattgaccactataa
agaatttggagcttctgttgagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacatcattcatatcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaacttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcttgtcttacttttggaagagaag
tggttcttgagtatttggtgtccttcggggtgtggatccgtacaccccccgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctaggtctcgggactctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgttcctgtctttaatcctgagtggcaaactccctcttttcctgatatacatttgaa
ggaggacattattgatagatgtcaacaatttgtgggccctcttaatgtaaatgaaaaaagaagattaaagttaattatgc
ctgctagattttttcctaaccttaccaaatatttgcccttagataaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttgcatgccctttggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcaaaacctcggaaaggc
atggggacgaatctgtctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttgggttggagcccgcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|KU964324_FT00000_P-C Feature FT:source KU964324_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 37_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgagaggcctatacagtcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcaccgagcatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaaagcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttataggaaccgacaactctgttgtcctctctcgaaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttaggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcgattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgtacccctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactcctgtggtttcacatttcctgtcttacttttggaagagata
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggacgcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcatcaaaccatattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggccggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatcccgattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT644997_FT00000_P-C Feature FT:source MT644997_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GX12). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaaatttcatcaagctctgctagatcccagagtaaggggcctatatcttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaaccacaagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaagcgttggggatactcccttaatttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaagcaatgttttcgtaaactgcct
gttaatcgacctattgattggaaggtctgccaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgcattactacctttgtatgcctgtatccaagctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggccaggccactgccaagtgtttgctgacgcaaccccc
actggttggggcttggccctgggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagctaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggtcgcttgggggtctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactattggactcccagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgtaccaacaccatgcaactttttcacctctgcctaatc
atctcgtgtgcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacacag
cctctgctttgtatcgggaggccttagagtctccggaacattgttcagctcaccatacagccctcaggcaagctgtgctg
tgttggggtgagttgatgaatttagccacttgggtgggcagtaatttggaagatccagcatccagggaattagtagtcaa
ctatgtcaatgttaacatgggcctaaaactcaggcaactgttgtggtttcatatttcttgtcttacttttggaagagaaa
cagttcttgagtatctggtgtccttcggggtgtggattcgtacacccctcgcatataggccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactggcctttattcttctaaggtacctgtctttaaccctgagtggcaaactccttcttttcctaatatacatttgca
tgaggacattattaatagatgtcaacaatttgtgggccctcttaccataaatgaaaaaaggagattatcgttaattatgc
ctgctagattttttcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaagctggcattctatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttattcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttgccagaccatcagttggacccggctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcttggcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacatcagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctacgcccatctcaccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|MZ439671_FT00000_P-C Feature FT:source MZ439671_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2007-Quasi-5). Complete genome. [Riboviria] (length=3200 residues).
ctccagcacattccaccaagctctgctagatcccagagttcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgtaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattggggacacagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggca
gttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttactcaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccatcaccatgcaactttttccccactgcctaatcatctcttgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataaagaatttggagcttc
tgtggagttaatctcttttttgccttctgacttctttcctaatattcgtgatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttggacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttat
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagagaagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatccgctgggattctttcccgatcaccagttggacccggcattcagagccaattcaaacaatcccgattg
ggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctcaggccatgcagtggaa
>gnl|hbvnuc|DQ089804_FT00000_P-C Feature FT:source DQ089804_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK262). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgttagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctagkacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctcgggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtccaccaatttgtcctggttatcgctggatgtgtctgcggcgttctatcata
ttcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttatgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
gttaatagacctattgattggaaggtgtgtcagagaattgtgggtcttctaggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcgggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactggggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtccccttctgcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttactgactgggaggagttgggggaggagatgaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctattgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggatgctctgcgcagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
ccactgctctgtatggggaggccttagagtctccggaacattgttcagctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatcaagcatccagggacttggtagtagg
ctatgtcaacgttaacatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagata
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccacmaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacccgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggcaggctggtattttatataagagagaaactacacgcag
tgcctcgttttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttcggttcccaatcctctgggattctttcccagtcaccagttggacccagcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatctttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475352_FT00000_P-C Feature FT:source GQ475352_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR48HCC). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacattccaccaagctcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcaccca
catcgtcaatcttctcgaggactggggaccctgcaccgaacatggagaacacaacatccggattcctaggacccctgctc
gtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaa
ttttctagggggagcacccacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctc
caatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttc
ttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggacc
atgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaact
gcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcctggctc
agtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggta
ttgggggccaagtctgtacaacatcttgagtccctttatacctctattaccaattttcttttgtctttgggtatacattt
gaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccac
aggaacatattatactaaaactcaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaa
agaattgtgggtcttttgggctttgctgccccttttacacaatgtggctatcctgccttgatgcctttatatgcatgtat
acaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttg
cccggcaacggtcaggtctctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcagcgc
atgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctgg
agcaaacctcatcgggactgacaactcggttgtcctctctcggaaatacacctcattcccatggctgctagggtgtgctg
ccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
ttgggactctatcgtccccttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtgaacgcccatca
ggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgtccgaccttgaggcatacttcaaag
actgtttgtttaaagactgggaggagttgggggaggagattaggttaatgatctttgtactaggaggctgtaggcataaa
ttggtctgttcaccagcaccatgtaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctcc
aagctgtgccttgggtggctttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctcttt
tttgccttctgacttctttcctcctgttcgagatctcctcgacaccgcctctgctctgtatcgggaggccttagagtctt
cggaacattgttcacctcaccatacagcacttaggcaagctattctgtgttggggtgagttgatggatctggccacctgg
gtgggaggtaatctggaagacccagcatccagagaattagtagtcggctatgtcaatgttaatatgggcctgaaacttag
acaactattgtggtttcatatttcctgtcttacttttggaagagaaactgttcttgagtatttggtatcttttggagtgt
ggattcgcactcctacaccttatagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagagga
cgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatc
tcgggaacctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttattcttctactgtacctgtc
tttaatcctgagtggcaaactccctcctttcctaacattcatttacaggaggacattattgatagatgtcaacaatatgt
gggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgctaggttctatcctaaccttaccaaatatt
tgcccttggataaaggcattaaaccttattatcctgaacatgtagttaatcattacttcaaaactaggcattatttacat
actctgtggaaggctggcattctatataaacgagaatctacacgcagcgcttcattttgtgggtcaccatattcttggga
acaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctttctgttcccaatcctctg
ggattctttcccgatcaccagttggaccctgcattcggagccaactcaaacaatccagattgggacttcaaccccaacaa
ggatcattggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccacacggcggtcttttgg
ggtggagccctcaggctcagggcatgttgacaacagtgccagcagcgcctcctcctgcctccaccaatcggcagtcggga
agacagcctactcccatctctccacctctaagagacagccatcctcaggccatgcagtggaa
>gnl|hbvnuc|KX765855_FT00000_P-C Feature FT:source KX765855_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PID:9192). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactctcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgcttccct
cttgttgctgtacaaaaccttcggccggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagttccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtatcacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcgaaaacttcct
ataaatagacctattgattggaaagtatgtcaacggattgtgggtcttctgggctttgccgctccttttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgtcgtgctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgtttaggtctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctacagtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatttgtgggccctcttacagttaacgaaaaaaggagattgaaattaattatgc
ctgctaggttctatcctaatctgaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaaccacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggcctgcagcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670307_FT00000_P-C Feature FT:source AB670307_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.34). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctcacccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactgaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacatcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacagcactcaggcaagctattcta
tgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcccaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacccgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctagacaaggc
atggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386598_FT00000_P-C Feature FT:source FJ386598_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1889). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctcaaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgcattaatgcctttatatgcatgtatacaakctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtatctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcaattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggacttgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcwtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgataccg
cctcagctctgyatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccctgcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggataaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggtggtcttttggggtggagccctcargctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439636_FT00000_P-C Feature FT:source MZ439636_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BO129-2019-Quasi-13). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacctttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaaaatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttctgttatctttgggtatacatttgaaccctaataaaaccaagcgttggggctactccctaaacttcatgg
ggtatgtaattggaagttggggtaccttgccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgctccttttacacaatgtgg
ttatcctgccttactccctttgtattcatgtatacaagctaagcaggctttcactttttcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctaaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggttcttgagtatttggtgtccttcggggtgtggattcgcacaccccccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcttcaatcctgaatggcaaactccctcttttcctgatatacatttgca
ggaagacattattaatagatgtcaacaatttgtgggccctctaaatgcaaatgaaaaaaggagattaaagctaattatgc
ccgctagattttttcctaaccttaccaaatatttgccattggataaaggtattaaaccttattatcctgaacattcagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagagagaaactacacgcag
tgcatcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcctcaaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcctgcccgaccatcagttggacccggctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggt
cagggttcaccccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU916237_FT00000_P-C Feature FT:source EU916237_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SWT2.2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcctgttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggatccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaaacaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacgatacatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccgtactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
atacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatcccaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtgagccctcttaccgttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774297_FT00000_P-C Feature FT:source KC774297_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1580). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccccgactttccaccaagctccgctaaatcccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttaaatcctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaatttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacagtctaagcaggctttcactttctcgccaacatacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaccctcatcggaaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctaccgtggagttactctcttttttgccttctgacttctttccttcagtacgagatcttctcgacaccg
cctcagctctgtatcgggatgccttagagtctccggaacattgttctcctcaccatacagcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ctgttatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttacagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatttgca
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcactatttacatactttgtggaaagctggcattctatataagagagaaactacatgcag
cgcctcattttgtgggtcaccatattcttggggacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
aaggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacatggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148477_FT00000_P-C Feature FT:source KP148477_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y177-18). Complete genome. [Hepadnaviridae] (length=3218 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcatatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggccttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaactccc
actggctggggcttggccataggccatcagcgcttgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggttttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctctctttttttgccttctgacttctttccttctattcgagatctcctcgaca
ccgcctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctatt
ctgtgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagt
aagctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagag
aaactgttctcgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatc
ttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacg
aaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtggga
aactttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcattt
gaaagaggatattatcaacagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattgatta
tgcctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgca
gttaatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacg
cagtgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaa
ggcatggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaa
ttcaaacaatccagattgggacttcaaccccaacaaggatcattggccagcggcaaaccaggtaggagtgggatccttcg
ggccagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagca
gcgcctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcc
tcaggccatgcagtggaa
>gnl|hbvnuc|KU964322_FT00000_P-C Feature FT:source KU964322_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 37_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgagaggcctatacagtcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcaccgagcatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttataggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaagaactgggaggagttaggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcgattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactcctgtggtttcacatttcctgtcttacttttggaagagata
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaagattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccatattatccggaacatgcagtt
aatcattacttcaaaactatgcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatcccgattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534638_FT00000_P-C Feature FT:source MK534638_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D462). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacatttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
catcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttctgtctttgggtatacatttgaaccctaataaaaccaagcgttggggatactccctaaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtgcagaaaatcaggcaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttgttacctttgtatgcatctatacaagctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatacctgaccctttaccccgttgccaggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgggggcgcttggggctttaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccatgaacgccaaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtgaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggttcttgaatatttggtgtccttcggggtgtggattcggacaccccccgcatataggccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgttcctgtctttaatcctgagtggcaaactcctctttttcctgatatacatttgca
ggaggacatcattaatagatgtcaacaatttgtgggccctcttaatgtaaatgaaaaaaggagattaaagttaattatgc
ctgctagattttttcccaaccttaccaaatatttgcccttagagaaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattctgcgaaacctcgcaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccgggggcctggcaggtaggagcgggagcattcgggc
cagggttcaccccgcctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcc
cctccttctgcctccaccaatcggcagtcagggaggcagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ675791_FT00000_P-C Feature FT:source MZ675791_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Viet_ocHBV107). Complete genome. [Riboviria] (length=3215 residues).
ttccacaacatttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgtaccgaaaatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtattcatttaaaccctactaaaaccaaacgctggggttactccctcaatttcatgg
gatatgtaattggaagttggggtaccttaccacaagagcatattgtacaaaaaattaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaacgcattgtggggcttctgggttttgccgctcccttcacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctcacggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccaaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcac
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacagatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagaccacgaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttgcactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtgaacaatatgtaggccctcttacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttgccaaatatttacccttagataaaggtattaaaccttattatcctgaacatatagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB112065_FT00000_P-C Feature FT:source AB112065_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VT140). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagaaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgtggcccgtttgtcctct
acttccaggaacatcaactaccatcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggacttctgggctttgccgctccctttactcaatgtgg
taccccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttgttcgtctgccgttccggccgaccac
ggggtgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgctttaccactgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
aaggtctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctgttcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaattcggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacagctgttgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactccacccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgaatggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagctaacgaacaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttagatacaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatacgctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtggctcaccatattcttgggaacaagagctacagcatgggaggttggacttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttccctatcaccagttggacccggcattcagagccaattc
aaacaatccatattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcggac
cagggttcaccccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ707773_FT00000_P-C Feature FT:source JQ707773_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S50_27A). Complete genome. [Hepadnaviridae] (length=3191 residues).
ctccagcacattccaccaagctctgatagatcctgctggtggctccagttccggaacagtaaaccctgttccgactactg
cctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcaggattcctagga
cccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggac
ttctctcaattttctagggggaacacccacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacct
cttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgc
ctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccag
cacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcgg
acggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttc
tcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatattgat
gatgtggtattgggggcgaaatctgtgcaccatcttgaatccctttttaccgctgttaccaattttcttttgtctttggg
tatacatttaaaccctactaaaactaaacgttggggctactcccttcacttcatgggatatgtcattggaagttggggta
ccttaccacaggatcatattgtacacaaaatcaaacaatgttttcggaaacttcctacaaatagacctattgattggaaa
gtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgta
tgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttctgtgtcaacaatatctgaaccttt
accccgttgctcggcaacggtctggtctttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggc
catcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcag
ccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaagtacacctcctttccatggctgctag
gctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccgtct
cggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggt
ctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtgaa
cgcccgacaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgaccttgaggcat
acttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggttaatgacctttgtactaggaggctgt
aggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgtt
caagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttggagcttctgtggagtt
actctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggcct
tggagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctgtgttggggtgagttgatgaatctg
gccacctgggtgggaagcaatttggaagacccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcct
gaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatcttatcaacacttccggagacttgtgtt
gttagacaacgaggcaggtccactagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaag
atctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttattcttctact
gtacctgtctttaatcctgactggcaaactccctcttttcctaacattcatttgaaagaggatattattaatagatgtca
acaatatgtaggccctcttacagttaacgaaaaacggagattaaaattgattatgcctgctaggttctatcctaactgta
ccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagttaatcattacttccaaactagacat
tatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcctcattttgtgggtcaccata
ttcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctttctgttccc
aatccgctgggattctttcccgatcaccagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaa
ccccaacaaggatcaatggcccgcggcacaccaggtaggagtgggatccttcgggccagggttcactccaccacacggca
atcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctcctcctgcctccaccaatcgg
cagtcaaggagacagcccactcccatctctccacctctaagagacagtcatcctcaggccatacagtggaa
>gnl|hbvnuc|KC774196_FT00000_P-C Feature FT:source KC774196_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2015). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcactcacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcgactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattgggagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttagaaaattgcct
gtaaatagacctattgattggaaagtttgtcaaagaattgtgggtcttttgggctttgctgccccctttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtttctcccaagtgtttcatgactcaaccccc
actggatgggggttgcccataggccatgggggcatgcgaggaacctttgtggctcctctggcgctccatagtgtggtact
cctagcagcttgttttgattgcagccggtttggggcgaaagttatcggcacggacaaatatgttgtcctctctaggaaat
acacctcctttccatggaatacagggtgtgttgccaactggatcctgcgggggacgtcctttgtctacgtcccgtcgccg
ttgaatcccgcggacgacccgtgtcggggccggttggggctttacggtcccctttgttgtttgccgttccgactgaccat
ggggcgcacctctctatccggggactccccgtttgtgccgtgtcatcccccggaccgtgtgcacttcgcttcacctgtgc
acgttgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactagtggactctcagcaa
ggttaacgaccgaccttgaggcatacttcaaagcctgtgtatttaaggaatgggaggagttgggggaggagagtaggata
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcttaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatccggaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttctccccacctcacggcggtgttttggggtggagccctcaggctcagggcatattggcaacagtgccagcagca
cctccttctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB014378_FT00000_P-C Feature FT:source AB014378_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 19Y01HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgttagatcccaaagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagaaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagaggctagactcgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtcggtacaacatcgtgagtccctttttacckctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggcagttggggtactttaccacaggaacatattgtccaaaaactcaagcaatgttttcggaaattgcct
gtaaatcgacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatatctgcacctttaccccgttgcacggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcgggactgacaattctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctgactctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaagtcttgcccaaggtcttatataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacgtttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccccttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggaggtcttttggggcggagccctcaggctcaaggcatattgacaacagtgccagcggcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|EU871969_FT00000_P-C Feature FT:source EU871969_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6-024-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggagtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctct
tcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaatttcctgttgtctttgggcatacatttgaaccctaacaaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacacattgtactaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccctaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcacagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctacggttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcaccatacagcactaaggcaagagattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtacttgagtatttggtgtcttttggagtgtggattcgcactcctcttgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcccaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
caggggtcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148521_FT00000_P-C Feature FT:source KP148521_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y26-2-24). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcgaggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattctctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggccttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacacattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatgtgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagcggcaaaccaggtaggagtgggacccttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377526_FT00000_P-C Feature FT:source GQ377526_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J27). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctactagaccccagagtgaagggcctatactttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctactaaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtattgaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaaagcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tctgtaaacaatatatgaacctttaccccgttacccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
atgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcagctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggatgagactaggtta
atgatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaagcagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaagactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggatcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatatcgacaacggtgcctgtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ040154_FT00000_P-C Feature FT:source JQ040154_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G181). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccrgttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcactgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgwcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaycaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgatgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactgaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggaraccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcwgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatyctg
tgttggggtgagttgatgaatytggccacctgggtgggaagtaatttggaagayccagcatccagrgaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccmtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggckggcattctatataagagagaaactacacgcag
ygcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttctcaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggactwcwaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcggtc
cagggttcaccccaccacacggcggtcttttggggtgaagccctcaggctcagggcctattgacmacmgtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatcttgccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439342_FT00000_P-C Feature FT:source MZ439342_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN216-2004-Quasi-11). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtcattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtgggagtaggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccacgcagtggaa
>gnl|hbvnuc|GQ475350_FT00000_P-C Feature FT:source GQ475350_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR46HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctctgggtatacatttaaaccctaataaaaccaaacgttggggttaytcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactcaagcaatgttttcggaaactgcct
gtcaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacatccttcccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcaactgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttcttcccttctattcgagatctcctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctaccgtacctgtctttaatcctgagtggcaaaccccctcctttcctaacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttactaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacactatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcttcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcaaggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ410495_FT00000_P-C Feature FT:source KJ410495_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK_1324). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacacacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaactaaacgttggggctactcccttaacttcttgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacgggcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcattggcaccgacaactctgtcgtccttgctcggaaat
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgccccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcctgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaaatggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcctccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctcttacagtcaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctatggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatcttgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881744_FT00000_P-C Feature FT:source KY881744_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate control-02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccattcttctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggtaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774259_FT00000_P-C Feature FT:source KC774259_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1061). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcgaaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaattctgaatggcaaactccctcatttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctaccctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ410489_FT00000_P-C Feature FT:source KJ410489_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1202). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccagcactttccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaaaaatgttttcggaaacttccc
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttggggtttgccgctccctttacacaatgtgg
ttacccagcattaatgcctctgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctggacctttaccccgttgctcggcaacgggcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcattggcaccgacaactctgtcgtccttgctcggaaat
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgccccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcctgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttccattcgtgatctcctcgacaccg
caactgctttgtatcgggaggccttagagtctccggaacattgttcagctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagagaattagtagtagg
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacctttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctccaccttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtgttttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatcttgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534647_FT00000_P-C Feature FT:source MK534647_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D481). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcgggtctttgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatactttaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattggtagtgag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctaacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtatcttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377620_FT00000_P-C Feature FT:source GQ377620_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J197). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggtctatatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttctggtgggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatcatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgctggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtactgaaactcaagcaatgttttcgtaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactattggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggaccttgacccatataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttggagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaagcagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatctcctgtcttacttttggaagagaca
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtattccacacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcattcgggc
caggattcaccccaccacacggcggtcttttggggcggagccctcaggctcagggcatgttaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KT366464_FT00000_P-C Feature FT:source KT366464_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C-EICI.29). Complete genome. [Hepadnaviridae] (length=3209 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatatgctggtggctcaagttccggaacagtaa
accctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggagagcacc
acatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagag
tctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacct
ccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcctc
ttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttcc
aggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccctcttgtt
gctgtacaaaaccttcggacagcaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggag
tgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttg
gctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaa
ttttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggttactcccttaacttcatgggatatg
taattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcctataaat
aggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtggttaccc
agcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgta
aacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaactcccactggt
tggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagc
agcttgttttgctcgcagccggtctggggcaaaacttatcggcactgacaactctgttgtcctctctcggaaatacacct
cctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaat
cccgcggacgacccatctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccgaccgaccacggggcg
cacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcg
catggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaa
cgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatc
tttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctca
tgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataaagaatt
tggagcatctgcggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccgcctctg
ctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattttgtgttgg
ggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaagctatgt
caatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaactgttc
ttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatcttatcaaca
cttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
atcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttact
gggctttattcttctactatacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaaagagga
tattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgcctgcta
ggttctatcctaaacttactaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatacagttaatcat
tacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcagtgcctc
attttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatgggg
acgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccagcgttcagagccaattcaaacaa
tccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcggtccagggt
tcactccaccacacggcagtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagcgcctcct
cctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccat
gcagtggaa
>gnl|hbvnuc|KY881805_FT00000_P-C Feature FT:source KY881805_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaatctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagacttgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactaaccaaccttttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgccatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaagaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggtctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgcacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtgctgaaaatcaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacctacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggcctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgcttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggggaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatactccaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccgtataa
agaatttggagcttctgtggagttactctcatttttgccttctgacttctttccttctactcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccatcaaatgcccctatctta
tcaacacttccggaaactactgttgttagatgccgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcactatttacatacgctgtggaaggcaggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU051427_FT00000_P-C Feature FT:source KU051427_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MMHBV002). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgatgcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactccctccacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcgcaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagctgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcatcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT645026_FT00000_P-C Feature FT:source MT645026_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB13). Complete genome. [Riboviria] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggatactcccttaacttcatgg
gatatgtaattggaagttggggtacattaccgcaggaacatattgtactaaaaattaagcaatgtttccgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgctccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttt
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctcgcagcttgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagccccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgatggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttaccgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcgcaatcctctgggattctttcccgatcaccagttggaccctgcgtttggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
ccgggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439582_FT00000_P-C Feature FT:source MZ439582_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2019-Quasi-3). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgtttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgactggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattgatcatgc
ctgctaggttttatcctaaacgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttggcgatcaccagttggacccggcattcagagccaattc
aaacaatccagattgggaccgcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcgtgttgacaacagtgccagcggcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF873526_FT00000_P-C Feature FT:source KF873526_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 040_K_Laj). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcctcagcattccatcaagctctacaagatcccagagtaaggggtctgtattttcctgctggtggctccagttccggaa
cagtaagccctgttcagaatactgtctctcacatctcatcaatcttcacgaagactggggaccctgctacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgataactgctcaaggaacctctatgtttccct
catgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgccgggctttcccccac
tgtttggctttcagttatatggatgacatggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctctgggcatacatctaaatcctcacaaaacaaaaagatggggttattcccttaacttcatgg
gatatgtaattggtagctggggaagcttaccacaagatcatattgtacaaaaaatcaaacactgttttagaaaaatacct
gttaataggcctattgactggaaagtgtgccaaagaattgtgggtctcttgggttttgctgccccttttacacaatgtgg
ttttcctgccttgatgcctttgtatgcatgtatacaagctaagcaggcttttagtttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcggggaacctttgtgtctcctctgccgatccatactgcggaact
cctagcagcctgtttcgctcgcagccggtctggagcgmaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgccgacgacccttctcggggccgcttgggactttaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
rcgtcgcatggagaccaccgtgaacacccacctgatcttgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
awgrtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttcagtggagttactctcttttttgccttctgatttctttccgtctattcgagatctcctcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggcgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatctagagaattagtagtaag
ttatgtcaatgttaatatgggcctaaaaattcgacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcctttggagtgtggattcgcactcctmccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctgatattcatttacg
ggaggacattatcaataggtgtcaacaatacgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctacccttaccaaatatttgcccttggacaaaggcattaagccttattatcctgaacatgcagtt
aatcattacttcaagactaggcattatttacatactctatggaaggctggtattctatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcttccaaacctcgcaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagcccgcaggcccagggcatattgacaacagtgccagcagcg
cctcctcctgcctccgccaatcggcagtcaggaagacagcccactcccatatcaccacctctaagagtcactcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963878_FT00000_P-C Feature FT:source KU963878_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggagcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtacaaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctctgacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacctcaccaaatatttgcccttggataaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaacac
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG826140_FT00000_P-C Feature FT:source MG826140_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate YNKM40). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctaggtcccaaagtgaggggcctagaccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaaccaagagatggggctactcccttaacttcatgg
gatatgtcattggaagttggggtaccttaccacaggagcatattgtagaaaaaatcaaacaatgtttccgtaaacttcct
gttaatagacctattgattggaaggtatgtcaacgcattgtgggtcttttaggctttgctgccccttttacacaatgtgg
gtatccagccttgatgccgttgtatgcttgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgcaaacaatatcttaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggggcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtattgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacgtgtataa
agaatttggagcttctgtggagttactctcatttttgccttctgatttctttccatctattcgagatctcctcgacaccg
cctcagctttatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttagaagatccagcatccagggaattagttgtcgg
ttatgtcaatgttaatatgggcataaaacttagacaactattgtggtttcacatctcctgtatcacttttggaagagaaa
ttgtacttgagtatttggtgtcttttggagtgtggattcgcacccctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaccacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggacattatcaccagatgccaacaatttgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctacccttactaaatatttgcccttggataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaagccaggcattatttacatactctgtggaaggcgggtattttatataggagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggcccgtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaatcccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939651_FT00000_P-C Feature FT:source EU939651_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D104). Complete genome. [Hepadnaviridae] (length=3215 residues).
caccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacaacaactaccagcacgggaccatgcaagacctgcacgactcctgctcaagggacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcccaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaaacctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcaacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagacctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcac
ctatgtcaatgttaatatgggcctaaaactcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtgaacaatatgtaggccctcttacagttaatgaaaaaaggagattacaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttacccttggacaaaggcattaaaccgtattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcgaatcaggtaggaacgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964343_FT00000_P-C Feature FT:source KU964343_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 38_10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctgtactttcctgctggtggctccagtttcggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctcgactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattgactgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
agggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacagcactcaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagacaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctccttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggacgaatcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcaaattcatttaca
tgaggacatcattaatagatgtcagcaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccaatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470873_FT00000_P-C Feature FT:source KY470873_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaaggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttaggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgagcctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctactgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactatggtggtttcacatttcctgtcttacgtttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670261_FT00000_P-C Feature FT:source AB670261_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.25). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcaccaatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcacttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtgcaaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggacattgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaagaactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctgttcgagatctcctcgacaccg
cctcagctctgtatcgggaggccctagagtctccggaacattgttcacctcaccatacagcaatcaggcaagctattctg
tgttgggttgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctacggtacctgtctttaatcctgattggcaaactccctcctttcctcatattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattaccctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacatcaaacctcgacaaggcatggggacgaatctttct
gttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagccctcaggctcagggcatattgaccacagtgccagcagcgcctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AY220702_FT00000_P-C Feature FT:source AY220702_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccaacacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttgacaagattccta
tgggagtgggcctcaatccgtttctcctgactcaatttactagtgccatttgttcaatggttcgtaaggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttgtgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctacccccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtattaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
ccgctgctctgtatcgggaggccttagattctccggaacattgttcacctcaccatacagcactcaggcaagctattcag
tgttggggtgaggtgatgaatctggccacctgggtgggaagtaatttggacgacccagcatccagggaattagttgtcag
ctatgtcaatgttaatatgggcctaaaaatgagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcctttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacccttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcctctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattgaaattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacgaatctttct
gttcccaaccctctgggattctttcccgatcaccagttggaccctgcattcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcacctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MZ439635_FT00000_P-C Feature FT:source MZ439635_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BO129-2019-Quasi-12). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacctttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaaaatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttgtcctct
aattccaggatcatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttatctttgggtatacatttgaaccctaataaaaccaagcgttggggctactccctaaacttcatgg
ggtatgtaattggaagttggggtaccttgccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgctccttttacacaatgtgg
ttatcctgccttactccctttgtattcatgtatacaagctaagcaggcttttactttttcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctaaccaggtcttgcccaaggtcttatataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggaattgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaagatcagacaactattatggtttcacatttcttgtcttacttttggaagagaaa
cggttcttgagtatttggtgtccttcggggtgtggattcgcacaccccccgcatacaggccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcttcaatcctgaatggcaaactccctcttttcctgatatacatttgca
ggaagacattattaatagatgtcaacaatttgtgggccctctaaatgcaaatgaaaaaaggagattaaagctaattatgc
ccgctagattttttcctaaccttaccaaatatttgccattggataaaggtattaaaccttattatcctgaacattcagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagagagaaactacacgcag
tgcatcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcctcaaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcctgcccgaccatcagttggacccggctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggc
cagggttcaccccaccgcacggcggtcttttgggttggagcccgcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB113876_FT00000_P-C Feature FT:source AB113876_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttaggctttgctgccccatttacacaatgtgg
ctatcctgccttgatgcccttatatgcatgtatacaatcgaaccaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctgtcaagtgtttgctgacgcaaccccc
actggctggggcttggcaataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactcagttgtcctctctcggaaat
acacctcatttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcgtttatgccttctgacttctttccttctattcgagatctcctcgataccg
cctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattaggcaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggcaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
gatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggttttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaagccagattgggacttcaaccccaacacggatcactggccggaggcgaatcaggtaggagcgggagcattcggtc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470878_FT00000_P-C Feature FT:source KY470878_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttaggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacactg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacaggccaccaaatgcccctatctta
tctacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439374_FT00000_P-C Feature FT:source MZ439374_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN216-2007-Quasi-14). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatctttggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtcattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagcaaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtaggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670278_FT00000_P-C Feature FT:source AB670278_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattcctccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaaatcaagcaatgttttaggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccayactgcggaact
cctagcagcttgttttgctcgcagctggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
atgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaraccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatatttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctttggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctc
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaactagtagtcag
ctatgtcaatgttaatatgggactaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacattaccaaatatttgcccttggataaaggcattaaaccttattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagcgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|AY206382_FT00000_P-C Feature FT:source AY206382_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttcttctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaactttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggcttcgctgccccttttacacaatgtgg
ctatcccgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggagcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcatctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccacacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccctgcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaagaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtactatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattcttccccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccaaaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacgcggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ089758_FT00000_P-C Feature FT:source DQ089758_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1733). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactattgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaaaatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtccaccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctgctaaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
acaaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatagrccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactgatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaagtcttgcccaaggtcttacataagaggactcttggactctcaacaa
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccytctattcgtgatctcctcgacaccg
cctctgctctgtatcgrgaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctcccgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcagcaatatgtaggccctcttaccgttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccgtaccaaatatttgccattagataaaggcattaaaccttattatcctgatcacctagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatcttgctgttcccaatcctctgggattctttcccgatcaccagttggaccttgcattcagagccaatac
aaacaatccagattgggacttcaaccccaacaaggatccatggccagaggcayggcaggtaggagcgggatccttcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctccttctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|GQ924658_FT00000_P-C Feature FT:source GQ924658_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M95). Complete genome. [Hepadnaviridae] (length=3209 residues).
cacattccaccaagctctgctaggtcccagagtgaggggcctatattttcctgctggtggctcaagttccggaacagtaa
accctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcacc
acatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagag
tctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacct
ccaatcactcaccaacctcttgtcctcaaatttgtcctggttatcgctggacgtgtctgcggcgttttatcatcttcctc
ttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttcc
aggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgtt
gctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggag
tgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttg
gctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctattaccaa
ttttcttttgtctttgggcatacatttaaaccctaataaaaccaaacgttggggctactccctgcacttcatgggatatg
taattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacagtgttttcggaaacttcctataaat
agacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgggtaccc
agcattagtgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgta
aacaatatctgaacctttaccccgttgctcggcaacggtcaggtctgtgccaagtgtttgctgacgcaacccccactggc
tggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaactcctagc
agcttgttttgctcgcagccggtctggagcgacacttatcggcactgacaactctgttgtcctctctcggaaatacacct
cctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaat
cccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccattccagccgaccacggggcg
cacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcg
catggaaaccaccgtgaacgcctgccaggtcttgcccaaggtcttacataagagaactcttggactctcagcaatgtcaa
cgaccgaccttgaggcgtacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattcggttaatgatc
tttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctca
tgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatt
tggagcttctgtggagttaatctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctg
ctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctgtgttgg
ggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaagctatgt
caatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaaaagaaactgttc
tagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatcttatcaaca
cttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctca
atcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttact
gggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctaacattcatttgaaagagga
tattatcaacagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattggttatgcctgcta
ggttctatcctaacattaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagttaatcat
tacgtccaaacgaggcattatttacatactctgtggaaggctgggattttatataagagagaaactacacacagcgcctc
attttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatgggg
acgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcgttcggagccaattcaaacaa
tccagattgggacttcaaccccaacaaggatcaatggccagaagcaaaccaggtaggagtgggatcattcgggccagggt
tcacaccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcgcctcct
cctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccac
gcagtgggg
>gnl|hbvnuc|KJ598647_FT00000_P-C Feature FT:source KJ598647_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB2S3). Complete genome. [Hepadnaviridae] (length=3197 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctaccctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcttttc
tttgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctcccggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtctgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcttgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacgaatctttct
gttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagccctcaggctcagggcatattaacaaccgtgccagcagcacctcctcctgcctccacc
aatcggcagtcaggaagacagcccactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU964240_FT00000_P-C Feature FT:source KU964240_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 30_12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcaccaagctctactagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgattccct
cttgttgctgtacaaaaccttcggacagaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcacggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcactaggccatcagcgcctgcgtggaacctttgtggctcctctgccgattcatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggtcgtttggggctctaccgtccccttctgtgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtataggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctgctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtaag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctctcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtgcctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattatcgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctcggttcccaatcctctgggattctttcccgatcaccagttggatcctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU306727_FT00000_P-C Feature FT:source EU306727_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcacaaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggcccagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgctggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtactgaaactcaagcaatgttttcgtaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcacagccggtctggagcaaaacttatcggcaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcctaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggccttggggcatggacattgacccatataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttcttcccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctactctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatctcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaaccctgactggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacgaatctttct
gttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagcacctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MT645031_FT00000_P-C Feature FT:source MT645031_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB19). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctattcccttaattttatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtctattgggctttgccgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcacccgcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagacctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgagcatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439702_FT00000_P-C Feature FT:source MZ439702_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2013-Quasi-8). Complete genome. [Riboviria] (length=3200 residues).
ctccaacacattccaccaagctctgctagatcccagagttcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggccaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataaagaatttggagcttc
tgtggagttaatctcttttttgccttctgacttctttcctaatattcgtgatctcctcgccaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttgaacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctattgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactattgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttat
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagagaagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatccgctgggattctttcccgatcaccagttggacccggcattcagagccaattcaaacaatcccgattg
ggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ386689_FT00000_P-C Feature FT:source FJ386689_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1649). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccctgcaagacctgcacgaatcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaaaaatgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttgtatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcggggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttataggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcatttatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagtcgggggaggagattaggtta
atgatctwtgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccgctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactattgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactcccacttttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatacgctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcaggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475347_FT00000_P-C Feature FT:source GQ475347_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR43HCC). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccacttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtaatgaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacagtgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactcggttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatttttaatcctgaatggcaaactccctcctttcctaacattcatttaca
tgaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaacctcaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgaaaaggcatggggacgaatctttct
gttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagctcctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|MZ439296_FT00000_P-C Feature FT:source MZ439296_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BL71-2019-Quasi-7). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctataccatcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttcttgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttctatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
actaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgccgttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccagggctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatagcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaagtcttgcccaaggtcttacataagagaactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgaagacttctttccttccgttcgtgatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccacacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaattagtagtacg
ctatgtcaacgttaatatgggcctaaagttcagacaactattgtggtttcacatttcctgtcttacttttggacaacaag
ttgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaccacgaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatttgtaggccctctcacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatattctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccccacggcaacattttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctacgcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|EU498227_FT00000_P-C Feature FT:source EU498227_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JL). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccacaaagctctgctagatccccgagtgaggggcccatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgatgactggggaccctgcaccgaatatggag
agcaccacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaaaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttctatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttgtcctct
acttccaggaacaacaactaccagcaggggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaactttcggacgcaaattgcacttgtattcccatcccaacatctggggctttcgcaaaattccta
tgggggtcggcctcagtccgtttctcctggctcaattcactagtgccatttgttcagtggttcgaagagctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaagccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaacactaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtactaaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgcagctccttttacacaatgtgg
ttacccagcattaatgcctttgtatgcctgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaacctcatcggcactgacaactccgtcgtgctctctcggaaat
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcagagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggctttagagtctccggaacattgctcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaagatccagcatccagggaatcagtcgtaac
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagacaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccccttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaaccccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacagtatgtgggccctcttacagttaatgaaaaaagaagattgaaactaattatgc
ctgctaggttctatcctaaactgaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaaccacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccagtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctccggctcagggcatattgacaaccgtgccagcagcg
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccaccactaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|GQ377538_FT00000_P-C Feature FT:source GQ377538_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J52). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagtttcggaa
cagtacaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctgatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagcgaattgtgggtctgttaggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agagtttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttcctgaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagactaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcccttggacaaaggtattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ410518_FT00000_P-C Feature FT:source KJ410518_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Occult_HK313). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcagtcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtgtgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcgtgaagccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaaccggtcttgcccaaggtcttacataagaggactattggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactagatta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgccttgtatcgggaggccctagagtctccggaccattgttcagctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaattagtagtaaa
ctacgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaaccgcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatctcttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963917_FT00000_P-C Feature FT:source KU963917_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 9_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctccaattccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaaacacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgctccgtttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagct
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaatgttgatatgggcctaaaacttagacaactactttggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattgaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacacgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963996_FT00000_P-C Feature FT:source KU963996_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 14_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccatttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcatcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactattgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
agaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagcg
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964024_FT00000_P-C Feature FT:source KU964024_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 16_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacgttccaccaagctctgctagatcccagagtgaggagcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtgattgggagttggggtactttaccacaggaacacattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatcttaacctctaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccccttctgagtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagagaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactatacctgtctttaatcctgaatggcaaactccctcctttcctcacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttactatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccacacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatactgacaacagtgccagcagcg
cctcctcctgccaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ315781_FT00000_P-C Feature FT:source DQ315781_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate EI0398). Complete genome. [Hepadnaviridae] (length=3212 residues).
ctccagcacattccaccaggctctactagatcccagagtgaagggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaacccgaataaaaccaaacgttggggctactcccttaacttcatgg
gatacgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaaggattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtattcaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctttatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtggtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacctttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaatacatagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacatggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtg
>gnl|hbvnuc|EU939593_FT00000_P-C Feature FT:source EU939593_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C144). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaagcgttggggctactctcttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactgaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgccgttatatgcatgtatacattctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaacttatcggcaccgacaactcagttgtcctctcgcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttacaaaatatttacccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattcttccccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439621_FT00000_P-C Feature FT:source MZ439621_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BO129-2007-Quasi-21). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacatttcatcaagctctgttagatcccagagtaaggggcctataccttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaaaatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagaggctagactcgtggtggacttctctcagttttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgtaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactccctaaacttcatgg
ggtatgtaattggaagttggggtaccttgccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgctccttttacacaatgtgg
ttatcctgccttactccctttgtattcatgtatacaagctaagcaggcttttactttttcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaagt
acacctcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctaaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgttcatatcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaagatcagacaactattgtggtttcacatttcttgtcttacttttggaagagaag
tggttcttgagtatttggtgtcctttggggtgtggatccgtacaccccccgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctaggtctcgggactctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgttcctgtctttaatcctgagtggcaaactccctcttttcctgatatacatttgaa
ggaggacattattgatagatgtcaacaatttgtgggccctcttaatgtaaatgaaaaaagaagattgaagttaattatgc
ctgctagattttttcctaaccttaccaaatatttgcccttagataaaggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcaaaacctcggaaaggc
atggggacgaatctgtctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttgggttggagcccgcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|KU964216_FT00000_P-C Feature FT:source KU964216_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 29_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatccaagagtgaggggcctatatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcgtgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctaacattcatttaca
ggaagacattattgagagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX765823_FT00000_P-C Feature FT:source KX765823_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PID:0274). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatctaaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggagcatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtaggtcttctgggctttgccgctccttttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggtcatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgtcgtgctctctagaaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctactcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctggagtatttggtctcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacctgaccaaatatttgcccttagataaaggcataaaaccttattatccggaacatacagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaaccacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcacattaacaacagtgccagcagcg
cctcctcctgcctccgccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT645009_FT00000_P-C Feature FT:source MT645009_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GX3). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacattccatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatccggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaacacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaagcgttggggctactccctcaatttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtgcaaaaaattaagcaatgttttcgtaaactacct
gttaatcgacctattgattggaaagtatgccaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgcattactacctttgtatgcatgtatacaggctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacagtatctgaccctttaccccgttgccaggcaacggccaggcctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcaaaactcatcggaaccgacaactctgttgtcctctctcgaaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggtcgcttggggatatatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aagatttatgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcacgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctgttcgggatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcgcctcaccatacagcactcaggcaagctattgtg
tgttggggtgaggtaacgaatttggccacttgggtgggtggtaatttggaagatcaagcatccagggaattagtagtcag
ctatgtcaatgataacatgggactaaaaatcaggcaactgttgtggtttcatatttcttgtctcacttttggaagagaaa
cggttcttgagtacctggtgtccttcggggtgtggattcgtacaccccccgcatataggccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctaatgtacctgtctttaaccctgagtggcaaactccctcttttcctgatatacatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttactgtaaatgaaaaaaggagattatcgttaattatgc
ctgctagattttttcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttgcccgaccatcagttggacccggctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcttggaaggtaggagctggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagggacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB074756_FT00000_P-C Feature FT:source AB074756_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th55). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcgaaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcacagccggtctggagctaaacttatcggcaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtatttacagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctttgtatcgggaggccttagaatcttcggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttactttcggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
ggaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttacccctagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacactatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377554_FT00000_P-C Feature FT:source GQ377554_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J85). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacgacattccaccaagctctgctagatccaagagtgaggggtctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggcttttactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctcgcagcttgttttgctcgcagccggtctggggcgaaactcatcggaaccgacaactctgttgtcctctcccggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX765844_FT00000_P-C Feature FT:source KX765844_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PID:1157). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgagaggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacgcaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccagatcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctcagctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttttagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactcccttttttcctcacattcatttgaa
agaggacattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagactaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttgcatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccccacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctc