HBVdb

Dataset for nucleotide sequence Genomes of genotype C

[Download (right click)] [Alignment] [Repertoires]

3062 sequence(s)

>gnl|hbvnuc|AB670288_FT00000_P-C Feature FT:source AB670288_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.15). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaastcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcgcaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagaataggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattstc
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcrg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtataccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU306674_FT00000_P-C Feature FT:source EU306674_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3206 residues).
ctccacaacatttcaccaagctttgctagatcccagagtgcagggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagcccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaaacaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgtcgtcctctctcggaaat
acacatcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgttgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaccttt
gtactaggaggctgtaggcataaactggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgt
tcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataaagaatttgg
agcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcgtcgacaccgccactgctc
tgtatcgggaggccttagagtctccggaacattgttcgcctcaccatacagcactcaggcaagctattgtgtgttggggt
gagttgatgaatctggccacctgggtgggaagcaatttggaagacccagcatccagggaattagtagtcagctatgtcaa
tgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaactgttcttg
agtaattggtgtcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatcttatcaacactt
ccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatc
gccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactggg
ctttattcttctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcatttacaggaggacat
tattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgctagat
tctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagttaatcattac
ttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcagcgcctcatt
ttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacg
aatctttctgttcccaatcctctgggattctttcccgatcaccagttgggccctgcgttcggagccaactcaaacaatcc
agattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttca
ccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagcacctcctcct
gcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgca
gtggaa
>gnl|hbvnuc|EU306687_FT00000_P-C Feature FT:source EU306687_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgactggaaagtatgtcaaagacttgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagcaggtctggagcaacactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtcccggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagcctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggacattatcaccagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatgctctgtggaaggcgggtattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatagtgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU498227_FT00000_P-C Feature FT:source EU498227_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JL). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccacaaagctctgctagatccccgagtgaggggcccatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgatgactggggaccctgcaccgaatatggag
agcaccacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcaaaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttctatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactacaaaggtatgttgcccgtttgtcctct
acttccaggaacaacaactaccagcaggggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaactttcggacgcaaattgcacttgtattcccatcccaacatctggggctttcgcaaaattccta
tgggggtcggcctcagtccgtttctcctggctcaattcactagtgccatttgttcagtggttcgaagagctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaagccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaacactaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtactaaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgcagctccttttacacaatgtgg
ttacccagcattaatgcctttgtatgcctgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaacctcatcggcactgacaactccgtcgtgctctctcggaaat
acacctccttcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcagagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggctttagagtctccggaacattgctcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaagatccagcatccagggaatcagtcgtaac
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagacaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccccttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaaccccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacagtatgtgggccctcttacagttaatgaaaaaagaagattgaaactaattatgc
ctgctaggttctatcctaaactgaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaaccacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccagtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctccggctcagggcatattgacaaccgtgccagcagcg
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccaccactaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|EU939657_FT00000_P-C Feature FT:source EU939657_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D139). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactctacttttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgaggccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagtgggggtactttaccgcaagaacatattgtacaaaaaattaagcaatgttttagaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggcttcgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgaccactataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagctctcaggcaagctattatt
tgttggggtgagttgatgaatctggccacctgggtgggaggaaatttggacgacccagcatccagggaagcagtagtcaa
ctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagaacaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcaggcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaattccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctctcacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgtcccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagctttcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562292_FT00000_P-C Feature FT:source FJ562292_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I164). Complete genome. [Hepadnaviridae] (length=3215 residues).
ccccaccacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctagcacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatatatctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgttcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggagct
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacctatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagatgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacattaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggcccgaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|FJ899777_FT00000_P-C Feature FT:source FJ899777_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C127-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacacattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaggtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcaaaacttatcggaactgacaactctgttgtactctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcaacaa
tgtcaacgaccgaccttgaggcatacttcatagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcgtccgtggagttactctcttttttgccttctgacttctttccttctattcgagacctcctcgacaccg
cctcagctctgtatcgggaggccctagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccatcctttccttacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcgccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatccctggccagaggccaatcaggtaggagcaggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggaaccctctggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377571_FT00000_P-C Feature FT:source GQ377571_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J112). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaggctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttatcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
caccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaccatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtgtctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcttctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtcaccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttagaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatcctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475334_FT00000_P-C Feature FT:source GQ475334_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR30LC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtggggctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaaatcaagcaatgtttccgtaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctaccctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaaacatttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctcattcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacagcactcaggcaagctattctg
tgttggggcgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattattttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcaaggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JF828911_FT00000_P-C Feature FT:source JF828911_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ES69-9). Complete genome. [Hepadnaviridae] (length=3182 residues).
caccacaacattccaccaagctcctgctggtggctccagttcaggaacagtaaaccctgttccgactactgcctctccca
tatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcacaacatcaggactcctaggacccctgctc
gtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaa
ttttctagggggagcacccgcgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtcctc
caatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatcttc
ttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacgggacc
atgcaaaacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaaact
gcacttgtattcccatcccatcatcatgggctttcgcaagattcctatgggagtgggcctcagtccgtttctcatggctc
agtttcttagtgccatttgttcagtggttcgcagggctttcccccattgtttggctttcagttatgtggatgatgtggta
ttgggggccaagtctgtacaacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtatacattt
gaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaagttggggtactttaccac
aggaacatattgtacaaaaactaaagcaatgttttcggaaactgcctgtaaatagacctattgattggaaagtatgtcaa
aggattgtgggtcttttgggctttgctgccccttttacacaatgtggctatcctgctttgatgcctttatatgcatgtat
acaatctaagcaggcttttactttctcgccaacttacaaggcctttctgtgtaaacaatatctgcacctttaccccgttg
cccggcaacggtcaggtctctgccaagtgtttgctgacgcaacccccactggatggggcttggccataggccatcggcgc
atgcgtggaacctttgtggctcctctgccgatccataccgcggaactcctagcggcttgttttgctcgcagccggtctgg
agcgaaacttatcgggactgacaactctgttgtcctctctcggaaatacacctccttcccatggctgcccggatgtgctg
ccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggccgt
ttggggctctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctctctttacgcggtctccccgtc
tgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtgaacgcccacca
ggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgaccttgaggcatacttcaaag
actgtttgtttaaggactgggaggagttgggggaggagactaggttaatgatctttgtactaggaggctgtaggcataaa
ttggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgtcctactgttcaagcctcc
aagctgtgccttgggtggctttggggcatggacattgacgcctataaagaatttggagcttctgtggagttactctcttt
tttgccttctgacttctttccttctattcgagatctccttgacaccgcctctgctctgtatcgggaggccttagagtctc
cggaacattgttcacctcaccatacagcactcaggcaagctattctgtgttggggtgagttgatgaatctggccacctgg
gtgggaagtaatttggaagacccagcatccagggacttagtagtcagctatgtcaatgttaatatgggcctaaaactcag
acaactattgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggagtgt
ggattcgcactcctcccgcttacagaccaccaaatgcccctatcttatcaacacttccggaaactactgttgttagacga
cgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatc
tcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttattcttctactgtacctgtc
tttaatcctgagtggcaaactccctcctttcctaacattcatttacaggaggatattattaatagatgtcaacaatatgt
gggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgctaggttctatcctaaccttaccaaatatt
tgcccttggataaaggcataaaaccttattatcctgaacatgcagttaatcattacttcaaagctaggcattatttacat
actctgtggaaggctggcattctatataagagggaaactacacacagcgcttcattttgtgggtcaccatattcttggga
acaagagctacagcatgggaggttggtcttccaaacctcgaaaaggcatggggacgaatctttctgttcccaatcctctg
ggattttttcccgatcatcagttggaccctgcgttcggagccaactcaaacaatccagattgggacttcaaccccaacaa
ggatcattggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccacctcacggcggtcttttgg
ggtggagccctcaggctcagggcacattgacaacagtgccagcagcgcctcctccttcctccaccaatcggcagtcagga
agacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|JQ801502_FT00000_P-C Feature FT:source JQ801502_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CONTROL9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcatcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccccaataaaaccaaacgttggggatactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatccaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagctaaacttatcggcaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcaccatacagcactaaggcaagctgttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcccaaccttaccaaatatttacccctagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacactatttacatactctgtggaaggctggtattttatataagagagaaactacacgaag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattccggc
cagggttcactccaccacgcggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcccca
ggccatgcagtggaa
>gnl|hbvnuc|KC875272_FT00000_P-C Feature FT:source KC875272_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV64). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccacttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtccgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaaccttttcggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgacgttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattactttcaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatatttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcggac
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598730_FT00000_P-C Feature FT:source KJ598730_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB617). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactcccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgattccct
cttgttgctgtacaaaaccttcggacagaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcacggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcactaggccatcagcgcctgcgtggaacctttgtggctcctctgccgattcatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgattggggctctaccgtccccttctgtgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgtgatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtaag
ctatgtcaatgttaatatgggcataaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattatcgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963903_FT00000_P-C Feature FT:source KU963903_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8_4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcatcaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcatcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaacgttggggctactctcttaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgacttgtgggtcttctgggctttgctgccccttttacgcaatgtgg
ttatcccgcattaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggcactaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtgttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgcgtggcaaactccctcctttcctcacattcatttgca
ggaagacattatcaatagatgccaacaatatgtgggccctctcacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcgtaccaaatattggcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggtgttctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtctgccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccattactccacctctcagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964218_FT00000_P-C Feature FT:source KU964218_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 29_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcgtgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagactaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|KJ410493_FT00000_P-C Feature FT:source KJ410493_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK_1204). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagcactgttagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaaccttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcaccaacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggcatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgaacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctgctaaaactaaacgttggggctactgccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacataaaatcaaacaatgttttcggaaacttcct
acaaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacccttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttataggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgtgatcttctcgacaccg
cctctgctctgcatcgggaggccttagagtctccgggacattgttcacctcaccatacagcactaaggcaagctatagtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccggcatccagggaattagtagtaag
ctatgtcaacgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttagtattccttggacccataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccgtaccaaatatttacccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaaccgcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactcccccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MH818373_FT00000_P-C Feature FT:source MH818373_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Hiroshima GtC CL3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggatactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctc
tgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggacgacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttactttcggaagagata
cggttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatccaaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcatactccctcctttcctaacattcatttaaa
ggaagacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcatcagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439594_FT00000_P-C Feature FT:source MZ439594_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2019-Quasi-15). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgtttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaagaagattaaaattgatcatgc
ctgctaggttttatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AJ748098_FT00000_P-C Feature FT:source AJ748098_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient Z1). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcacctcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctgctaaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtacattaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaacgaatcgtggggcttctgggcttcgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaggctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattctcggcaccgacaactctgtggtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtcgcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctcgccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggctaactccctcttttcctaacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccccctcacagttaacgaaaaaaggagattaaaattgatattgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacgaatctttct
gttcccaatcctctgggattctttcccagtcaccagttggaccctgcattcagagccaattcaaacaatccagattggga
cttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggccagggttcactccaccac
acggcaatcttctggggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU964026_FT00000_P-C Feature FT:source KU964026_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 16_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacgttccaccaagctctgctagatcccagagtgaggagcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagataccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtgattgggagttggggtactttaccacaggaacacattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccgtaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatcttaacctctaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccccttctgagtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagagaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactatacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttactatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccacacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatactgacaacagtgccagcagcg
cctcctcctgccaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964341_FT00000_P-C Feature FT:source KU964341_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 38_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctattagaccccagagtgaggggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctcggggaagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggcactttaccgcaagaacatattatattaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggacatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgtttcgctcgcagccggtctggagcgaacattattggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataaaaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagctctcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcaaattcatttaca
tgaggacatcattaatagatgtcagcaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacaagcag
cgcctcattttatggggtaccatattcttgggaacaagagctacagcatgggaggttggtcctccaaacctcgacaaggc
atggggacgaatctgtctgttcccaatccgctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggccttttggggtggagccctcaggctcagggcatattgacaacagtgccagtaaca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctgagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU306694_FT00000_P-C Feature FT:source EU306694_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3206 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagacttgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagcaggtctggagcaacactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtcccggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggtta
atactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgt
tcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttgg
agcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctt
tgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctgtgttggggt
gagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaagctatgtcaa
tgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaactgttctag
agtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatcttatcaacactt
ccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatc
gccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaattttactggg
ctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaaagaggacat
tatcaccagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgactatgcctgctaggt
tctatcctaaccttactgaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagttaatcattac
ttccaaactagacgttatttacatactctgtggaaggcgggtattttatataagagagaaactacacgcagcgcctcatt
ttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacg
aacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattcaaacaatcc
agattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggccagggttca
ctccaccacacggcagtcttttggggtggagccctcaggctcagggcatagtgacaacagtgccagcagcgcctcctcct
gcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgca
gtggaa
>gnl|hbvnuc|KY881960_FT00000_P-C Feature FT:source KY881960_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-09). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccaaagtgaggggcctatactttcctgctggtggctccagctccggaa
caggaaaccctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aatacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaagcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcgtttttgccttccgacttctttccttctgttcgagatctcctcgacaccg
cctcagctctgtatcgggagaccttagagtctccggaacattgttcacctcaccattcagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgccattagacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattactccaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439399_FT00000_P-C Feature FT:source MZ439399_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN216-2013-Quasi-9). Complete genome. [Riboviria] (length=3209 residues).
ccacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaacagta
aaccctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggagagcac
cacatcaggactcctagcacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacaga
gtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacc
tccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcct
cttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttc
caggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgt
tgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatctttggctttcgcaagattcctatggga
gtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgttt
ggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattacca
attttcttttgtctttgggtatacatttaaaccctaacaaaaccaaacgttggggctactcccttaacttcatgggatat
gtcattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcctataaa
tagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtggttacc
cagcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttctgtgt
aaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactgg
ttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctag
cagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaatacacc
tcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaa
tcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggc
gcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtc
gcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtca
acgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgat
ctttgtactaggaggctgtaggcataaattggtctgtccaccagcaccatgcaactttttcacctctgcctaatcatctc
ttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataaagaat
ttggagcttctacggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccgcctct
gctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactaaggcaagctattctgtgttg
gggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaagctatg
tcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaactgtt
cttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatcttatcaac
acttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgccgacgaaggtctc
aatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaactttac
tgggctttattcttctactgtacctgtctttaatcctgactggcaaactccatcttttcctcacattcatttgaaagagg
atattatcaatagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgcctgct
aggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagttaatca
ttacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcagcgcct
cattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggg
gacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaattcaaaca
atccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtgggagtaggatctttcggaccaggg
ttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctcc
tcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggcca
cgcagtgga
>gnl|hbvnuc|AY306136_FT00000_P-C Feature FT:source AY306136_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate H85). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcccgaggactggggaccctgcactgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtcggcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacccttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcctcacctctgt
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattggcccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctactctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccaacatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacgactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggataaaggcattaaaccatattatcctgaacatgtggtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598672_FT00000_P-C Feature FT:source KJ598672_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB310). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctgctagatcccagagtgaggggcctatacctccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcacggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcactaggccataagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctctaccgtccccttctttgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttatataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgtccaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacctggcaacctgggtgggaagtaatttggacgacccagcatcccgagaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggttccacatttcctgtcttacttttggaagagcaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagaccatcaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattattgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgttccaaatcctctgggattctttcccgatcaccagttggatccggcgttcggagccaattc
aaacaatccagattgggatttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|MZ439660_FT00000_P-C Feature FT:source MZ439660_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2004-Quasi-21). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatcttctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttagaagacccggcatccagggaagcagtagtagg
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagacaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
ttcactgggctttactcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaagaggagattaaaattgatcatgc
ctgctaggttctatcctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggacccggcattcagagccaattc
aaacaatccagattgggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377585_FT00000_P-C Feature FT:source GQ377585_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J134). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatccaagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactgaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtggcaacaatatatgcacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcccggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggttctgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaagcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cttctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctcgaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881968_FT00000_P-C Feature FT:source KY881968_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-09). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccggctactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggacgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcgcgattactgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaatcaaacaatgttttcgaaaactgcct
ataaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcag
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctccccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagttgca
cctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|MZ439714_FT00000_P-C Feature FT:source MZ439714_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2013-Quasi-20). Complete genome. [Riboviria] (length=3200 residues).
ctccaccacattccaccaaactctgctagatcccagagttcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggccaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataaagaatttggagcttc
tgtggagttaatctcttttttgccttctgacttctttcctaatattcgtgatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttgaacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttat
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagagaagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatccgctgggattctttcccgatcaccagttggacccggcattcagagccaattcaaacaatcccgattg
ggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggccggggttcactccac
cacacggcaatcttttggggaggagccctcaggctcagggcatattgacaacagcaccagcagcacctcctcctgcctcc
accaagcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctcaggccatgcagtggaa
>gnl|hbvnuc|EU871998_FT00000_P-C Feature FT:source EU871998_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 530-00-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccatgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacctcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacgtacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cttcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccataccgcactcaggcaagagattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcaa
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggggtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctttcctaaccttaccaaatatctgccattggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatctacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggcccgaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggaaccctcaggctcggggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|FJ787455_FT00000_P-C Feature FT:source FJ787455_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S1092-3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagcctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttgtgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggaactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtggggcttttaggctttgctgccccttttacacaatgtgg
ctatcctgccttaaagcctttatatgcatgtatacaatctaagcaggctttctcgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggctgtgggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatacagcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgttcacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtccccttcttcatctgccgttccgaccggccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtgttgcccaaggtcttacataaaaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggagaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccgtctgacttctttccttctactcgagatctcctcgacaccg
cctcggctctatatagggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaacatgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcggaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattactttaaaactatgcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacaaatctttctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcctttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439600_FT00000_P-C Feature FT:source MZ439600_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2019-Quasi-21). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagagtgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgtttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaagaagattgaaattgatcatgc
ctgctaggttttatcctaaacgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ089781_FT00000_P-C Feature FT:source DQ089781_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1476). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttgggttttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcacctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccaacggcaaaccaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU570073_FT00000_P-C Feature FT:source EU570073_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8-S698). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgttggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaacgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaaactctacgtttccct
cttgttgctgtataaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggaatgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggatgttggggtactttgccgcaagaacatattgtacaaaaaatcaagaactgttttcgaaaactgcct
gtaaatagacctattgattggaaagtacgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgacacttatcggaaccgacaactctgttgtcctctctcggaaat
acacatcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccctagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaggacccagcatccagagaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaattactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggactctcaatgttagtatcccttggactcataaggtgggaaac
ttcactggtctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaacgacacgaag
cgcctcattttgtgggtcaccctattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatcttactgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaatcccaacaaggatcactggccggaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcaaattgacaaaagcgccagtagca
cctcctcctgcctccaccaatcggcagtcaggcagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ787447_FT00000_P-C Feature FT:source FJ787447_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S461-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
gcttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcggtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttgcctctat
taccaattttctttggtctttgggtatacatttgaaccctaataaaaccaaacgttgggggtactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcatgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgcggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcggtt
aatcattacttcaaaactagacattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctatagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccggaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|FJ386632_FT00000_P-C Feature FT:source FJ386632_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 2370). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagacttgtggtggacttctctcaattttctaggggaagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaraccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttacggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctcaaattaagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggarcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtaccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377531_FT00000_P-C Feature FT:source GQ377531_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J36). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgactgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaacttaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaaacaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactcggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964174_FT00000_P-C Feature FT:source KU964174_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 26_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatattgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctactaaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactgaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagacctccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattattgatagatgtcaacagtatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacaagcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|AB931171_FT00000_P-C Feature FT:source AB931171_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2S_HB11-0922). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcctcaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaagggacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttattcccttcactttatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcccgccttaaagcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttctggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaaccgacaactcggttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctatcgtccccttctacatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagcggactcttggactctcaacga
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagacctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatacta
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaagcagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttcctgaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcctcacattcatttgaa
ggaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaacaaggagattaaaattaattatgc
ctgccagattctatcctaaacttaccaaatatttgcccttagacaaaggcattaaaccttattatccggaacatgtagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
ctggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaccaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcggtc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcaaactgacatcaatgccagcagca
cctcctcctgccaccaccaatcggcagtcaggaagacggcctactcccatcactccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ023640_FT00000_P-C Feature FT:source FJ023640_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-1206). Complete genome. [Hepadnaviridae] (length=3188 residues).
ctccagcacattccaccaagctctgccccctgctggtggctccagttccggaacagtaaaccctgttccgactactgcct
ctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggagagcaccacatcaggattcctaggaccc
ctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttc
tctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcactcaccaacctctt
gtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctgctgctatgcctc
atcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcac
gggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacg
gaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttctct
tggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgat
gtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctattaccaattttcttttgtctttgggtat
acatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaagttggggtacct
tgccacaggaacatattgtacaaaaactgaaacaatgttttcggaaacttcctataaatagacctattgattggaaagta
tgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtggttacccagcattaatgcctttatatgc
atgtatacaagccaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttacc
ccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccat
cagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccg
gtctggagcgaaacttatcggcaccgacaactctgtggtcctctctcggaaatacacctcctttccatggctgctaggct
gtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcgg
ggccgtttgggactctaccgtccccttctgcgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctc
cccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtgaacgc
ccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgaccttgaggcatact
tcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaaaggtctttgtactrggaggctgtagg
cataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaa
gcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttggagcttctgtggagttact
ctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtatcgggaggccttag
agtctccggaacattgttcacctcaccatacagcactaaggcaagctattctgtgttggggtgagttgatgaatctggcc
acctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcagctatgtcaatgttaatatgggcctaaa
aatcaaacaactattgtggtttcacatttcttgccttacttttggaagagaaacagttcttgagtatttggtgtcttttg
gggtgtggattcgcactccccccgcatacgggccaccaaatgcccctatcttatcaacacttccggaaactactgttgtt
agacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatc
tcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttattcttctactgta
cctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaaagaggatattatcaacagatgtcaaca
atatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgcctgctaggttctatcctaaccttacca
aatatttgcccttagataagggcattaaaccttattatcctgaacatacggttaatcattacttccaaactagacattat
ttacatactctgtggaaggctggtattttatataagagagaaactacacgcagtgcttcattttgtgggtcaccatattc
ttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaacctttctgttcccaat
cctctgggattctttcccggtcaccagttggacccagcgttcrgagccaattcaaacaatccagattgggacttcaaccc
caacaaggatcaatggccagcggcaaaccaggtaggagtgggakcattcgggccagggttcactccaccacacggcagtc
ttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcgcctcctcctgcctccaccaatcggcag
tcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU964045_FT00000_P-C Feature FT:source KU964045_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 17_12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtaccaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggcgactcccttaacttcatgg
gatatgtaattggttgttggggtactttaccgcaagaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcgtgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcca
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttgcaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattcttaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggcgattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacacactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcgggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670264_FT00000_P-C Feature FT:source AB670264_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.28). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactattgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttatctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggcagttggggtactctaccgcaggaacatattgtacaaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttctacgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacmcstataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcgattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatytggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgcgggccctcttacagctaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaaccaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013826_FT00000_P-C Feature FT:source KR013826_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatacctccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagcccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgccggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tggttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttgggtcttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctaggctgcgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcctaaggtcttatataagaggattcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaagagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cggggttcactccacctcacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagta
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggcaatgcaatggaa
>gnl|hbvnuc|MZ439516_FT00000_P-C Feature FT:source MZ439516_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2019-Quasi-25). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagtgtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggttgacttctctcagttttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgaatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtgcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagagagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|EU939556_FT00000_P-C Feature FT:source EU939556_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C64). Complete genome. [Hepadnaviridae] (length=3206 residues).
ctccacaacattccaccaagctctgctagaccccaaagtgaggggtcctgctggtggctccagttccggaacagtaaacc
ctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagaacacaaca
tcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtct
agactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccccaacctcca
atcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttc
atcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccagg
aacgtcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgct
gtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatctttggctttcgcaagattcctatgggagtgg
gcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggct
ttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctattaccaattt
tcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgggatatgtaa
ttggaagttggggtactttaccgcaagaacatattgtactcaaactcaagcaatgttttcgaaaactgcctgtaaataga
cctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtggctatcctgc
cttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaac
aatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaacccccactggatgg
ggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagc
ttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctcgcggaaatacacctcct
ttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcgctgaatccc
gcggacgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccaaccacggggcgcac
ctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcat
ggagaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactattggactctcagcaatgtcaacga
ccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggaggagctgggggagattaggttaatgatcttt
gtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgt
tcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataaagaatttgg
agcttctgtggagttactctcttttttgcctgctgacttctttccttctgttcgagatctcctcgacaccgcctctgctc
tgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattgtgtgttggggt
gagttgatgaatctggccacctgggtgggaagtaatttggaagaccctgcatccagggaattagtagtcagctatgtcaa
tgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaactgttcttg
agtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatcttatcaacactt
ccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatc
gccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaactttactggg
ctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttacaggaggacat
tattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaactaattatgcctgctaggt
tctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccctattatcctgagcatacagttaatcattac
ttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcagcgcctcatt
ttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacg
aatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatcc
agattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggccagggttca
ccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcacctcctcct
gcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccacgca
gtggaa
>gnl|hbvnuc|FJ562270_FT00000_P-C Feature FT:source FJ562270_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I123). Complete genome. [Hepadnaviridae] (length=3203 residues).
ctccacaacattccaccaagctctgctagaccccagagtgagggctgctggtggctccagttccggaacaataaaccctg
ttccgattactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagaacacaacatca
ggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctaga
ctcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccccaacctccaatc
actcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatc
ctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctctacttccaggaac
atcaactaccagcatgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgta
caaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcc
tcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttc
agttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctattaccaattttct
tttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaatttcatgggatatgtaattg
gatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcctgtaaatagacct
attgattggaaagtatgtcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtggctatcctgcctt
aatgcctttatatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtgtaaacaat
atctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaacccccactggatggggc
ttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcgtg
ttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctcccggaaatacacctcctttc
catggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcg
gacgacccgtctcggggccgcttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctc
tctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatgga
aaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactcgcagcaatgtcaacgaccg
accttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaaaggtctttgta
ctaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttca
tgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataaagaatttggagc
ttctgtggagttactctcttttttgccttctgacttytttccttctattcgagatctcctcgacaccgcctcagctctgt
atcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcacgctatcctgtgttggggtgag
ttgatgaatctggccacctgggtgggaagtaatttggaagatcaagcatccagggacttagtagtcggctatgttaatgt
taatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagt
atttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatcttatcaacacttccg
gaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgcc
gcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctt
tattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttacaggaggacattat
taatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgctaggttct
atcctaaccttaccaaatatttgcccttggacaaaggcataaaaccatattatcctgaacatgcagttaatcattacttt
aaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcagcgcctcattttg
tgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaat
ctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccaga
ttgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccc
caccacacggcggtcttttggggtggagccctccggctcagggcctattgacaacagtgccagtagcacctcctcctgcc
tccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtg
gaa
>gnl|hbvnuc|JQ707773_FT00000_P-C Feature FT:source JQ707773_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S50_27A). Complete genome. [Hepadnaviridae] (length=3191 residues).
ctccagcacattccaccaagctctgatagatcctgctggtggctccagttccggaacagtaaaccctgttccgactactg
cctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcaggattcctagga
cccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggac
ttctctcaattttctagggggaacacccacgtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacct
cttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgc
ctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccag
cacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcgg
acggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctcagtccgtttc
tcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagttatattgat
gatgtggtattgggggcgaaatctgtgcaccatcttgaatccctttttaccgctgttaccaattttcttttgtctttggg
tatacatttaaaccctactaaaactaaacgttggggctactcccttcacttcatgggatatgtcattggaagttggggta
ccttaccacaggatcatattgtacacaaaatcaaacaatgttttcggaaacttcctacaaatagacctattgattggaaa
gtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtggttacccagcattaatgcctttgta
tgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttctgtgtcaacaatatctgaaccttt
accccgttgctcggcaacggtctggtctttgccaagtgtttgctgacgcaacccccactggttggggcttggccataggc
catcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcag
ccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaagtacacctcctttccatggctgctag
gctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccgtct
cggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctctctttacgcggt
ctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtgaa
cgcccgacaggccttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgaccttgaggcat
acttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggttaatgacctttgtactaggaggctgt
aggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcccactgtt
caagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttggagcttctgtggagtt
actctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccgcctctgctctgtatcgggaggcct
tggagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctgtgttggggtgagttgatgaatctg
gccacctgggtgggaagcaatttggaagacccagcatccagggaattagtagtaagctatgtcaatgttaatatgggcct
gaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtctt
ttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatcttatcaacacttccggagacttgtgtt
gttagacaacgaggcaggtccactagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaag
atctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttattcttctact
gtacctgtctttaatcctgactggcaaactccctcttttcctaacattcatttgaaagaggatattattaatagatgtca
acaatatgtaggccctcttacagttaacgaaaaacggagattaaaattgattatgcctgctaggttctatcctaactgta
ccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagttaatcattacttccaaactagacat
tatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcctcattttgtgggtcaccata
ttcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctttctgttccc
aatccgctgggattctttcccgatcaccagttggaccctgcattcggagccaattcaaacaatccagattgggacttcaa
ccccaacaaggatcaatggcccgcggcacaccaggtaggagtgggatccttcgggccagggttcactccaccacacggca
atcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctcctcctgcctccaccaatcgg
cagtcaaggagacagcccactcccatctctccacctctaagagacagtcatcctcaggccatacagtggaa
>gnl|hbvnuc|JX429915_FT00000_P-C Feature FT:source JX429915_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-SD-19). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccacggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggcatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcaattggccatcgccgcatacgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccctgcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcttaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgagcatacagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173311_FT00000_P-C Feature FT:source KJ173311_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate NH005C(e49)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggttctttaccgcaagaacatattgtactaaaaatcaagcaatgttttaggaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcatttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacgatcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatacggcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggaatctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagctgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctagacaccg
cctcagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggggtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
agaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagta
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|MZ439554_FT00000_P-C Feature FT:source MZ439554_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2004-Quasi-3). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacgtttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttacggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaagaagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB014371_FT00000_P-C Feature FT:source AB014371_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 12D12HCC). Complete genome. [Hepadnaviridae] (length=3221 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgatttgtcctggctatcgcttgatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
amttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttgccacaagaacatattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgtcaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcgaaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatgggcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactct
cagcaatgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagtct
aggttaatgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgc
ctaatcatctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgaccc
gtataaagaatttggagcttctgtggagttactctcttttttgcctcatgacttctttccttccattcgagatctcctcg
acaccgcttcagctctgtatcgggaggccttggagtctccggaacattgttcacctcaccayacagcactcaggcaagcc
attctgtgttggggtgagttgatgaatctggccacctgggtgggaggtaatttagaagacccaacatccagggaagcagt
agtcggctatgtcaacgttaatatgggcttaaaactcaggcaactactgtggtttcacatttcctgtcttacttttggaa
gagaaactgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaggcttacagaccaccaaatgcccct
atcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcag
acgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggacgcataaggtg
ggaaactttactggcctttattcttctactgtacctgtcttcaatcctgagtggcaaactccctcctttcctcacattca
tttacaggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattgaaattaa
ttatgcctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacat
gcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactac
acgcagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcga
cacggcatggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccagcgttcggagc
caactcaaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcat
tcgggccagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgcca
gtagcacctcctcctgcatccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtca
tcctcaggccatgcagtggaa
>gnl|hbvnuc|KJ598636_FT00000_P-C Feature FT:source KJ598636_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB1C4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctaccctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcttttc
tttgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctcccggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtctgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaaccgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctcagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674425_FT00000_P-C Feature FT:source MF674425_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV040081). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatctcctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagctcccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaacctacggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gttatgtaattggaagttggggcaccttgccacaggaacatattatacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaacgaattgtgggtcttctgggctttgccgctccctttacccaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttttcgccaacttacaaggcctttc
tatgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctgttcatgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ccatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaaaagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgtcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaat
tttactggactttattcttctactgtacctgtctttaaccctgaatggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgccattggataaaggcattaaaccttattatcctgagcatatagtt
aatcattacttccaaacaaggcattatttacatactctgtggaaggctggtattttatataaaagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccagcattcagagccaattc
aaacaatccagattgggacttaaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcaccccaccacacggcaatcttttggggtggagtcctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggacgacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB367411_FT00000_P-C Feature FT:source AB367411_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 20). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggttttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gctatgtaattggaagttggggaactttaccacaggaacatattgtactaaaactcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacaagccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaactgacaattcggttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccgtccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctccttgataccg
catctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgcacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagaaagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY363254_FT00000_P-C Feature FT:source KY363254_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate geno2.6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcccccacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatctgcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttataccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaatagaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattatactaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacctcatcgggactgacaactcggttgtcctctctcggaaat
acacctcattcccatggctgctagggtgtgctgccaactggatcctgtgcggggcgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggtcaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgtccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
catctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagactaagattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctttggaaggctggcattttatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaacac
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcaaca
ccccctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctgagagacagtcatcctca
ggccacgcagtggaa
>gnl|hbvnuc|MZ439361_FT00000_P-C Feature FT:source MZ439361_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN216-2007-Quasi-1). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatacattcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatctttggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtcattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagcaaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtaggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcaccctca
ggccatgcagtggaa
>gnl|hbvnuc|AB074756_FT00000_P-C Feature FT:source AB074756_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-Th55). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcgaaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaggcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcacagccggtctggagctaaacttatcggcaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtatttacagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctttgtatcgggaggccttagaatcttcggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttactttcggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
ggaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttacccctagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacactatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881928_FT00000_P-C Feature FT:source KY881928_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-07). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaaacaatgttttcgaaaactgcct
ataaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcttgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagttgca
cctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|MZ439624_FT00000_P-C Feature FT:source MZ439624_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BO129-2019-Quasi-1). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacatttcatcaagctctgctagatcccagagtaaggggcctataccttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaaaatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctgcaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttgtcctct
aattccaggatcatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttatctttgggtatacatttgaaccctaataaaaccaagcgttggggctactccctgaacttcatgg
ggtatgtaattggaagttggggtaccttgccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgctccttttacacaatgtgg
ttatcctgccttactccctttgtattcatgtatacaagctaagcaggctttcactttttcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctaaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggaattgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cttctgctctgcatcgggaggccttagagtctccggaacattgtacatatcaccatacagcactaaggcaagctattctg
tgttggggtgaattgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcttgtcttacttttggaagagaag
tggttcttgagtatttggtgtccttcggggtgtggatccgtacaccccccgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctaggtctcgggactctcaatgttagtatcccctggactcataaggtgggaaac
tttactggcctttattcttctactgttcctgtctttaatcctgagtggcaaactccctcttttcctgatatacatttgaa
ggaggacattattgatagatgtcaacaatttgtgggccctcttaatataaatgaaaaaagaagattaaagttaattatgc
ctgctagattttttcctaaccttaccaaatatttgcccttagataaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttgcattccctttggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcaaaacctcggaaaggc
atggggacgaatctgtctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggc
cagggttcaccccaccgcacggcggtcttttgggttggagcccgcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|LC279257_FT00000_P-C Feature FT:source LC279257_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23_serum). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacctccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggcagttggggtactttgccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgctccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgagtggaacctttgtggctcctctgccgatccatactgcggaact
cgtagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
agaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT645003_FT00000_P-C Feature FT:source MT645003_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GX23). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaaactaagcaggcttttacgttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcaggcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggactctaccgtcccctacttcgtctgccgtttcgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttacagactgggaggagttgggggatgagactaggtta
atgatctatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatccggactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctcttacagtgaatgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacctggccttcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcacaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacaataccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439497_FT00000_P-C Feature FT:source MZ439497_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2019-Quasi-6). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaagatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgaatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtgcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|AB198083_FT00000_P-C Feature FT:source AB198083_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccactttccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggga
cagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaaacaatgtttccgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcgtgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctcacggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctccgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttaatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacataattaatagatgtcaacaatatgtgggtcctcttacagtcaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcatactatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881872_FT00000_P-C Feature FT:source KY881872_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-05). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggagcctatactttcctgctggtggctccagttccggaa
caggaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccggcacgggaccatgcaagacctgcacgattcctgctcaaggaaactctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaactggaagttggggtactttaccgcaagaacatattgtacaaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtccctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacgactacataatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctgttcgagatctcctcgacaccg
cctcagctctgaatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaagatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgccattagacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaagagcgggagcattcgggc
caggtttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacggtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|MZ439481_FT00000_P-C Feature FT:source MZ439481_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2013-Quasi-27). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttatcccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagcaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ089799_FT00000_P-C Feature FT:source DQ089799_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK734). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctctacaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatcatcaaccaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatctgaaccctaataaaaccaaacgwtggggctactcccttaacttcatgg
gatatgtaattggatgttggggtaccttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaamtcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctmctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatyctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttttatcctaaccttaccaaatatttgccattggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggccttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475321_FT00000_P-C Feature FT:source GQ475321_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR17CHB). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccacggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactaaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctctctatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactcggttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctccttgacaccg
cctctgctctgtatagggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctccttccctaacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacacag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcatttgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439286_FT00000_P-C Feature FT:source MZ439286_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BL71-2007-Quasi17). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttcttgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttctatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
acaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccagggctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatagcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttccgttcgggatctcctcgacacca
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccacacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagcagtaag
ctatgtcaatgttaatatgggcctaaagttcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaccacgaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccccacggcaaccttttggggtggagccctcaggctcagggcatattgtcaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctacgcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB195954_FT00000_P-C Feature FT:source AB195954_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggattggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaatttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaacacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttgctctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctccgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaacgttaatatgggcctaaaaatcagacaattactgtggtttcacatttgctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcacccccccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccactaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013975_FT00000_P-C Feature FT:source KR013975_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3206 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtgactccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaaacagcacgggaccatgcaggacctgcacgattactgctcaaggaacctctatgtttccctcttgttgct
gtacaaaaccttcggacggaaactgcacttgtattcccatcccatcagcctgggctttcgcaagattcctatgggagtgg
gcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtcgggctttcccccactgtttggct
ttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctattaccaattt
tcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgggatatgtaa
ttggaagttggtgtactttaccgcaggaacatattgtactaaaacttaagcaatgttttcgaaaattgcctgtaaataga
cctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtggctatcctgc
tttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaac
aatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaacccccactggatgg
ggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagc
ttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaagtacacctcct
ttccatggctgctagggtgtgctgccaactggatcctgcgcggaacgtcctttgtttacgtcccgtcggcgctgaatccc
gcggacgacccgtctcggggccgtttgggactccaccgtccccttcttcatctgccgttccggccgaccacggggcgcac
ctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcat
ggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacga
ccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatcttt
gtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgt
tcatgtcctactgttcaagcctccaagctgcgccttgggtggctttggggcatggacattgacacctataaagaatttgg
agcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctc
tgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctctgttggggt
gagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcggctatgtcaa
tgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaactgtccttg
agtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatcttatcaacactt
ccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatc
gccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactggg
ctttattcttctactgtgcctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttacaggaggacat
tattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgctaggt
tctatcctaaccgtaccaaatattggcccttggacaaaggcattaaaccatattatcctgaacatgcagttaatcattac
ttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcagcgcctcatt
ttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttccaaacctcgacaaggcatggggaca
aatctttctgttcccaatccgctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatcc
agattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagctttcgggccagggttca
ccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagcacctcctcct
gcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgca
gtggaa
>gnl|hbvnuc|MN683728_FT00000_P-C Feature FT:source MN683728_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate XZ10). Complete genome. [Riboviria] (length=3215 residues).
ctccacaaccttccaccaagctctgcaagatcccagagtgagaggcctatatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacatcacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgactcctgctcaaggaacctctatgtatccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattgggagttggggtactttaccccaggaacatattgtacaaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcttctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctaccctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939568_FT00000_P-C Feature FT:source EU939568_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C93). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccaaagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataac
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatatgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggaaccttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtgtctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgagtggaacctttgtggctcctctcccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggrctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaraccaccgtgaacgcccaccaggtgttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgaccactataa
agaatttggagcttctggagagttactctcttttttgccgtctgacttctttccttctattcgagatctcctcgacaccg
ccactgctctatatcgagaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagcaatttggaagaccaagcatccagggaattagtagtcag
ctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgccaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcccgaacatgcagtt
aatcattacttcaaaactagacattatttgcatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcsgtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcccctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaaaaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cacggttcaccccaccacacggcggtctcttggggtggagccctcaggctcatggcatactgacaacagtgccaacacca
cctcctcctgcttcaacagatcggcagtctcgaagacagcctactaccatctctccacctctaagagacagtcatcctca
cgccatgcagtggaa
>gnl|hbvnuc|FJ899761_FT00000_P-C Feature FT:source FJ899761_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C9-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacgacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggttgacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattatacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcaccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggtaccgacaactctgtggtcctctctcggaaat
acacctcgtttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggcctaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccgctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccaagcatccagggatttagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggccggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|KP148513_FT00000_P-C Feature FT:source KP148513_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y26-2-5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
caataaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactgggggccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacacattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgtcgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagaccgggaggagttaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccagtcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB198077_FT00000_P-C Feature FT:source AB198077_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggaactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctgttggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcgaaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtgttgcccaaggtcttacataaaaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctt
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagaccctgcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ089804_FT00000_P-C Feature FT:source DQ089804_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK262). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgttagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctagkacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctcgggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtccaccaatttgtcctggttatcgctggatgtgtctgcggcgttctatcata
ttcctcttcatcctgctgctatgcctcatcttctcgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttatgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
gttaatagacctattgattggaaggtgtgtcagagaattgtgggtcttctaggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcgggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactggggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttggggctctaccgtccccttctgcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttactgactgggaggagttgggggaggagatgaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctattgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggatgctctgcgcagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
ccactgctctgtatggggaggccttagagtctccggaacattgttcagctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatcaagcatccagggacttggtagtagg
ctatgtcaacgttaacatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagata
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccacmaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacccgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggcaggctggtattttatataagagagaaactacacgcag
tgcctcgttttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttcggttcccaatcctctgggattctttcccagtcaccagttggacccagcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatctttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU051424_FT00000_P-C Feature FT:source KU051424_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MMHBV014). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaagtacattccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtcttgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccaatggccatcagcgcatgcgtggaaccttggtggctcctctcccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttgggactctaccgtcccctcctgcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatcaagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgactggcaaactccctcttttcctcacatacatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ccgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670254_FT00000_P-C Feature FT:source AB670254_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.18). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctcgat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaytaggtta
atgatctttgtactcggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctrttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttacccttggataaaggcattaaaccttattatcccgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacwacagtgccatcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439637_FT00000_P-C Feature FT:source MZ439637_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BO129-2019-Quasi-14). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacctttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaaaatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttatctttgggtatacatttgaaccctaataaaaccaagcgttggggctactccctaaacttcatgg
ggtatgtaattggaagttggggtaccttgccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttactgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaccctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
accggttggggcttggccatgggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgttctctctcggaaat
acacctcgttcccatggctgctcggctgtgctgccaactggatcctgcgcgggacatcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggtcgcttggggatctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgccaatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggttcttgagtatttggtgtccttcggggtgtggattcgcacaccccccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcttcaatcctgaatggcaaactccctcttttcctgatatacatttgca
ggaagacattattaatagatgtcaacaatttgtgggccctctaaatgcaaatgaaaaaaggagattaaagctaattatgc
ccgctagattttttcctaaccttaccaaatatttgccattggataaaggtattaaaccttattatcctgaacattcagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagagagaaactacacgcag
tgcatcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcctcaaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcctgcccgaccatcagttggacccggctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggt
cagggttcaccccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439684_FT00000_P-C Feature FT:source MZ439684_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2007-Quasi-18). Complete genome. [Riboviria] (length=3200 residues).
ctccaacacattccaccaagctctgccagatcccagagttcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcaccaaggtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgaccactataaagaatttggagcttc
tgtggagttactctcttttttgccttctgacttctttccttctattcgtgatcttctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcagctcaccatacagcactaaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaactcagacaaatattgtggtttcacatttcttgtcttacttttggaagacaaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaacttcactgggctttac
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagaggagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatccgctgggattctttcccgatcaccagttggacccggcattcagagccaattcaaacaatcccgattg
ggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctcaggccatgcagtggaa
>gnl|hbvnuc|KU964002_FT00000_P-C Feature FT:source KU964002_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 14_13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaatttcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccatttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatcaaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacatcctttgtttacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcatcgacaccg
cctccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactattgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
agaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagtgccagtagcg
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881890_FT00000_P-C Feature FT:source KY881890_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-05). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
caggaaaccctgttccgactactgcctcacccatattgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
aaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaagacctttc
tgtgtgaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccgccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctgttcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttcgagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaagatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccagaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgccattagacaaaggcaataaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggacttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagaaagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439300_FT00000_P-C Feature FT:source MZ439300_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BL71-2019-Quasi-11). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctataccatcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttcttgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttctatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccccaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
actaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgccgttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccagggctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatagcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaagtcttgcccaaggtcttacataagagaactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtgcagttactctcttttttgcctgaagacttctttccttccgttcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaattagtagtacg
ctatgtcaacgttaatatgggcctaaagttcagacaactattgtggtttcacatttcctgtcttacttttggacaacaag
ttgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaccacgaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatttgtaggccctctcacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatattctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcagagccaattc
aaacaatcccgattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccccacggcaaccttttggggtggagccctcaggctcagggcacattgacaacagcaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcccacgcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AY641562_FT00000_P-C Feature FT:source AY641562_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate He82). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaaacacctctatttttccct
cttgttgctgtacaaaaccttcggacgcaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactaaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcgtgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcggcttgttttgctcgcagccggtctggagcaaaacttattgggactgacaactctgttgtcctctcacggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctttctctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctggacactg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttacaaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaaacctcgacaaggcatggggacgaatctttct
gttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccacctc
acggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagcgcctcctactgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774251_FT00000_P-C Feature FT:source KC774251_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cww1030). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgatggggatactcccttaactttatgg
gatatgtaattggaagttggggtacattaccgcaggaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcagactccctcttttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaatcttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaagctaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgtttggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013768_FT00000_P-C Feature FT:source KR013768_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttcttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtttgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcagtaggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaactcattggaaccgacaactctgttgtcctctctcgaaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atcccatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggaatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgtccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcttcaattctgaatggcaaacaccctcctttcctcacattcatttaca
ggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccagcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB113878_FT00000_P-C Feature FT:source AB113878_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaggctctactagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactgccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtacaaaaaattaagaactgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctaccttaaagcctttgtatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtctgggactctatcgtccccttcttcatctgccattccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcacctgcaccatgctactttttcacctttgcctaatc
atctcttgctcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacatcgacccatataa
agaatttggagcctctgctgagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagaatctcaagaacattgttcagctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacttgggtgggcagtaatttggaagacccagcatcccgggaattggtagtcag
ctatgtcaatgttaacatgggcctgaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcccaaccttactaaatatttgcccttggataaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactgcacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggatccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaactcaggtaggagcgggagcattcggac
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccacgcagtggaa
>gnl|hbvnuc|AB900115_FT00000_P-C Feature FT:source AB900115_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccatcaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactcaaacaatgctttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccgtttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacagtctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
acgggctggggcttggcaataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcgcaaat
acacctccttcccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
atgaatcccgcggacgacccgtcgcggggccgtttgggcctctatcgtccccttcttcagctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacacccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttaggggaggagactaggtta
atgatctttgtattaggaggctgtaggcataaattggtccgttcaccagtaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agaatttggagcctctgcggagttactctcttttttgccttctgacttctttcctaatattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtcttctgaacattgttcagctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcatgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacaacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattgatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaacatgaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcgatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439372_FT00000_P-C Feature FT:source MZ439372_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN216-2007-Quasi-12). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatctttggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtcattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctattcgtgacctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagcaaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtaggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377551_FT00000_P-C Feature FT:source GQ377551_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J82). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacttaaactcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgagacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactctcggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaatagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013769_FT00000_P-C Feature FT:source KR013769_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactaccgcctcacccatatcgtcaatcttctcgaggactggggaccctgtaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatccccacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtctgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacggttcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgctggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtttgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccgtaggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcaaaactcattggaaccgacaactctgttgtcctctctcgaaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgcctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttaggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacatgtttcacctcaccatacagcactcaggcaagctattctg
cgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgctaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtatcccgtggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcctcaattctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacggatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccagcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881877_FT00000_P-C Feature FT:source KY881877_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-05). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
caggaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgtggcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtggacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccattcttctttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctgttcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgccattagacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|KU964072_FT00000_P-C Feature FT:source KU964072_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 19_9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctgtactttcctgctggtggctccagtttcggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctcgactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattgactgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
agggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagctctcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatacgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881888_FT00000_P-C Feature FT:source KY881888_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-05). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaaactctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
caggaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagagtcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctgttcgagatctcctcgacaccg
cctcagctctgtatcgggtggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcgatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgcacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgccattagacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaagaatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcccactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT426108_FT00000_P-C Feature FT:source MT426108_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 9233811 transfection clone). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgacgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactaaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctctctatgcatgcatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagccattctg
tgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtacttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctccttccctaacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacacag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ562291_FT00000_P-C Feature FT:source FJ562291_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I163). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgcccacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcgtgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaattctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccaccgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggaccattggccagaggccaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ924642_FT00000_P-C Feature FT:source GQ924642_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M77). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaaactctgctagatcccagggtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagaatctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaaactctacgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttacccgggtgctcggcaacggtcaggtctttgccgagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtccgcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtcccctgcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcctgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataggttggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctactgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgcctaatgacttctttccttccatgcgagacctcctcgacaccg
cctctgctttgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagccctaagacaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattctggtttcacatttcctgtcttatgtttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctaacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccagacgaggcattatttacataccctgtggaaggctggtattctatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagcaaaccaggtaggagtgggagcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagcccgcaggctcagggcatattgacaacaatgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccgtgaagtggaa
>gnl|hbvnuc|MZ439641_FT00000_P-C Feature FT:source MZ439641_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2004-Quasi-2). Complete genome. [Riboviria] (length=3200 residues).
ctccagcacattccaccaagctctgctagatcccagagttcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcctgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataaagaatttggagcttc
tgtggagttactctcttttttgccttctgacttctttcctaatattcgtgatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttggacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttat
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagagaagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatccgctgggattctttcccgatcaccagttggacccggcattcagagccaattcaaacaatcccgattg
ggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ562242_FT00000_P-C Feature FT:source FJ562242_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I68). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttattggaaccgacaactctgttgttctgtctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactcttccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagatgtcgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaacagtgccagtagca
cctcctcctgcctccgccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964011_FT00000_P-C Feature FT:source KU964011_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 15_8). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtcaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaaactctacgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctgttcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgcaccttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctacggtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatgttaccaaatatttgcctttggataaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatccatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatagtgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439578_FT00000_P-C Feature FT:source MZ439578_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2007-Quasi-8). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaagaagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacctcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB367422_FT00000_P-C Feature FT:source AB367422_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 31/Adefovir-treated Pt. 12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaaaatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctagtaaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaaattaagcaatgttttcggaagctgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttactcaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggccttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgagtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaataggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcatcgacactg
cctctgctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccatcacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598668_FT00000_P-C Feature FT:source KJ598668_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB35). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctgctagatcccagagtgaggggcctatacctccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatcagaacctttaccccgttgcacggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcactaggccataagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctctaccgtccccttctttgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttatataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacctggcaacctgggtgggaagtaatttggacgacccagcatcccgagaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggttccacatttcctgtcttacttttggaagagcaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattattgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgtccttggataaaggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|MZ439514_FT00000_P-C Feature FT:source MZ439514_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2019-Quasi-23). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttcct
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttaaaccccaacaaggatcggtggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|JN400087_FT00000_P-C Feature FT:source JN400087_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-75-Mother). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccccgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgctggggctactcccttaatttcatgg
gatatgtaattggaagctggggtactttaccacaggaacatattgtattaaaactcaagcaatgttttcggaaactgcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacatgcacctgtaccccgttgcccggcaacggcctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcaacacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaagctcttacataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgcaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgtgtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcaagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatcctgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaaccctgagtggcaaactccctcttttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacataccctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcctattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774200_FT00000_P-C Feature FT:source KC774200_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2044). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcgcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttaggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttgtatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctcccaagtgtttgatgacgcaaccccc
actggatgggggttggccataggccatcggggcatgcgtggaacctttgtggctcctctggcgatccatagtgtggaact
cctagcagcttgttttgcttgcagccggtctggagcaaaagttatcggaaccgacaaatctgttgtcctctctcggaaat
acacctcctttccatggatgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctttaccgtcccctactttgtttgccgttccggccgaccac
ggggcgcacctctctttccgcggtctccccgtttgtgccttcacatctgccggcccgtgtgcacttcgcttcacctgtgc
acgttgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactagtggactctcagcaa
ggtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagagaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactttacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtgttttggggtggagccctcaggctcagggcatattggcaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ173290_FT00000_P-C Feature FT:source KJ173290_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CX038M(e253n)). Complete genome. [Hepadnaviridae] (length=3185 residues).
ctccacaacattccaccaagctcttcctgctggtggctccagttccggaacagtaaaccctgttccgactactgcctcac
ccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcacaacatcaggattcctaggacccctg
ctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctct
caattttctaggggaagcacccaagtgtcctggccaaaattcgcagtccccaacctccaatcactcaccaacctcttgtc
ctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctgctgctatgcctcatc
ttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatcaactaccagcacggg
accatgcaagacctgcacgactcctgctcaaggaacctctatgtttccctcttgttgctgtacaaaaccttcggacggaa
actgcacttgtattcccatcccatcatcctgggctttcgcaagatacctatgggagtgggcctcagtccgtttctcctgg
ctcagtttactagtgccatttgttcagtggttcgtagggctttcccccattgtttggctttcagttatatggatgatgtg
gtattgggggccaagtctgtacaacatcttgagtccctttttacctctattaccaattttcttttgtctttgggtataca
tttgaaccccaataaaaccaaacgttggggctactcccttaatttcatgggatatgtaattggatgttggggtactttac
ctcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcctgtaaatcgacctattgattggaaagtatgt
cagagaattgtgggtcttttgggctttgctgccccttttacacaatgtggatatcctgccttaatgcctttatatgcgtg
tatacaatctaagcaggctttcactttttcgccaacttacaaggcctttctgtgtaaacaatatctgaacctttaccccg
ttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaacccccactggatggggcttggctattggccatcag
cgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcggcttgttttgctcgcagccggtc
tggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaatacacctcctttccatggctgctagggtgtg
ctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccgtctcggggc
cgtttgggactctaccgtccccttctccgtctgccgttccagccgaccacggggcgaacctctctttacgcggtctcccc
atctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtgaacgccca
ccaggtcttgcccaaggtcttatataagaggactcttggactcgcagctatgtcaacgaccgaccttgaggcatacttca
aagactgtttgtttaaggactgggaggagttgggggaggagattaggttaatgatctttgtactaggaggctgtaggcat
aaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcctactgttcaagcc
tccaagctgtgccttgggtggctttaggacatggacattgacccgtataaagaatttggagcttctgtggagttactctc
ttttttgccttctgacttctttccttctgttcgagatctcctcgacaccgcctcagctctgtatcgggaggccttagagt
ctccggaacattgctcacctcaccatacagcactcaggcaagctattctgtgttgggttgagttgatgaatctggccacc
tgggtgggaagtaatttggaagacccagcatccagggaattggtagtcagctatgtcaatgttaatatgggcctaaaatt
cagacaactactgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatttggtgtcttttggag
tgtggattcgcactcctcctgcttacagaccacaaaatgcccctatcttatcaacacttccggaaactgctgttgttaga
cgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctca
atctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttattcttctactgtacct
gtctttaatcctgagtggcaaactccctcctttcctcacattcatttacaggaggacattattaatagatgtcaacaata
tgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgctaggttctatcctaaccttaccaaat
atttgcctttggacaaaggcattaaaccatattatcctgaacatacggttaatcattacttcaaaactaggcattattta
catactctgtggaaggcgggcattctatataagagagaaactacacgcagcgcctcattttgtgggtcaccatattcttg
ggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctttctgttcccaatcct
ctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattgggacttcaaccccaa
caaggatcactggccagaggcaaatcaggtgggagcgggagcattcgggccagggttcaccccaccacacggcggtcttt
tggggtggagccctcaggctcagggcatattgacaacagtgcccgtagcacctcctcctgcctccaccaatcggcagtcg
ggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB670304_FT00000_P-C Feature FT:source AB670304_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.31). Complete genome. [Hepadnaviridae] (length=3200 residues).
ctccacaacattccaccaagctctgctagaccccagagtgagtgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcacaacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatattcctcttcatcctg
ctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatc
ractaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgttgtacaa
aaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctattaccaattttctttt
gtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtactttaccacaagaacatattgtactgaaaattaagcaatgttttcgaaaactgcctgtaaatagacctatt
gattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtggctatccggccttaaa
gcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
taaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaacccccactggatggggcttg
gctcttggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtatacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccatcaggtcttgcctaaggtcttatataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagattaggttaatgatctttgtacta
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgt
cctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttggagcttc
tgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccgccgccgctctgtatc
gggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattctatgttggggtgaattg
atgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcggctatgtcaatgttaa
tatgggcataaaactcagaacactactgtggtttcacatttcctgtcttatgtttggaagagaaactgttcttgagtatt
tggtgtctttcggagtgtggattcgcactcctccggcttacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactggcctttat
tcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttacaggaggacattattaa
tagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgctaggttctatc
ccaaaattaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagttaatcattacttcaaa
actaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacccgcagcgcatcattttgtgg
gtcaccatattcttgggaacgagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattg
ggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcattcgggccagggttcaccccac
cacacggtggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccacgcagtggaa
>gnl|hbvnuc|KU963906_FT00000_P-C Feature FT:source KU963906_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8_7). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcatcaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcatcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaacgttggggctactctcttaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgacttgtgggtcttctgggctttgctgccccttttacgcaatgtgg
ttatcccgcattaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggcactaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtgttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgcgtggcaaactccctcctttcctcacattcatttgca
ggaagacattatcaatagatgccaacaatatgtgggccctctcacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcgtaccaaatattggcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggtgttctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtctgccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccattactccacctctcagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439631_FT00000_P-C Feature FT:source MZ439631_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BO129-2019-Quasi-8). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacctttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccaactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctgt
taccaattttcttttatctttgggtatccatttaaaccctaataaaaccaagcgttggggctactccctgaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttactgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaccctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
accggttggggcttggccatgggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgttctctctcggaaat
acacctcgttcccatggctgctcggctgtgctgccaactggatcctgcgcgggacatcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggtcgcttggggatctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgccaatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctacttttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggttcttgagtatttggtgtccttcggggtgtggattcgcacaccccccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcttcaatcctgaatggcaaactccctcttttcctgatatacatttgca
ggaagacattattaatagatgtcaacaatttgtgggccctctaaatgcaaatgaaaaaaggagattaaagctaattatgc
ccgctagattttttcctaaccttaccaaatatttgccattggataaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcctcaaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcctgcccgaccatcagttggacccggctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggt
cagggttcaccccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939654_FT00000_P-C Feature FT:source EU939654_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D115). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtattaaaactcaagcactgttttcgaaaactgcct
gtaaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagcaggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcctcttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgactcatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtcgtcgg
ctatgtcaatgttaatatgggcctaaaacttagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatggtagtatcccttggactcataaggtgggaaac
tttactgggctttactcctctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtattccaaacctcgacaaggc
atggggacgaatctttctgttcccaaccctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaaaaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|KR013787_FT00000_P-C Feature FT:source KR013787_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcatcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactactaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggtcggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtcgttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttgccacaggagcatattgtacacaaaatcaaacaatgttttcggaaacttcct
attaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaacacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctacggtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagactctcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534557_FT00000_P-C Feature FT:source MK534557_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 409). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcactcacgtgtcgtggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaaattgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtccacaaaatcaaacaatgttttcggaaacttcct
acaaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgctgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccctgcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctgatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgcgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgaccaagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcttgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgccgcttacagaccccaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgagtcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgcacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgaag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagccaactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX276839_FT00000_P-C Feature FT:source KX276839_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgttagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagtacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtctgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagkccctttwtacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgctggggctactcccttaacttcatgg
gatatgtaattggaagttggggtgctttaccgcaggaacatattgtactaaaacttaagcaatgttttcgaaaattgcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgcattgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcraaacttatcgggaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcatctgtggagttactctcttttttgcctgctgacttctttcctcctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcacttaggcaagctgttctr
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaattcagacaactattatggtttcacgtttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctatmgcttacagaccaccaaatgcccctatctta
tccacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccgtattatccggaacatgcagtt
actcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcttccaccaatcggcagtcaggaagacagcctactcccatctctccacctttaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470895_FT00000_P-C Feature FT:source KY470895_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 24-B5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcatgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagatttcta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaacttaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaacataagcaggctttcactttctcgccaacttacaaggcctttc
tttgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaaccttcgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatactccaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctccttgacaccg
cctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctt
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacacag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatactgacaacagcgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagtctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF925367_FT00000_P-C Feature FT:source MF925367_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BD-HBV11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctactagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccacggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatacctgaacctttaccccgttgctcggcaacgggcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccgtctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcgcctcaccataccgcactaaggcaagctattttg
tgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattgtcagcagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccgatcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598722_FT00000_P-C Feature FT:source KJ598722_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB65). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctactagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgattccct
cttgttgctgtacaaaaccttcggacagaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcacggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcactaggccatcagcgcctgcgtggaacctttgtggctcctctgccgattcatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctcttccgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtataggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctgctcgacaccg
ccactgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtaag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctctcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattatcgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctcggttcccaatcctctgggattctttcccgatcaccagttggatcctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881963_FT00000_P-C Feature FT:source KY881963_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-09). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaaacaatgttttcgaaaactgcct
ataaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ccatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacactttcggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagttgca
cctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|MZ439730_FT00000_P-C Feature FT:source MZ439730_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2019-Quasi-10). Complete genome. [Riboviria] (length=3200 residues).
ctccaccacattccaccaagctctgctagatcccagagttcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtcggcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgaaactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcctgttcatgt
cccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataaagaatttggagcttc
tgtggagttaatctcttttttgccttctgacttctttcctaatattcgtgatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttgaacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttat
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagagaagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgaagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctg
tccgttcccaatccgctgggattctttcccgatcaccagttggacccggcattcagagccaattcaaacaatcccgattg
ggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctcaggccacgcagtggaa
>gnl|hbvnuc|DQ922651_FT00000_P-C Feature FT:source DQ922651_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcgcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggacgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcactgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatgggacttggctattggtcatcgccgcatgcgtggaacctttaaggctcctctaccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgggggcgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacagcaccatgcaacactcaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtgcattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcagtgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctctctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacgttaccaaatatttgcccttggacaaaggaattaaaccatattatcccgaacatgcagtt
aatcattacttccaaactagacattatttacatactctgtggaaggcgggcattctgtataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctacgcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MG826140_FT00000_P-C Feature FT:source MG826140_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate YNKM40). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctaggtcccaaagtgaggggcctagaccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgtgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttaaaccctcataaaaccaagagatggggctactcccttaacttcatgg
gatatgtcattggaagttggggtaccttaccacaggagcatattgtagaaaaaatcaaacaatgtttccgtaaacttcct
gttaatagacctattgattggaaggtatgtcaacgcattgtgggtcttttaggctttgctgccccttttacacaatgtgg
gtatccagccttgatgccgttgtatgcttgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgcaaacaatatcttaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggggcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtattgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacgtgtataa
agaatttggagcttctgtggagttactctcatttttgccttctgatttctttccatctattcgagatctcctcgacaccg
cctcagctttatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttagaagatccagcatccagggaattagttgtcgg
ttatgtcaatgttaatatgggcataaaacttagacaactattgtggtttcacatctcctgtatcacttttggaagagaaa
ttgtacttgagtatttggtgtcttttggagtgtggattcgcacccctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaccacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggacattatcaccagatgccaacaatttgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctacccttactaaatatttgcccttggataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaagccaggcattatttacatactctgtggaaggcgggtattttatataggagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggcccgtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaatcccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439628_FT00000_P-C Feature FT:source MZ439628_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BO129-2019-Quasi-5). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacctttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaaaatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgttgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctgt
taccaattttcttttatctttgggtatccatttaaaccctaataaaaccaagcgttggggctactccctgaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtaatgaaaatcaagcagtgttttcgaaaacttcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttactgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaccctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
accggttggggcttggccatgggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgttctctctcggaaat
acacctcgttcccatggctgctcggctgtgctgccaactggatcctgcgcgggacatcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctaaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaagatcagacaactattatggtttcacatttcttgtcttacttttggaagagaaa
cggttcttgagtatttggtgtccttcggggtgtggattcgcacaccccccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcttcaatcctgaatggcaaactccctcttttcctgatatacatttgca
ggaagacattattaatagatgtcaacaatttgtgggccctctaaatgcaaatgaaaaaaggagattaaagctaattatgc
ccgctagattttttcctaaccttaccaaatatttgccattggataaaggtattaaaccttattatcctgaacattcagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagagagaaactacacgcag
tgcatcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcctcaaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggt
cagggttcaccccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700577_FT00000_P-C Feature FT:source HQ700577_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To293_2006). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtaaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcacatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcataatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaagaaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctctgggtatacatttgaaccctaataagaccaaacgatggggctattcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaagaacatattatacagaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaargtgtgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttatatgcatgtatycaagctaarcaagctttcactttttcgtcmacttacaargtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggwtggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatctaycgtccccttctycgtytgccgttccggccaaccac
ggggcgcacctctctttacgcsgtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaargactgggrggagttrggggaggagatyagrtta
awgatstttgtaytaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctrttcgagacctcctcgacaccg
cctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttgsamgacccagcatccagggaatyagtggtcag
ttatgtcaacattaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttgaa
agaggacattatcaataggtgtcaacaatatgtgggccctcttaccgttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttagataaaggcattaagccctattatcctgaacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtgaaaatctggcatcctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598674_FT00000_P-C Feature FT:source KJ598674_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB3B1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctgctagatcccagagtgaggggcctatacctccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattggggtccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcactaggccataagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtctggggctctaccgtccccttctttgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttatataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacctggcaacctgggtgggaagtaatttggacgacccagcatcccgagaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggttccacatttcctgccttacttttggaagagcaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattattgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|KU963904_FT00000_P-C Feature FT:source KU963904_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8_5). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcatcaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcatcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttacct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaacgttggggctactctcttaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgacttgtgggtcttctgggctttgctgccccttttacgcaatgtgg
ttatcccgcattaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggcactaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtgttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgcgtggcaaactccctcctttcctcacattcatttgca
ggaagacattatcaatagatgccaacaatatgtgggccctctcacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcgtaccaaatattggcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggtgttctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtctgccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccattactccacctctcagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148538_FT00000_P-C Feature FT:source KP148538_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y26-2-63). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacacattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttggggcatacttcaaagactgtgtatttaaagactgggaggagttaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagtggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964216_FT00000_P-C Feature FT:source KU964216_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 29_3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatccaagagtgaggggcctatatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacattctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcgtgtttcgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatctggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctaacattcatttaca
ggaagacattattgagagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT645037_FT00000_P-C Feature FT:source MT645037_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HB5). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacattccgccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgccttacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttctatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgctcctggttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggaactttaccgcaagaacatattgtcctaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtggggcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctatgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtgttgcccaaggtcttatataaacggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccatccgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctatatcgagaggccttagagtctccggaacattgcacacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttgcaagaccaagcatccagggaattagtagtcaa
ctatgtcaatgttaacatgggcctaaaattcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtatcttttggagtgtggattcgcactcctcctgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaaa
ggaggacattattaatagatgtcaacaatatgtgggccctctcacagttaatgaaaaaaggagattaaaattaattatgc
ctgcaaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagggaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtctgccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattcttccccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacactgacaacagtgccagtagca
cctcctcctgcctccgccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013820_FT00000_P-C Feature FT:source KR013820_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccggcacattccaccaagctctgctagatcccagagtgaggggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttgtcatc
ttcctcttcatcctgccgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacaggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagttggtctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttgggttttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccacggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttgcgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcctaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggaacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcctttttgccttctgacttctttccttctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaagagatgtcaacaatatgtgggccctctgacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccgtaccaattatttgcccttagataaaggcatcaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaattc
aaacaatccagactgggacttcaaccccaacaaggatcaatggccagcggcagaccaggtaggagtgggatcattcgggc
cggggttcactccacctcacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagta
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|MZ439593_FT00000_P-C Feature FT:source MZ439593_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2019-Quasi-14). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagagtgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgtttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaagaagattaaaattgatcatgc
ctgctaggttttatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggcaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttggcgatcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439717_FT00000_P-C Feature FT:source MZ439717_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2013-Quasi-23). Complete genome. [Riboviria] (length=3215 residues).
ctccaacacattccaccaagctctgctagatcccagagtgaggagcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtgg
ttacccagcatcaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtattgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttaatctcttttttgccttctgacttctttcctaatattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttgaacgacccggcatccagggaagcagtagtagg
ctatgtcaacgttaatatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaagagaagattaaaattgatcatgc
ctgctaggttctatcctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgaag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaattc
aaacaatccagattgggatctcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cggggttcactccaccacacggcggtcttttggggtggagccctctggctcaaggcatattgacaacattaccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774283_FT00000_P-C Feature FT:source KC774283_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1062). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgccttacccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttgggctttgctgcaccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtattcaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtttctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcttctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgttggggactctaccgtccccttcttcatctgccgttccggcggaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttttcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggattcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcacacctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcagactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaagctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgtttggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674398_FT00000_P-C Feature FT:source MF674398_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV040029). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggcagttggggtaccttaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgccagcgaattgtggggcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagcaaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaacccttctcggcaccgacaactctgtggtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgacaggtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaagctaggcattatttacatactctgtggaaggcaggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacatggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439396_FT00000_P-C Feature FT:source MZ439396_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN216-2013-Quasi-6). Complete genome. [Riboviria] (length=3209 residues).
ccacattccaccaagctctgctagatcccagagtgaggggcctacactttcctgctggtggctccagttccggaacagta
aaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaagatggagagcac
cacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacaga
gtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacc
tccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcct
cttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttc
caggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgt
tgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatggga
gtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgttt
ggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattacca
attttcttttgtctttgggtatacatttaaaccctaacaaaaccaaacgttggggctactcccttaacttcatgggatat
gtcattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcctataaa
tagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtggttacc
cagcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttctgtgt
aaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactgg
ttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctag
cagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaatacacc
tcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaa
tcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggc
gcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtc
gcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtca
acgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgat
ctttgtactaggaggctgtaggcataaattggtctgtccaccagcaccatgcaactttttcacctctgcctaatcatctc
ttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataaagaat
ttggagcttctacggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccgcctct
gctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactaaggcaagctattctgtgttg
gggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaagctatg
tcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaactgtt
cttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatcttatcaac
acttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgccgacgaaggtctc
aatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaactttac
tgggctttattcttctactgtacctgtctttaatcctgactggcaaactccatcttttcctcacattcatttgaaagagg
atattatcaatagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgcctgct
aggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagttaatca
ttacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcagcgcct
cattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggg
gacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaattcaaaca
atccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtgggagtaggatctttcggcccaggg
ttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctcc
tcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggcca
cgcattgga
>gnl|hbvnuc|FJ899788_FT00000_P-C Feature FT:source FJ899788_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C226-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaagccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccctaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtattaaaactcaagcaatgttttcgaaaactgcct
gtaaatagaccgattgattggaaagtatgtcaaaggattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcttgttttgctcgcagccggtctggagcaaacctcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggcagctagggtgtgctgccaactggatcctgcgcgggacgtcttttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccgtctcggggccgtttggggctctatcgtccccttcttcatctgccgtcccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagagaactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattaatagtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactactgtggtctcatatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtctttcggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacggttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttcgtattccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598671_FT00000_P-C Feature FT:source KJ598671_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB39). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacatttcaccaagctctgctagatcccagagtgaggggcctatacctccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcacggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggcactaggccataagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctctaccgtccccttctttgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttatataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctcctcgacaccg
cctctgccctgtatcgggagggcttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaacctggcaacctgggtgggaagtaatttggacgacccagcatcccgagaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggttccacatttcctgtcttacttttggaagagcaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctatcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgacgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattattgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttggataaaggtattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgttccaaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaagtcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|KY881966_FT00000_P-C Feature FT:source KY881966_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-09). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
caggaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaagaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgctcaagcctccaagctgtgccttgggtagctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctgttcgagatctcatcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcgatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgccattagacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013819_FT00000_P-C Feature FT:source KR013819_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaggctctgctagatcccaaagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttgccgctgt
taccacttttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgtcggggctactcccttcacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttttactttctcgccaacatacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttataggcacggacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagtggatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgtcaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatctggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccagatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttactcttctacggtacctgtctttaatcctgagtggcaaattccctcctttcctcacattcatttgca
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
ctgcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KR013874_FT00000_P-C Feature FT:source KR013874_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgccttacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctttcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
actttcaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactgaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtgggacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgtcgtcctctctcgcaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgagggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactctcagtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggtataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcctgtcctactgttcaagcctccaagctgtgtcttgggtggctttagggcatggacattgacccgtataa
agaatttggggcttctgctgagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccatccaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgtagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttttgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|KU964230_FT00000_P-C Feature FT:source KU964230_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 30_2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttattggttcttctggactcccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgattccct
cttgttgctgtacaaaaccttcggacagaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcacggcaacgggccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcactaggccatcagcgcctgcgtggaacctttgtggctcctctgccgattcatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgattggggctctaccgtccccttctgtgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgtgatctcctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtaag
ctatgtcaatgttaatatgggcataaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattatcgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctctgtgcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ787441_FT00000_P-C Feature FT:source FJ787441_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S157-9). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctctacaacattccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccataccgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgctacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctccttactcagtttactagtgccatttgttcagtggttcatagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctgataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggcttcgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgccctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcgcctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataaggggactcttggactctcagcaa
tatcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcagcaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggccttttggggtggagccctcaggctcaaggcacattgacaacagtgcccgtaaca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|KC774205_FT00000_P-C Feature FT:source KC774205_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2058). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaaccttccaccaaactctgcaagatcccagggtgagaggcttgtatttccctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctggagtccctttttaccgctgt
taccacttttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctactcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaggaacatattatacttaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttttactttctcgccaacatacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtatctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggtacggacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagagaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactttacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccgcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881984_FT00000_P-C Feature FT:source KY881984_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgttggtggctccagttccggaa
caggaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttctaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaagttaattatgc
ctgccaggttctatcctaaccttaccaaatatttgccattagacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JN827422_FT00000_P-C Feature FT:source JN827422_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 5494). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtctgtcaaagaattgtgggtcttctaggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctaccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcagactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttacccttagacaaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacactatttacatactctgtggaaggctggtattttatataagagagaaaccacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ410501_FT00000_P-C Feature FT:source KJ410501_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Occult_HK532). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccaactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatctaaaccctactaaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtgtacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgtccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccgtaccaaatatttacccttagataaaggtattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598691_FT00000_P-C Feature FT:source KJ598691_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SSC19). Complete genome. [Hepadnaviridae] (length=3182 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaatctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgacacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgacaac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaggccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattatagga
ggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcct
actgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttggagcttctgt
ggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctcagctctgtatcggg
aggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctgtgttggggtgagttgatg
aatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcagctatgtcaatgttaatat
gggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatttgg
tgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatcttatcaacacttccggaaact
actgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcg
cagaagatctcaacctcgggaatctcaatgttagtattccttggactcataaggtgggaaactttactgggctttattct
tctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatttacaggaggacattattaatag
atgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgctaggttctatccta
accttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagttaatcattacttcaaaact
aggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcagcgcctcattttgtgggtc
accatattcttgggaacaagagctacagcaccaaacctcgacaaggcatggggacgaatctttctgttcccaatcctctg
ggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattgggacttcaaccccaacaa
ggatcactggcccgaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccaccacacggcggtattttgg
ggtggagccctcaggctcagggcatattgacaacagtgccagtagcacctcctcctgcctccaccaatcggcagtcagga
agacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ562340_FT00000_P-C Feature FT:source FJ562340_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I220). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagaggctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaataggacaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatctccttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaaacacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttatgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttacctcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttataggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
ccacagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccacctaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctttcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774286_FT00000_P-C Feature FT:source KC774286_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1076). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcactggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaattttatgg
gatatgtaattggatgttggggtactttaccgcaagaccatattgtactaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctatcgattggaaagtatgtcagagaattgtgggtctgttaggctttgctgccccttttacacaatgtgg
ctatcctgccttaaagcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctaccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagataaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagctactgtggagttactctcttttttgccttctgacttttttccttccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaacatgggcctaaaaattagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaatcccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598698_FT00000_P-C Feature FT:source KJ598698_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SSC128). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgacacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcacctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggcccgaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtattttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KF485390_FT00000_P-C Feature FT:source KF485390_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate FF11). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatattgttttgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgctcggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcgtctcccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcatcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatccggagcttctgtggagatactctcttttttgccttctgacttctttccttmtattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcwcctcaycatacagcactcaggcaagctattctg
tgttggggkgarttgatgaatctggccacctgggtgggaagtaatctggaagayccagcatccagggaattagtastcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatytggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcrccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacctcaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacacgagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|KY881932_FT00000_P-C Feature FT:source KY881932_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-07). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaaacaatgttttcgaaaactgcct
ataaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcacaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttgcataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagttgca
cctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|MZ675788_FT00000_P-C Feature FT:source MZ675788_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Viet_HBV128). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttggtggacaaaaccttgggacggaaaatgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgtgggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgatgcaaccccc
actggatggggcttggctatcggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactcttccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggatg
atggtctttgtactgggagggtgtacgcatacattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgcggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgtcaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttactttcggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattgataatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcataaaaccttattatcctgaacatgcagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaaccgtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatccgca
ggccatgcagtggaa
>gnl|hbvnuc|GQ377616_FT00000_P-C Feature FT:source GQ377616_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J192). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcacaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctctcacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagctgca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774242_FT00000_P-C Feature FT:source KC774242_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1070). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaagccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
accacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacgtcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggattatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtattaaaactcaagcaatgttttcgaaaactgcct
gtcaatagaccgattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cttagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgatccttctcggggccgtttggggctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcag
ctatgtcaatgttaatatgggcctgaaaattagacaactactgtggtttcatatctcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtctttcggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtggttcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881921_FT00000_P-C Feature FT:source KY881921_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-07). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaatcaaacaatgttttcgaaaactgcct
ataaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactccgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcggaacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggttg
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaaatcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagttgca
cctcctcctgcctccaccaatcggcagtcaggaagacggcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|KJ598709_FT00000_P-C Feature FT:source KJ598709_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB511). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctactagaccccagagtgaggggcctatactttcctgctggtggctccagttccgaaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagttgttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttctgttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggaactttaccgcaagaacatattgtactaaaaatcaagaaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcgaaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcgcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgactcgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
agaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccctggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggttttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctctaccaatcggcagttaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963914_FT00000_P-C Feature FT:source KU963914_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 8_15). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcatcaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcatcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaaacgttggggctactctcttaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgacttgtgggtcttctgggctttgctgccccttttacgcaatgtgg
ttatcccgcattaatgcctttgtatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctaaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggcactaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggatctaccgtccccttctttgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtgttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgcgtggcaaactccctcctttcctcacattcatttgca
ggaagacattatcaatagatgccaacaatatgtgggccctctcacagttaacgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcgtaccaaatattggcccttagacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggtgttctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtctgccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcggcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagcccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccattactccacctctcagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964234_FT00000_P-C Feature FT:source KU964234_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 30_6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcaccaagctctactagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatctcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acggagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagcacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgattccct
cttgttgctgtacaaaaccttcggacagaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagctatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaaacgttggggctactctctcaactttatgg
gctatgtaattgggagttggggtacattgccacaggaacatattgtactgaaaatcaaacaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttatcccgcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcacggcaacgggcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcactaggccatcagcgcctgcgtggaacctttgtggctcctctgccgattcatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaactcatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtactgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttggggctctaccgtccccttctgcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctgctcgacaccg
cctctgccctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatcccgggaattagtagtaag
ctatgtcaacgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctctcgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtgcctgtctttaatcctgagtggaaaactccctcctttcctcacattcatttgca
ggaagacattatcgatagatgccaacaatatgtgggccctctcacagttaacgaaaaacggagattaaaattaattatgc
cggctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctctcggttcccaatcctctgggattctttcccgatcaccagttggatcctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcagtcttttggggtggagtccgcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774228_FT00000_P-C Feature FT:source KC774228_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1023). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctgttgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaagcaatatatgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccattggccatcagcgcgtgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttctcggcaccgacaactctgttgtcctttctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattcggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacactgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtgag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggacattatcaccagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470886_FT00000_P-C Feature FT:source KY470886_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23-G07). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcagtcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaatttcctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatctgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttaggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactagggggctgtaggcataaattggtctgttcgccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcgatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcagatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcgggaagacagcctactcccatctctccacccctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439591_FT00000_P-C Feature FT:source MZ439591_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2019-Quasi-12). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagagtgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgtttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttcttctgtacctgtctttaatcctgactggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattgatcatgc
ctgctaggttttatcctaaacgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148315_FT00000_P-C Feature FT:source KP148315_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y17-24). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcccgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagatattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgc
ctgctaggttctgtcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaagggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgctcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881742_FT00000_P-C Feature FT:source KY881742_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate control-02). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaacgttggggctattcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcctgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcatctaccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccattcttctttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccataccgcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaagttaattatgc
ctgctaggttctatcctaaccttaccaaatatctgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacgcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcattttgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439720_FT00000_P-C Feature FT:source MZ439720_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2013-Quasi-26). Complete genome. [Riboviria] (length=3200 residues).
ctccaacacattccaccaagctctgctagatcccagagttcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtgggtacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggccaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatgccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtctaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataaagaatttggagcttc
tgtggagttaatctcttttttgccttctgacttctttcctaatattcgtgatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttggacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttat
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagagaagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgaagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaagacatggggacgaatctt
tctgttcccaatccgctgggattctttcccgatcaccagttggacccggcattcagagccaattcaaacaatcccgattg
ggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggaaccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctcaggccatgcagtggaa
>gnl|hbvnuc|AB205125_FT00000_P-C Feature FT:source AB205125_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-VH34-1). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctaccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccactat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctattcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcgagcaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggggcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatccagcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtattgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
catctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactacggcaagctattctg
tgttggggtgagttgatgaaccttgccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtagg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcactacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccacgcagtggaa
>gnl|hbvnuc|KU964062_FT00000_P-C Feature FT:source KU964062_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18_14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactcaaactcaagcaatgttttcgcaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctagtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttattatccggaacatgtagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccacacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatactgacaacagtgccagcagcg
cctcctcctgccaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674417_FT00000_P-C Feature FT:source MF674417_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV040065). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaacacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaagaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacccaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcctgagtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttggatggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaat
tttactggactttattcttctactgtacctgtctttaatcctgaatggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttagataaaggcattaaaccttattatcctgaacatgtagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcaccccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaagcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB675675_FT00000_P-C Feature FT:source AB675675_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 10A34). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacaactttccaccaagctctgctagatcccagagtaaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggatcaacaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaccctctatgtttccct
cttgttgctgttcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccacttttcttttgtctttgggtatacatttaaatcccaataaaacaaagcgttggggctattcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaagtctgtcaaagaattgtgggtctgttgggctttgctgccccatttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggtactgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactattcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttcagtggagttactctcttttttgccttctgacttctttccttctattcgagatctactcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcaccgcaccatacagcactcaggcaagctattctg
tgttggggcgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattggtagtcag
ctatgtcaatgttaatatgggcctaaaaataagacaactattgtggtttcacatttcctgtcttactttcggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacacataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaacggagattaaaattaataatgc
ctgctaggttttaccctaactttaccaaatacttgccattagataaaggcattaaaccttattatcctgaacatgtagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattttatataagagagaaactacacgcag
cgcctcattttgcggttcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagcgggagcattcgggc
cggggttcaccccaccacacggcagtcttttggggtggggccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774187_FT00000_P-C Feature FT:source KC774187_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz1027). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaaatcaagcaatgttttcgtaaattacct
gtaaacagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacgcaatgtgg
ctatcctgccttgatgcctttgtatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcctgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgacccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccttctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattagagatctcctcgacaccg
cctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaat
tttactgggctatattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaagacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgtcaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtgttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT645051_FT00000_P-C Feature FT:source MT645051_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HN24). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttctatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccat
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcaacatcttgagcccctttttacctctat
tactaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggttctttaccgcaagaacatattgtactgaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgaagcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggaatctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgt
acgtcgcatggagaccaccgtgaacgcccaccaggccttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccgggaccatgcaactttttcacctctgcctaatc
atctcatgttcaggtccaacggttcaaccctccaacctgggccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactttcttttttgccttctgacttctttccttccatgcgagatctcatcgacaccg
cctctgctctgtttcgggaggccttagagtctccggaacattgttcagctcaccatacagcactcaggcaagctattctg
tgctggggtgagttgatgaatctggccacctgggtgggaggtaatttagaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaattcagacaactaatgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacgttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475312_FT00000_P-C Feature FT:source GQ475312_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR8CHB). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcatttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctcattcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcatcatacagcactcaggcaagctattctg
tgttggggcgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
cggttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcaaggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX504536_FT00000_P-C Feature FT:source JX504536_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate WY-HZ-44). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcaaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactgaaaatcaagcaatgttttcgcaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggccttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgccctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatcctgcatccagggaattggtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgctagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctccttctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK534596_FT00000_P-C Feature FT:source MK534596_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 550). Complete genome. [Riboviria] (length=3215 residues).
ctccagcactttccaccaagctctgctagatcccagagtgagaggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
ttccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaacgaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctgtgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttaggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccatataa
agaatttggagcctctgcggagttactctcttttttgccttctgacttctttccttccattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattttg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaacaaatgcccctatctta
tccacacttccggaaactactgttgttagacaacgatacaggtccactagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaaccccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggccaaccaggtaggagtgggatcattcggtc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939626_FT00000_P-C Feature FT:source EU939626_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D158). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaaccttttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactmtcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccamttttcttttgtctttgggtatacatttaaaccccaataaaacaaagcgttggggctactcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttttactttctcgccaacatacaaggcctttc
tatgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccaccagcgcatgcgtggaacctttgcggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggtacggacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgtccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgaaactttttcacctctgcctaatc
atctcttgttcatgtcctactattcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagaccctgcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatctggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccctattcttgggaacaagagctacagcatgggaggtcggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctacgcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148548_FT00000_P-C Feature FT:source KP148548_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y26-3-19). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacacattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttacagactgggaggagttaggggaggagattaggtta
aaggtctatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcgatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaactttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggag
>gnl|hbvnuc|KU964063_FT00000_P-C Feature FT:source KU964063_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 18_15). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctgtattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcgtcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactcaaactcaagcaatgttttcgcaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggcctctatcgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacctagtcttgcccaaggtcttacataagcggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggacattatcaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccttattatccggaacatgtagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccacacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcagactcagggcatactgacaacagtgccagcagcg
cctcctcctgccaccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774179_FT00000_P-C Feature FT:source KC774179_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SX11xa1580). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccccgactttccaccaagctccgctaaatcccagagtgaggggcctgtactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttaaatcctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaatttcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttatatgcatgtatacagtctaagcaggctttcactttctcgccaacatacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaccctcatcggaaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagctaccgtggagttactctcttttttgccttctgacttctttccttcagtacgagatcttctcgacaccg
cctcagctctgtatcgggatgccttagagtctccggaacattgttctcctcaccatacagcactcaggcaagcaattctg
tgctggggggaactaatgactctagctacctgggtgggtgttaatttggaagatccagcatctagggacctagtagtcag
ttatgtcaacactaatatgggcctaaagttcagacaactcttgtggtttcacatttcttgtctcacttttggaagagaaa
ctgttatagagtatttggtgtctttcggagtgtggattcgcactcctctagcttacagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttacggggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcatattcatttgca
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcactatttacatactttgtggaaggctggcatcttatataagagagaaactacatgcag
cgcctcattttgtgggtcaccatattcttggggacaagagctacagcatgggaggttggtctccaacacctcgacaaggc
aaggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccgtgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacatggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148564_FT00000_P-C Feature FT:source KP148564_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y26-3-57). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcactaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacacattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctca
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439349_FT00000_P-C Feature FT:source MZ439349_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN216-2004-Quasi-18). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatctttggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctcataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtcattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtacgcatgtatacaagccaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcgggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagcaaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtaggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939578_FT00000_P-C Feature FT:source EU939578_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C119). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacttgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaaacaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtctgttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtccccttcttcatctgccgttccgaccgtccac
ggggagaacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagctgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggctttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatacgctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccacgcagtggaa
>gnl|hbvnuc|FJ386670_FT00000_P-C Feature FT:source FJ386670_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S454). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtkgtggacttctctcaattttctagggggagcacccacgtgtcgtggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggctgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgccgacgcaaccccc
actggatggggcttggctattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggrgcgaaacttatcggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagaccaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcwtgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttcctaacattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctatcctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtctaacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagaactcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
ttcactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacccgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatttctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439498_FT00000_P-C Feature FT:source MZ439498_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2019-Quasi-7). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaagccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaagatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgaatgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtgcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcattaaggaagacagcgtactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|FJ562306_FT00000_P-C Feature FT:source FJ562306_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I196). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaaactctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcacttaccaacctcttgtcctccaacttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggatcatcaactaccagcacgggaccatgcaagacatgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaagcgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactcaaacaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggggcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgtttgggtctctaccgtccccttctgactctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagacctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcacgctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagatcaagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacatcattgatagatgtcaacaatatgtgggccctcttacaattaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KX765821_FT00000_P-C Feature FT:source KX765821_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate PID:0211). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgacttctgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggaaggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttatccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctccgtaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacactg
cctcagctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcatattcatttgaa
agaggacattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttactatcccgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtatcttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcacaccaccccacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctactgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439702_FT00000_P-C Feature FT:source MZ439702_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2013-Quasi-8). Complete genome. [Riboviria] (length=3200 residues).
ctccaacacattccaccaagctctgctagatcccagagttcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggccaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcttgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataaagaatttggagcttc
tgtggagttaatctcttttttgccttctgacttctttcctaatattcgtgatctcctcgccaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttgaacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctattgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactattgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttat
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagagaagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatccgctgggattctttcccgatcaccagttggacccggcattcagagccaattcaaacaatcccgattg
ggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ899767_FT00000_P-C Feature FT:source FJ899767_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C26-2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtcagaggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgtctcacccatatcgtcaatcttctcgaggactggggaccctgcgccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagaatctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttatctttgggtattcatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaagctcaaagaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaggctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtctggtctctgccaagtgtttgctgacgtaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcggcttgttttgctcgcagccggtctggggcaaatcttatcggaaccgacaactccgttgtcctctctcggaaat
acacctcatttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccatgaacgcccaccgggccttgcccaaggtcttacataagaggactcttggactcccagcac
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagatgaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccggcaccatgcaactttttcacctctgcctaatc
atctcttgtgcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgctggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagatccagcatccagggaatcagtagtcgg
ctatgtcaatgttaatatgggcataaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcctttggagtgtggatccgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggagacttgtgttgttagacaacgaggcaggcccactagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattacgattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatccggaatatgcagtt
aatcattacttcaaaaccagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttcggttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
caggggtcaccccgccacacggcggtcttttggggtggagccctcaggctcagggcatattgaccacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctgagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|MZ439283_FT00000_P-C Feature FT:source MZ439283_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BL71-2007-Quasi-14). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttcttgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttctatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaccaccttgaatccctttttaccgctat
tactaattttcttatgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccagggctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatagcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttccgttcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgtacacctcaccacacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaagttcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcaagcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaccacgaggcaggtcctctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctcttacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccccacggcaaccttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcccacgcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439735_FT00000_P-C Feature FT:source MZ439735_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2019-Quasi-15). Complete genome. [Riboviria] (length=3200 residues).
ctccagcacattccaccaagctctgctagatcccagagttcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtcggcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtatgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggccaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatactgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcctgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataaagaatttggagcttc
tgtggagttaatctcttttttgccttctgacttctttcctaatattcgtgatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttggacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctattgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttat
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagagaagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctt
tcggttcccaatccgctgggattctttcccgatcaccagttggacccggcattcagagccaattcaaacaatcccgattg
ggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagcaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagccatcctcaggccatacagtggaa
>gnl|hbvnuc|JN827414_FT00000_P-C Feature FT:source JN827414_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 0015). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacatttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttatgtctttgggtatacatttgaaccctaataaaaccaagcgttggggatactccctaaatttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtgcaaaaaatcaggcagtgttttcggaaacttcct
gtaaatagacccattgattggaaagtatgtcagagaattgtgggtcttttgggcttcgctgccccttttacacaatgtgg
ttatcctgccttattacctttgtatgcatgtatacaagctaagcaggctttttctttctcgccaacttataaggcttttc
tgtgtaaacaatacctgaccctttaccccgttgccaggcaacggcccggtctgtgccaagtgtttgctgacgcaaccccc
actggttggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaagt
acacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgggggcgcttggggctctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccttgaacgccaaccaagtcttgcccaaggtcttacataagagaactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
cctctgctctctatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggttcttgaatatttggtgtccttcggggtgtggattcggacaccccccgcatataggccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgttcctgtctttaatcctgaatggcaaactccctcttttcctgatatacatttgca
ggaggacattattaatagatgtcaacaatttgtgggccctcttaatgtaaatgaaaaaaggagattaaagttaattatgc
ctgctagattttttcccaaccttaccaaatatttgcccttagagaaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcatactatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattctgcaaaacctcgcaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccgggggcctggcaggtaggagctggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774314_FT00000_P-C Feature FT:source KC774314_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa2033). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagcgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctatcggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaattctgttgtcctctctcggaaat
acacctcctatccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aagatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcacccctcctgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470883_FT00000_P-C Feature FT:source KY470883_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23-6). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgttctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttaggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcaaaaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatccctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|D50520_FT00000_P-C Feature FT:source D50520_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtattacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctacgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgcattgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttggccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcggcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
ccactgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtc
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagaagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774238_FT00000_P-C Feature FT:source KC774238_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1052). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcatcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcaccattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaatcccaataaaacaaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtactcaaaatcaaacaatgttttcgaaaacttcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgctgccggtcaggtgcaaaacttatcgctacgcacaactccgttgtcctctctcagaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgttcaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatcttctcgacaccg
cctctgctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttagtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtttttaaccctgagtggcaaactccctcctttcctcatattcatttgca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttaccattagataaaggcattaaaccttattatcctgaacattcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaaggtggcattttatataagagagaaactacccgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccccgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaagcaaatcaggtaggagtgggagcatttgggc
cagggttcacccctccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgtctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803774_FT00000_P-C Feature FT:source KJ803774_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY98472). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
cattccaggatcatcaaccaccagcacgggaccatgcaaaacctgcacgactactgctcaaggaacctctatgtttccct
catgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaataccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggttctgggggccaaaactgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccgcaggaacatattgtacaaaaaatcaaacaatgttttaggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatttgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctaccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagctgggggaggagatgaggtta
aaggtctttgtactgggaggctataggaataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaactagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttactctttggagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccttcttttccacatattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagct
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatccgca
ggccatgcagtggaa
>gnl|hbvnuc|JQ040151_FT00000_P-C Feature FT:source JQ040151_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G79). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttwtacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggcactttgccgcaggaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtaggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccctgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcatttc
tgtgtaaacaatatttgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcrgcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctatcgtccccttcttcgtctrccgttccggccgaccac
gggrcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaraccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaaatttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttrgggcatggacattgacccatataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctrtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccatcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatytcctgtcttacttttggaagagaaa
ctgtccttgagtatttggtgtcttttggagtgtggattcgcactcctyccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaagacattattaatagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagactaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgccyttggacaaaggcattaaaccgtattatcctgammatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
ygcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctktctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccaygcagtggaa
>gnl|hbvnuc|KU963898_FT00000_P-C Feature FT:source KU963898_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 7_13). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaataggcctattgattggaaggtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaacttatcggcaccgacaactctgttgtactctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
atgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcgcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacatcg
cctcagctctgtatcgggaggccttagagtctccggagcattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT645010_FT00000_P-C Feature FT:source MT645010_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GX31). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacatttcatcaagctctgctagatcccagagtaaggggcctatacttccctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcgacgaaaatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccgaattgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaacgagcacgggaccatgcaagacctgcacaactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaggccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactccctaaacttcatgg
ggtatgtaattggaagttggggtaccttgccacaggaacatattgtactgaaaatcaagaaatgttttcgaaaacttcct
gtaaataggcccattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgctccttttacacagtgtgg
ttatcctgccttactccctttgtattcatgtatacaagctaagcaggctttcactttttcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgtcaggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctttctcggaaat
acacctcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggatctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctaaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttcctaatattcgagatctcctcgacaccg
cttctgctttgtatcgggaggccctagagtctccggaacattgttcacctcaccatacagcaataaggcaagctattcta
tgttggggtgagttaatgaacttggccacctgggtgggaggaaatttgcaagaccaagcatccagggaagcagtagtcgg
ctatgtcaatgttaatatgggcataaagatcagacaactattgtggtttcacatttcttgtcttacttttggaagacaaa
cggttcttgaatatttggtgtccttcggggtgtggatccgtacaccccccgcatataggccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttgatatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgttcctgtctttaatccggagtggcaaactccctcttttcctgatatacatttgca
ggaggacatcattgatagatgtcaacaatttgtgggccctcttaatgcaaatgaaaaaagaagattaaagttaattatgc
ctgctagattttttcctaaccgtaccaaatatttgcccttagataaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagatacagcatgggaggttattctgcaaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgactacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagacacactcatcctca
ggccatacagtggaa
>gnl|hbvnuc|GQ377617_FT00000_P-C Feature FT:source GQ377617_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J193). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattatgtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcatatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgtagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598645_FT00000_P-C Feature FT:source KJ598645_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB210). Complete genome. [Hepadnaviridae] (length=3200 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatatagtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctaccctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcttttc
tttgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctcccggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtctgggactctaccgtccccttcttcctctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtccgttcaccagcaccaggcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcttgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcaccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaatccagattg
ggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccac
cacacggcggtcttttggggtggagccctcaggctcagggcatattaacaaccgtgccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KR013835_FT00000_P-C Feature FT:source KR013835_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcgcccatatcgtcaatctactcgaggactggggaccctgcaccgaatatggag
agcactacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctcc
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagctggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttgcccaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggggcgaaactcatcggcaccgacaactctgttgtcctctctcggaagt
acacctcctttccacggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcac
tgtcaatgaccgaccttgaggcatacttcaaagactgtgtatttacagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctatatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgtgcttgagtatttggtgtcttttggagtgtggattcgcacacctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgctgaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatggatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattggtcatgc
ctgctaggttctatcctaaccttaccgaatatttgcccttagataaaggcattaaaccttattatcctgaacatgtagtt
aatcattgcttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcttcattttgtgggtcaccatattcctgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctctcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggcctgcggcaaaccaggtaggagtgggatcattcgggc
cagggttcaccccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475349_FT00000_P-C Feature FT:source GQ475349_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR45HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacttaaaattaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgcaccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatcaaagaaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggactttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctctttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aagatttatgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtccccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcccaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcccgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggccttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagaaagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ924614_FT00000_P-C Feature FT:source GQ924614_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate M31). Complete genome. [Hepadnaviridae] (length=3206 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattactgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaagttgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactttaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattatcttt
gtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgt
tcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttgg
agcttctgtggagttactctcttttttgccttctgacttttttccgtctattcgggatctcctcgacaccgcctctgctc
tgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctgtgttggggt
gagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaagctatgtcaa
tgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcctgtcttacttttggaagagaaactgttctag
agtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatcttatcaacactt
ccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatc
gccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaactttactggg
ctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaaagaggatat
tattaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgattatgcctgctaggt
tctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttactatcctgaacatacggttaatcattac
ttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcagtgcctcatt
ttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacg
aacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattcaaacaatcc
agattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggagcattcgggccagggttca
ctccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcgcctcctcct
gcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgca
gtggaa
>gnl|hbvnuc|KC774337_FT00000_P-C Feature FT:source KC774337_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxn1019). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccctgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttagaaaattgcct
gtaaatagacctcttgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttgtatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaaacctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcggcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaattagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtgcctgtctttaatcctgagtggcaaactccttcctttcctcacattcatttaca
ggaggacatcattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaagatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccacctcacggcggtgttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ023639_FT00000_P-C Feature FT:source FJ023639_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_C04-0968). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaacacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatctyctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacrggaggggtttttctygttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
rtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcattaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttagaagacccmgcatccagggaattagtagtgag
ctatgtcaatgttaacatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagaatatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacggggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctatctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaactaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggakcattcgggc
cagggtttactccaccacacggcaatcttttggggtggagccctcaggctcaaggcatawtgacaacaakgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctgagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HM011481_FT00000_P-C Feature FT:source HM011481_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3212 residues).
ctccacaacattccaccaagctctgttagatcccagagtgaggrgcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttcttgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtctgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggatggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgctggggctactcccttaacttcatgg
gatatgtaattggaagttggggtgctttaccgcaggaacatattgtactaaaacttaagcaatgttttcgaaaattgcct
gtaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgcattgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaamcttatcgggaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcatctgtggagttactctcttttttgcctgctgacttctttcctcctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaattcagacaactattatggtttcacgtttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtatcttttggagtgtggattcgcactcctatcgcttacagaccaccaaatgcccctatctta
tcaacacttcckgaaactactgttattagacgacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
actcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcttccaccaatcggcagtcaggaagacagcctactcccatctctccacctttaagagacagtcatcctcw
ggcgcagtggaa
>gnl|hbvnuc|KP148492_FT00000_P-C Feature FT:source KP148492_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y177-35). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggacgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcttgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttaggggaggagatactagga
ggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgtcct
actgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttggagcttctgt
ggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctttgtatcggg
aggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctgtgttggggtgagttgatg
aatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaagctatgtcaatgttaatat
gggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaactgttctcgagtatttgg
tgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatcttatcaacacttccggaaact
actgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcgtcg
cagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttattct
tctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaaagaggatattatcaacag
atgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgcctgctaggttctatccta
accttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagttaatcattacttccaaact
aggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacgcagtgcctcattttgtgggtc
accatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaacctttct
gttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattcaaacaatccagattggga
cttcaaccccaacaaggatcattggccagcggcaaaccaggtaggagtgggatccttcgggccagggttcactccaccac
acggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcgcctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|HQ700558_FT00000_P-C Feature FT:source HQ700558_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_BD5375_2001). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtaaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataagaccaagagatggggctattcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaagaacatattagactaaaaatcaaaaactgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtattcaagctaaacaagctttcactttttcgtcaacttacaaagtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggggcgaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtccccttctccgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagacctcctcgacaccg
cctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagtggtcag
ttatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttgaa
agaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgccgttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaatctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774295_FT00000_P-C Feature FT:source KC774295_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa1207). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtgctgaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctatgggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttgggactctttcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatacgctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcgtccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964329_FT00000_P-C Feature FT:source KU964329_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 37_12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgagaggcctatacagtcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcaccgagcatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcttggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttataggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttaggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcgattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactcctgtggtttcacgtttcctgtcttacttttggaagagata
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaagattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccatattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatcccgattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggtccaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HM011486_FT00000_P-C Feature FT:source HM011486_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccaragtgaggggcctatacttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaagatggag
ascaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctcgactcgtggtggacttctctcaattttctaggggragcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaayttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctacgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaycttgaatccctttwtaccgctrt
taccaattttcttytgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcgaaaacttcct
ataaatagacctattgattggaaagtgtgtcaaagaattgtgggtcttttgggttttgctgctccctttacacaatgtgg
ttacccagccttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatrggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcacrgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcctaaggtcttatataagaggactcttggactctcaacaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcyattcgtgatctcctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactraggcaagctattstg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaakyagtagtaag
ctatgtcaatgttaatatgggcctraaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcycgyttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggamtctcratgttagtatcccttggactcataaggtgggaaac
tttactggrctttattcttctackgyacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaacmgtaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatayagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaaccctctgggattctttcccgatcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacttaaaccccaacaaggatccatggccagcggcaarccaggtaggrgtgggagcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcrtattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagrcagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgmagtggaa
>gnl|hbvnuc|HQ700576_FT00000_P-C Feature FT:source HQ700576_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To250_2006). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccaragtaargggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcactgaacatggag
aacacaacatcaggattccyaggacccctgctcgtatyacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
gcttccaggaacatcaactaccagcacgggaccatgcaagacctgcamgattcctgctcaaggaacctctatgtttccct
catgttgctgtwcaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacckctat
taccaattttcttttgtctttgggtatacatttaaacmctrataagactaaaagatggggctattcacttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaagaacatattatacwaaaaatcaaacamtgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtctgttgggctttgctgccccatttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtattcaagcgaaacaagctttcactttttcgycmacttacaaagtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctccgctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcaaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctmcgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggatstaccgtccccttctycgtctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcayctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggtattgcccaaggtcttgcataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagcttagatta
awgrtstttgtactaggaggctgtaggcataaattggtctgttcaccagyaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttcttcccatcgattcgagatctcctcgacaccg
cctcagctctgtaccgggaggctttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggcagtaatttggaagacccagcatccagagaattagtggtcag
ttatgtcaacrttaatatgggcctaaaaatcagacaactattgtggtttcacatttcytgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaygcagaggcaggtccactagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttgaa
agaggacattatcaataggtgtcaacaatwtgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
cagctaggttttatcctaaccttaccaaatatttgcctttagataaaggcattaaaccctattatcctgaacacgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaatctggcattctatataagagagaaactacacgcag
cgcctcattttktgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccwgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcayawtgacaacagtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctackcccatytctccaccgctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JX661497_FT00000_P-C Feature FT:source JX661497_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SH1228-C14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccataacattccaccaagctctgctagaccccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggaatacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaacaaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctctgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacacattgtactaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttggggtttgctgccccttttacacaatgtgg
ctatcctgccttaaagcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggttggggcttggctattggccatcgccgcatgcgtggaacctttgtggctccgctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaactgatcggaacagacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggcctctgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctagtc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgaccattataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
ccacagctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagcttttctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctgtattcttctactgtacctgtctttaatcctgagtggcaaactccttcttttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagctaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcgatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgtctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggctgcgcagtggaa
>gnl|hbvnuc|KY470925_FT00000_P-C Feature FT:source KY470925_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CFQ-116). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcactaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acctccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttgccacaggaacatattgtacacaaaatcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgccccttttacacaatgtgg
ttatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccgacaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataacaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacacatataa
agaatttagagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggatttagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacagctattgtggtttcacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggctctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcggtc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439608_FT00000_P-C Feature FT:source MZ439608_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BO129-2007-Quasi-8). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacatttcatcaagctctgttagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaaaatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagaggctagactcgtggtggacttctctcagttttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggatcatcgacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgtaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaagcgttggggctactccctaaacttcatgg
ggtatgtaattggaagttggggtaccttgccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgctccttttacacaatgtgg
ttatcctgccttactccctttgtattcatgtatacaagctaagcaggctttcactttttcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaagt
acacctcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctaaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgaccactataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cttctgctctgtatcgggaggccttagagtctccggaacattgttcatatcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaacgttaatatgggcctaaagatcagacaactattgtggtttcacatttcttgtcttacttttggaagagaag
tggttcttgagtatttggtgtcctttggggtgtggatccgtacaccccccgcatatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgaggcaggtcccctagaagaagaactccctcgcctcgccgacgaag
atctcaatcgccgcgtcgcagaagatctaggtctcgggactctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgttcctgtctttaatcctgagtggcaaactccctcttttcctgatatacatttgaa
ggaggacattattgatagatgtcaacaatttgtgggccctcttaatgtaaatgaaaaaagaagattaaaattaattatgc
ctgctagattttttcctaaccttaccaaatatttgcccttagataaaggtattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttgcatgccctttggaaggctggcattctatataagagagaaactacacgcag
tgcctctttttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcaaaacctcggaaaggc
atggggacgaatctgtctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccggaggcctggcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttgggttggagcccgcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|MZ439635_FT00000_P-C Feature FT:source MZ439635_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate BO129-2019-Quasi-12). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacctttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaaaatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccagggtatgttgcccgtttgtcctct
aattccaggatcatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttatctttgggtatacatttgaaccctaataaaaccaagcgttggggctactccctaaacttcatgg
ggtatgtaattggaagttggggtaccttgccacaggaacatattgtactaaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgctccttttacacaatgtgg
ttatcctgccttactccctttgtattcatgtatacaagctaagcaggcttttactttttcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctaaccaggtcttgcccaaggtcttatataagaggactcttggactctcggcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggaattgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccctataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctctgctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaagatcagacaactattatggtttcacatttcttgtcttacttttggaagagaaa
cggttcttgagtatttggtgtccttcggggtgtggattcgcacaccccccgcatacaggccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtcttcaatcctgaatggcaaactccctcttttcctgatatacatttgca
ggaagacattattaatagatgtcaacaatttgtgggccctctaaatgcaaatgaaaaaaggagattaaagctaattatgc
ccgctagattttttcctaaccttaccaaatatttgccattggataaaggtattaaaccttattatcctgaacattcagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagagagaaactacacgcag
tgcatcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcctcaaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcctgcccgaccatcagttggacccggctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggc
cagggttcaccccaccgcacggcggtcttttgggttggagcccgcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KP148532_FT00000_P-C Feature FT:source KP148532_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Y26-2-44). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaattctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacacattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcgcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatgcttcaaagactgtgtatttacagactgggaggagttaggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaggctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtaggccctcttacagttaatgaaaaaagaagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataaaagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggacatgcagtggaa
>gnl|hbvnuc|KY363286_FT00000_P-C Feature FT:source KY363286_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate geno20.3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
aaagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagcccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctattcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaattcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttggtgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatcttaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccctactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctcacggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagagtaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacctatataa
agaatttggagcttctgtggagttactctcttttttgcctactgacttctttccttcaattcgagatctcctcgacaccg
ccacagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcgg
ctatgtcaatgttaatatgggcctgaaaatcagacaacttttgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactcccccgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttccttccattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcggac
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ671248_FT00000_P-C Feature FT:source MZ671248_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Viet_ocHBV/chr371). Complete genome. [Riboviria] (length=3215 residues).
ttccacaacatttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgtaccgaaaatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtactgaagatcaagaagtgttttcgaaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttattacctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctcacggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccaaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcac
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacgtgtcttgtcttacttttggaagagaaa
cggttcttgagtatttggtgtccttcggggtgtggattcgcacaccccccgcatataggccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctgatatacatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttaatgtaaatgaaaaaagaagattaaaattagttatgc
ctgctagattttttcctaaccttaccaaatatttacccttagataaaggtattaaaccttattatcctgaacatatagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcaact
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB117758_FT00000_P-C Feature FT:source AB117758_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV-CB10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccgcaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaactgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctcgcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgaccgaccac
ggggcgtacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggatg
atggtctttgtactgggagggtgtacgcatacattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgcggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccatctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgtcaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttactttcggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatatcatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattgataatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctgtccacctgtaagagacagtcatactca
ggccatgctgtggaa
>gnl|hbvnuc|AB195938_FT00000_P-C Feature FT:source AB195938_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaggctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggttttccttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggatatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacagttcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaactccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccgccaagtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcctgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaagacccagcatcccgggaattagtagtcgg
ctatgtcaatgttaatatgggcctgaaactcagacaactattgtggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactccttccgcttacagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccgtattatcctgaaaatgcagtt
aatcattacttcaaaactagacattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcggat
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcgtcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|KR013853_FT00000_P-C Feature FT:source KR013853_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgccagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgtcgataagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtactccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccttcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
cgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacccttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatgctgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaagtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggtataaattggtctgtacaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaattcggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcagcaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB367403_FT00000_P-C Feature FT:source AB367403_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate LAMr Pt. 12/Adefovir-treated Pt. 17). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagtacgggaccatgcaaaacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccccaataaaaccaaaagatggggatactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtactaaaaatcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacagtgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctttctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgcctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaagaagattaaaattaattatgc
ctgctaggttttatcccaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggccaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670273_FT00000_P-C Feature FT:source AB670273_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HCC pt No.37). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaggttctgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgtgggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaaytcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccacaagaccatattgtacaaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatacatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtccgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattstg
tgttggggtgagttgatgaatctggccacttgggtgggaagtaatttggaagacccagcatcccgggaattagttgtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctccagcttacagaccaccaaatgcccctatccta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcactgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaactttaccaaatatttgcccttggataaaggcattaaaccgtattatcctgacaatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattttatataagagagaaactacacggag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcatttggac
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatgttgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccacgaagtggaa
>gnl|hbvnuc|MZ439654_FT00000_P-C Feature FT:source MZ439654_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2004-Quasi-15). Complete genome. [Riboviria] (length=3200 residues).
ctccaacacattccaccaagctctgctagatcccagagttcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcctgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggagcatggacattgaccactataaagaatttggagcttc
tgtggagttactctcttttttgccttctgacttctttccttccattcgtgatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcagctcaccatacagcactaaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaattagtagtaggctatgtcaacgttaa
tatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttac
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagaggagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatccgctgggattctttcccgatcaccagttggacccggcattcagagccaattcaaacaatcccgattg
ggatctcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtgggatcattcgggccggggttcactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|FJ023658_FT00000_P-C Feature FT:source FJ023658_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C2_M04-1116). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgctgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtccgcg
ctgaatcccgcggacgacccctctcggggccgtttgggactctaccgtccccttctgcgtctgccgttccgcccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagagaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagaatatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctaacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacggtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctattcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaagatcaatggccagcagcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ598635_FT00000_P-C Feature FT:source KJ598635_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate SHB1C2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccaccacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttcacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctaccctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcttttc
tttgtaaacaatatctgaacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctcccggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtctgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtccgttcacaagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttcggacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggttccacatttcctgtcttacttttggaagagaaa
ccgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaaccgtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctcagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439475_FT00000_P-C Feature FT:source MZ439475_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2013-Quasi-21). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttccc
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagtttaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcctgctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcgatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ089783_FT00000_P-C Feature FT:source DQ089783_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HK1402). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttataccgctat
taccaattttcttgtgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcgaaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgtttgggactctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttttttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcagtctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttccgttcccaatcctctgggattctttcccggtcaccagttggacccgacattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagaaagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|GQ475328_FT00000_P-C Feature FT:source GQ475328_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR24LC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgatagatcccagagtgagaggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggatcatattatacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctctgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctttctcgcaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggaattactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcttgtctcacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcatacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaatattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcacccctccacacggaggtcttttggggtggagccctcaggcccagggcatattgacaacagtgccagctgcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcctatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439584_FT00000_P-C Feature FT:source MZ439584_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2019-Quasi-5). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcaccttcttgttggttcttctggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgtttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaagaagattaaaattgatcatgc
ctgctaggttttatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacttcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|DQ536410_FT00000_P-C Feature FT:source DQ536410_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate JeF339). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctctattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaacaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaactcaagcaatgttttcggaaactgcct
gtaaatagacccattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
gtatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgtcaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctctttcccatggctgctcgggtgtgctgccaattggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtcccctgctccatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccatgaacgcccatctggtcttgcccaaggtcttacatcagaggactcttggactctccgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagccctcaggcaagctattctg
tgttggggtgagttgatgaatctggcaacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcgcatttcctgtcttacttttggaagagaaa
ctgttctcgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcacttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU963874_FT00000_P-C Feature FT:source KU963874_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 6_4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatctgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccacaagaacatattgtacaaaaaatcaagcaatgttttagaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacacaagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgtgcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatgtggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaacctcaccaaatatttgcccttggataaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaaccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaacac
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT645007_FT00000_P-C Feature FT:source MT645007_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GX28). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacatttcatcaagctctgctagatcccaaagtgaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgaatactgcctctcccatatcgtcaatcttctcgaagactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatcctcacaatacc
acagagtctagactcgtggtggacttctctcagttttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcattttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggatcctcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaagcgttggggctactccctaaacttcatgg
ggtatgtaattggaagttggggttccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcgaaaacttcct
gtgaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttactccctttgtatgcatgtatacaagctaagcaggctttcactttttcgtcaacttacaagacctttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaagt
acacctcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggatctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgctaaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttacagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccttataa
agaatttggagcttctgcggagttaatctcttttttgcctgctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccagaacattgttcacctcaccatacagcaataaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaggcaatttgcaagaccaacaatccagagaattagtagtcgg
ctatgtcaatggtaatatgggcctaaagttcagacaactattgtggtttcacgtttcttgtcttacttttggaagagaca
cggttcttgagtatttggtgtccttcggggtgtggatccgtacaccccccgcatataggccaccaaatgcccctatctta
tcaacacttccggaaacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgatcctgtctttaatcctgagtggcaaactccctcttttcctgatatacatttgca
ggaggacattattaatagatgtcaacaatttgtgggccctcttactgtaaatgaaaaaaggagattaaagttaattatgc
cggctagattttttcctaaccttaccaaatatttgcccttagataaaggtataaaaccttattatcctgaacacacagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttcaaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttgcccgaccatcagttggacccggctttcggagccaattc
aaacaatccggattgggacttcaatcccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggtggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatacagtggaa
>gnl|hbvnuc|EU717215_FT00000_P-C Feature FT:source EU717215_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Q67K-1). Complete genome. [Hepadnaviridae] (length=3197 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggactcctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttccagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgactcctgccaacggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgtacttgcattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgaaattggaagttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgtaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctataggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ttgaatcccgcggacgacccgtctcggggccgtctgggactctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgcgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaacttggaagaccaagcatccagggatttagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacagatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaaccctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcactatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatatacttgggaacaagagctacagcaaacctcgacaaggcatggggacgaatctttct
gttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactcaaacaatccagattggga
cttcaaccccaacaaggatcattggccagaggccaatcaggtaggagcgggagcattcgggccagggttcaccccaccac
acggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacagtgccagtagcacctcctcctgcctccacc
aatcggcagtcaggaagacagcctactcccatctctccacctctaagagaaagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|GQ377526_FT00000_P-C Feature FT:source GQ377526_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate J27). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctactagaccccagagtgaagggcctatactttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcagcgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactacaagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctactaaaaccaaacgatggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtattgaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaaagcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tctgtaaacaatatatgaacctttaccccgttacccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
atgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcagctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggatgagactaggtta
atgatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgctcacctcaccatacagcactcaggcaagccattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaagcagtagtcag
ctatgtcaatgttaatatgggcctaaaactcagacaaatactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaagactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttccgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggatcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatatcgacaacggtgcctgtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439330_FT00000_P-C Feature FT:source MZ439330_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TX271-2013-Quasi-19). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacatttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcatgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaagcgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtactaaaaattaagcaatgttttcgtaaactgcct
gttaatcgacctattgattggaaagtatgccaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgcactactacctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcatttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggccaggcctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatattgcggaact
ccttgcagcttgttttgctcgcagccggtctggggcaaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggatttatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctattcgagatctcatcgacaccg
cctctgctctgtatcgagaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttaatgaatttggccacttgggtgggtagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaacatgggactaaaaatcagacaactgttgtggtttcatatttcttgccttacttttggaagagaaa
cggttcttgagtacctggtgtccttcggggtgtggattcgtacaccccccgcatataggccacaaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctaatgtacctgtctttaaccctgagtggcaaactccctcttttcctgatatacacttgca
ggaagacattattaatagatgtcaacaatttgtgggccctcttactgtaaatgaaaaaaggagattatctttaattatgc
ctgctagattttttcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttgcatacactttggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttgcccgaccatcagttggacccggctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcttggcaggtaggagctggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcggct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AF223955_FT00000_P-C Feature FT:source AF223955_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate ea2). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaggacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtcattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttagaaaactgcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgccgctccctttacacaatgtgg
atacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcgggaccgacaactctgtcgtcctctctcggaaat
acacctcttttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtggggagtaatttggaagacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttaaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagctgcaaatcaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964331_FT00000_P-C Feature FT:source KU964331_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 37_14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgagaggcctatacagtcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccacatcgtcaatcttctcgaggactggggaccctgcaccgagcatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaattgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttataggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggaattaggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttcgattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactcaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactcctgtggtttcacatttcctgtcttacttttggaagagata
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattgatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaagattaattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttggacaaaggcattaaaccatattatccggaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacaacatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatcccgattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439403_FT00000_P-C Feature FT:source MZ439403_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN216-2013-Quasi-13). Complete genome. [Riboviria] (length=3209 residues).
ccacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaacagta
aaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggagagcac
cacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacaga
gtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacc
tccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatattcct
cttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttc
caggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgt
tgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatctttggctttcgcaagattcctatggga
gtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgttt
ggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattacca
attttcttttgtctttgggtatacatttaaaccctaacaaaaccaaacgttggggctactcccttaacttcatgggatat
gtcattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcctataaa
tagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtggttacc
cagcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttctgtgt
aaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactgg
ttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctag
cagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaatacacc
tcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaa
tcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccacggggc
gcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtc
gcatggaaaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaatgtca
acgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggttaatgat
ctttgtactaggaggctgtaggcataaattggtctgtccaccagcaccatgcaactttttcacctctgcctaatcatctc
ttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataaagaat
ttggagcttctacggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccgcctct
gctctgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactaaggcaagctattctgtgttg
gggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaagctatg
tcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaactgtt
cttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatcttatcaac
acttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcgcctcgccgacgaaggtctc
aatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaactttac
tgggctttattcttctactgtacctgtctttaatcctgactggcaaactccatcttttcctcacattcatttgaaagagg
atattatcaatagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgcctgct
aggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagttaatca
ttacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcagcgcct
cattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggcatggg
gacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaattcaaaca
atccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtgggagtaggatctttcggaccaggg
ttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcgcctcc
tcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggcca
cgcattgga
>gnl|hbvnuc|AB300362_FT00000_P-C Feature FT:source AB300362_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaagaacatattgtaatgaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaccaatatctgcacctgtaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcgtgttttgctcgcagccggtctggggcgaaccttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatccagcggacgacccgtctcggggccgcttgggcctctaccgtcccctacttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctcctgaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttaaa
agaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatnc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggaattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386659_FT00000_P-C Feature FT:source FJ386659_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S219). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagacccccgagtgaggggcctataccttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaactttatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtactaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgcaccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaatcttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacmcstataa
agaatttggagcttctgyggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatttggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactttggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgccgtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
tgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcacattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|KY881993_FT00000_P-C Feature FT:source KY881993_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
caggaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtacaaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggccttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctaaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccgc
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctgttcgagatctcatcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgccattagacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacacactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttatgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagaaagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774192_FT00000_P-C Feature FT:source KC774192_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz1034). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttagaaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacactctaagcaggctttcactttctcgccgacatacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
actagcggcttgttttgctcgcagccggtctggagcaaaacttattggtaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtcccctccttcatctgccgttccggccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatccgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggcta
aaggtctttgtcctaggaggctgtaggcataaattggtgtgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttaggacatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagacctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcctttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MT644999_FT00000_P-C Feature FT:source MT644999_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate GX19). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacatttcatcaagctctgctagatcccagagtaaggggcctatacttccctgctggtggctccagttccgaaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggtccctgcgccgaaaatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggttgacttctctcagttttctagggggaacacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
aattccaggatcatcaacaacaagcacgggaccatgcaagacctgcacaactcctgctcaagggacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcgtcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaggcgttggggctactccctaaacttcatgg
ggtatgtaattggaagttggggtaccttgccacaggaacatattacactgaaaatcaagcaatgttttcgaaaacttcct
gtaaacagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgctccttttacacaatgtgg
ttatcctgccttactccctttgtatgcctgtatacaagctaagcaggctttcactttttcgccaacttataaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgccaggcaacggccaggtctatgccaagtgtttgctgatgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaagt
acacctcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggctctaccgtccccttctccgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccatgaacgctaaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgcgtaccaccaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttgggacatggacattgacccgtataa
agagtttggagcttctgcggagttactctcgtttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccctagagtctccggaacattgttcacctcaccatacagcagtaaggcaaattattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatgtggaaaacccagcatccagggaattaatagtcag
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcttgtcttacgtttggaagagaaa
cggttcttgagtatttggtgtccttcggggtgtggatccgtactcccaccgcatataggccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagacaacgaggcaggacccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccctggactcataaggtgggaaac
tttactgggctttattcttctactgttcctgtctttaatcctgagtggcaaactccctcttttcctgatatacatttgca
ggaggacattattaatagatgtgaacaatttgtgggccctcttaatgtaaatgaaaaaaggagattaaagttaattatgc
ctgctagattttttcctaaccttaccaaatatttgcccctagataaaggtattaaaccttattatcctgaacatacagtt
aatcattactttaaaactaggcattatttgcataccctttggaaggctggcattctatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattctgcaaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagct
cctcctcctgcctccaccaatcggcagtcgggaagacagcctactcccatctctccacctctaagggacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ675793_FT00000_P-C Feature FT:source MZ675793_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Viet_ocHBV279). Complete genome. [Riboviria] (length=3215 residues).
ttccacaacatttcatcaagctctgctagatcccagagtaaggggcctatactttcctgctggtggctccagttccggaa
cagcaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
aattccaggaacatcaacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggcacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcctgggctttcgcaaaattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacmtctcgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaagcgttggggatactccctaaatttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtgcaaaaaatcaggcagtgttttcggaaacttcct
gtaaatagacccattgattggaaagtatgtcagagaattgtgggtcttttgggcttcgctgccccttttacacaatgtgg
ttatcctgccttactccctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggccaggtctatgccaagtgtttgctgacgcaaccccc
actggttggggcttggctataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggtcgcttggggctctatcgtccccttctccgtctgccgttccagccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccaatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgaattgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaagatcagacaactattgtggtttcacatttcttgtcttacttttggaagagaaa
cggttcttgagtatttggtgtccttcggggtgtggattcgtacaccacccgcatataggccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgttcctgtctttaatcctgaatggcaaactccctcttttcctgatatacatttgca
ggaggacattattaatagatgtcaacaatttgtgggccctcttaatgtaaatgaaaaaaggagattaaagttaattatgc
ctgctagattttttcctaaccttaccaaatatttgcccttagataaaggtattaaaccttattatcctgaacatatagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggcatactatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttattctgcaaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattcttgcccgaccatcagttggaccctgctttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggacccttggccagaggcctggcaggtaggagctggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaaccgtgccagcagct
cctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|JQ040165_FT00000_P-C Feature FT:source JQ040165_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate G222). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaagacctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccttaggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggakgagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgtacaccagcaccatgcaaatttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgcmttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcatatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcttttcctcacattcatttaca
tgaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaatatgcagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccggaggcaaatcaggtaggaacgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KU964067_FT00000_P-C Feature FT:source KU964067_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 19_4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctgtactttcctgctggtggctccagtttcggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctcgactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattgactgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
agggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagctctcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgccttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatacgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439435_FT00000_P-C Feature FT:source MZ439435_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CC246-2004-Quasi-29). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgcggggcctctactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaagcaatgttttcggaaacttcct
acaaataggcctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaacttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcaggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
caacaatccagattgggacttcaaccccaacaaggatcaatggcctgcggcaaaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774197_FT00000_P-C Feature FT:source KC774197_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate clz2035). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccatcaagctctgctagatcccagagtgaggggcctttattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacctcaactaccagcacgggaccatgcaagacctgcactattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctctgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttgccacaggaacatattgtacaaaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctttcctgccttgatgcctttatatgcatgtattcaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
aatggatggggcttggccataggccattggggcatgcgtggaacctttgtggctcctcggccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggaaccgacaactctgttgtcctctcttggaaat
acacctcctttccatggttgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtgtggggctctgccgtccccttgttcgtctgccgttccggccgaccgc
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggata
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttactgttaatgaaaaaagaagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgtag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggatcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MK628732_FT00000_P-C Feature FT:source MK628732_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctcaagttccggaa
ccgtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgttggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaagcgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgtcgtcctctctcggaaat
acacctcttttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccgtctattcgggatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctagccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaattattgtggtttcacatttcttgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaacagatgtcaacaatttgtaggccctcttacagttaatgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatactctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439552_FT00000_P-C Feature FT:source MZ439552_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2004-Quasi-1). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatggcccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctcttctg
tgttggggtgagttgatgactctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaagaagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccagtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU939658_FT00000_P-C Feature FT:source EU939658_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate D142). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctcaacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaagtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttcact
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtgattcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgctggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggagcatattgtcctgaaactcaagcaatgttttcgtaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacagtctaagcaggctttcactttctcgccaacttataaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactccgttgtcctctctcggaaat
acacctcctttccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttccgtggagttactctcttttttgccttctgacttctttccttctgttcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagactccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatctcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgaccaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
cttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattaacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KC774330_FT00000_P-C Feature FT:source KC774330_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cxa2075). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaactttccaccaagctctgctagatcccagagtgaggggcctttactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccacatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctaataaaacaaagcgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtaccttaccccaggagcatattgtactcaaaatcaaacaatgttttcgaaaacttcct
gtaaatagacctattgattggaaagtctgtcaacgaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ttatcctgccttaatgcctttgtatgcatgtatacaatctaagcaggcttttactttttcgccaacatacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccaccagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtctggagcgaaacttatcggtacagacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcgcggccgtttgggaatctaccgtccccttcttcgtctgccgttccggccgcccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctatccgagatcttctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatctggtatcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
atctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttgca
ggaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaataatgc
ctgctaggttctatcctaaccttaccaaatatttgccattagataaaggcattaaaccttattatcctgaacatacagtt
aatcattacttcaaaactaggcattatttacatactttgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaagcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcagccttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|KJ173285_FT00000_P-C Feature FT:source KJ173285_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CX026C(e241)). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
ccgtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcacagaatatggag
aacaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcaccaaagtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctcgatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaagaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggttttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggctttgggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagctcaacttatcggcaccgacaacgccgttgtcctctctcggaaat
acacctcctatccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcctaaggtcttatataagaggactcttggactctccgcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttacagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgttccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctgttcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccggcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cggggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccactcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|EU570072_FT00000_P-C Feature FT:source EU570072_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1-B74). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagcactgctagatcccagagtgaggggcctatatcttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccagtcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatatgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagtacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccattatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggctactcccttaacttcatag
gatatgtaattggaagttggggtactttaccgcaggaacatattgtactaaaactcaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcagcgaattgtgggtctgttaggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtattcaagctaagcaagctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatatatgaacctttaccccgttgcccggcaacggtcaggtctctgccaggtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcctgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggaccctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgatccgtttcggggccgtttgggtctctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagtcgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgtgtggctttggggcatggacattgacacctataa
agaatttggagcttctgtggagttactctcgtttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaatatgggcctaaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ccgttcttgaatatttggtgtcgtttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgacg
atctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttggtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaattctgaatggcaaactccctcctttcctcacattcacttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagtcaatgaaaaaaggagactaaaattaattatgc
ctgctagattctatcctaaccttaccaaatatttgcccttggacaaaggtattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaagccaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtcggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
ccttctcctgcctctaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccacgcagtggac
>gnl|hbvnuc|GQ475329_FT00000_P-C Feature FT:source GQ475329_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR25LC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatatttccctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacggggccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggttactctcttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtaatgaaactcaagcaatgttttcggaaactacct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtctcttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttttcgccaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggctataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcgtgttttgctcgcagccggtctggggcgacacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgcttgggcctctatcgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacaaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgtacccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcagggagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803761_FT00000_P-C Feature FT:source KJ803761_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY761182). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttacctctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccctgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgccccttttacacaatgtgg
ttacccagccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctcccggaaat
acacctcctttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttggctacgtcccgtcggcg
ctgaatcccgcggacgacccatctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcctgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattcggtta
atggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttattgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcaggcaactattgtggtttcacatttcctgtcttacctttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctaacattcatttgaa
agaggatattatcaacagatgtcaacaatatgtgggccctcttacggttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccttactaaatatttgcccttagataaaggcataaaaccttattatcctgaacatacagtt
aatcattacttccaaacgaggcattatttacatactctgtggaaggctgggattttatataagagagaaactacacatag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcagcaaaccaggtaggagtgggagcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaagctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KJ803760_FT00000_P-C Feature FT:source KJ803760_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate MY805753). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctcaagttccggaa
cagtaaaccctgttccaactactgcctctcccatatcgtcaatcttctcgaggactggggactctgcaccgaatatggag
agcaccacatcaggattcctaagacccctgctcgggttacaggaggggtttttctcgttgacaagaatcctcacaatacc
acagagtctaggctcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcattttatcatc
ttcctcttcatcctgccgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcgactaccagcacgggaccatgcaagacctgcacgaatcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcaatttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgaatccctttttacctctat
tactaattttcttttgtctttgggtatacatttaaaccctcataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaattgaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgcagccccttttacacaatgtgg
gtatccagcattaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgtcaacttacaaaacctttc
tgtgtcaacaatatatgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccatctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcctgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcac
tgtcaacgaccgaccttgaggcatacttcaaagaccgtgtatttacagactgggaggagttgggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccgtctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatgcagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggacgacccagcatccagggaattagtagtaag
ctatgtcaatgttaacatgggcctaaaaatcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttctagagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttattagatgtcgaggcaggtccactagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgttcctgtctttaaccctgactggcaaactccctcttttcctcacattcatttgaa
agaggatatcataaacagatgtcaacaatttgtaggcccccttacagttaatgaaaaacggagattaaaattgattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagataaaggtatcaaaccttattatcctgaacatacagtt
aatcattacttccaaactagacattatttacatacgctgtggaaggctggtattttatataagagagaaactacacgcag
tgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaacctttctgttcccaatcctctgggattctttcccggtcaccagttggacccagcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcagtcttttggggtggagccctcaggctcaaggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccactcggcagtcaggaagacagcctactcccatctctccacctctgagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KM875424_FT00000_P-C Feature FT:source KM875424_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate pt13N). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaagggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttctatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgttcaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgcagctccctttacacaatgtgg
ttacccagcgttaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctacgcggaacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcca
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcgtgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctactcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaattagtagtagg
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagaccaa
ctgttctggagtatttggtgtcttttggagtgtggattcgcactcctcccccttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggacggggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctcttacagctaacgaaaaacggagattaaaattgattatgc
ctgctaggttctatcctaactgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacacagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggtccgtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctcaaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcaatggaa
>gnl|hbvnuc|KU964343_FT00000_P-C Feature FT:source KU964343_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 38_10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctgtactttcctgctggtggctccagtttcggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctcgactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattgactgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
agggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggcccgtgtgcacttcgcttcacctctgc
acgtcgcatggcgaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggcta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcagctcaccatacagcactcaggcaagctattcta
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatttggaagacccagcatccagggaattagtagtcgg
ctatgtcaatgttaacatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagacaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctccttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggacgaatcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcaaattcatttaca
tgaggacatcattaatagatgtcagcaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcctttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccaatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB050018_FT00000_P-C Feature FT:source AB050018_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C. Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagaccccagagtgcggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacagcatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtgtctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgttctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggca
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttctgcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggtccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcttaaaaatcaggcaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacgcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|GQ475348_FT00000_P-C Feature FT:source GQ475348_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate KOR44HCC). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttcaggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatataattggaagttggggtactttaccacaggaacatattgtacaaaaactaaagcactgttttcggaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcgtgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtataaacaatatatgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataccgcggaact
cctagcggcttgttttgctcgcagccggtctggagcaaaacttatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcgggtgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacatcgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctccttgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtcttcaatcctgagtggcaaactccctccttccctaacattcatttaca
ggaggatattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacacag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcagtggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggtccaccccacctcacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY470892_FT00000_P-C Feature FT:source KY470892_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 23-H12). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatccccgagtgaggggcctatattttcctgctgggggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaacttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcgtcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggacgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaatcctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaactcaagcaatgttttcggaaattgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttaggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagcaggtccggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggtctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcacaaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatccggaatatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggtattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KM875425_FT00000_P-C Feature FT:source KM875425_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate pt13T). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcatggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgacctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggattaccagggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgcagctccctttacacaatgtgg
ttacccagcgttaaagcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tatgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttctcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgacaggtcttgcccaaggtcttacataagaggactcttggactctcagcca
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcgtgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgctctactcgacaccg
cctctgctttgtatcgggaggccttagagtctccggaacattgtacacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggtggtaatttggaagacccagcatccagggaattagtagtagg
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagaccaa
ctgttctggagtatttggtgtcttttggagtgtggattcgcactcctcccccttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagaggacggggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctcttacagctaacgaaaaacggagattaaaattgattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MF674454_FT00000_P-C Feature FT:source MF674454_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate HBV050076). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctmgggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttaggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggacttctgggctttgccgctccttttactcaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggccaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggcactgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgaatggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttactgttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttctatcctaaccttaccaaatatttgcctttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcaccccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
catcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MW310260_FT00000_P-C Feature FT:source MW310260_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Viet_ocHBV353). Complete genome. [Riboviria] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaagggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacttcaactaccagtacgggaccatgcaagacctgcacgatacctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctgt
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaatttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaatcaagcaatgttttcgaaaactgcct
gtaaatcgacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggatggggcttggctatcggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaacttatcggcaccgacaactctgttgtcctctctcggaagt
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcctgcagacgacccgtctcggggccgtttgggactcttccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttatataagaggactcttggactcgcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggaattgggggaggagactagttta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctgttcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttctcctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggatttagtagtcgg
ctatgtcaatgttaatatgggcctgaaactcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtgaacaatttgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacaggcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcaggcattctatataagagagaaactacacgcag
cgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggacttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttccctatcaccagttggacccggcattcagagccaattc
aaacaattcagattgggacttcaaccccaacaaggatcactggccagcagcaaatcaggtaggagcgggagcattcgggc
cagggttcactccaccccacggcggtcttttggggtggagccctcaggctcagggcctattgacaaccgtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccgtgcagtggaa
>gnl|hbvnuc|FJ562230_FT00000_P-C Feature FT:source FJ562230_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate I38). Complete genome. [Hepadnaviridae] (length=3200 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaagttcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcatgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgatggggatactcccttaacttcatgg
gatatgtaattggcagttggggtacattaccgcaggaacatattatactgaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaaacaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgtttcgctcgcagccggtctggagcgaagcttatcggaactgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcatacagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgt
cctactgttcaagcctccaagctgtgccttggatggctttagggcatggacattgacccgtataaagaatttggagcttc
tgcggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccgcctctgctctatatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcagctatgtcaatgttaa
tatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttgttagacgacgatgcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaactttactgggctttat
tcttccacggtacctgtctttaatcctgagtggcagactccctcttttcctcacattcatttacaggaggacattattaa
tagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgcctgctaggttctatc
ctaatcttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgcagttaatcattacttccaa
actaggcattatttacatactctgtggaaagcgggcattctatataagagagaaactacacgcagcgcctcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggcatggggacgaatctt
tctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgtttggagccaactcaaacaatccagattg
ggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggttcaccccac
cacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatgcagtggaa
>gnl|hbvnuc|KC774227_FT00000_P-C Feature FT:source KC774227_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate cur1009). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcacagaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cctgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgaatccctttttaccactgt
taccaattttcttttgtctttgggtatacatttaaaccctactaaaactaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtaccttaccacaggaacatattgtacacaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaacgaattgtggggcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccataggccatcagcgcatgcgtggaacctttatggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtttggagcaaaacttattggcaccgacaaatttgttgtcctctcttggaaat
acacctcctttccatgggtgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttttttgtttgccgttccgaccgaccac
ggggggcacctctctttacgcggtctccccgtttgtgccttttcatttgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgacaggtcttgcccaaggttttacataagaggactcttggactctcagcaa
agtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaaaactgggaggaattgggggaggagattagatta
aaggtctttgtaactggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggacattgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtaggccctctcacagttaacgaaaaaaggagattaaaattgattatgc
ctgctaggttctatcctaaccgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacacatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcacaccaggtaggagtgggatccttcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagca
cctcctcctgcatccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439369_FT00000_P-C Feature FT:source MZ439369_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN216-2007-Quasi-9). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatctttggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtcattggaagttggggtaccttgccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
ttacccagcattaatgcctttgtacgcatgtatacaagctaagcaggcttttactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaacattatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactcccagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaactcagacaaatattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgactggcaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgccaacaatatgtgggccctcttacagttaacgaaaaaaggagattaaaattgatcatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagcaaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaatcaggtaggagtaggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|FJ386595_FT00000_P-C Feature FT:source FJ386595_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 1879). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccaagtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgagtcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtagtgaaactcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtcccggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactttcagcaa
tgtcaacgaccgaccttgaggcgtacttcaaagactgtttgtttaaggactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgcatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattactagatgtgaacaatatgtgggccctcttacagttaatgaaaaaaggagattgaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatacactgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcttgggaggttggtcttccaaacctcgacaaggc
atggggacaaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggaacattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HQ700572_FT00000_P-C Feature FT:source HQ700572_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate C_Tonga_To422_2007). Complete genome. [Hepadnaviridae] (length=3215 residues).
ttccacaacattccaccaagctctgctagatcccagagtaaggggccttyactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctaggggaagcaccaaggtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcytggctatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatccactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
catgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgtaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagcgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataagaccaagagatggggctattcccttaacttcatgg
gctatgtaattggaagttggggtaccttaccacaagaacatattagactaaaaatcaaaaactgttttcgaaaacttcct
gtaaataggcctattgattggaaggtgtgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
atatcctgccttaatgcctttgtatgcatgtattcaagctaaacaagctttcactttttcgtcaacttacaaagtttttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtccggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccattggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccataytgcggaact
ccttgcagcttgttttgctcgcagccggtctggggcgaaacttatcggaactgacaactctgttgtcctttctcgcaaat
acacctcgtttccatggctgctcggttgtgctgccaactggatccttcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgcttggggctctaccgtccccttctccgtctgccgttccggccaaccac
ggggcrcacctctctttacgcggtctccccgtctgtgccttctcatctgccgggccgtgtgyacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccacatggyattgcccaaggtcttgcataagaggactcttggactctcarcga
tgtcaacgrccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagaytagatta
aaggtctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccttataa
agaatttggagcttctgtggagttactctcttttttgccttctgatttctttccgtctattcgagacctcctcgacaccg
cctcagctctgtaccgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctgttctg
tgttggggtgagttaatgaatctggctacctgggtgggaagtaatttggaagacccagcatccagggaattagtggtcag
ttatgtcaacattaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggatccgcactcctcccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttccactgtacctgtctttaatcctgagtggcaaactccctcttttcctgacattcatttgaa
agaggacattatcaataggtgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgccgttagataaaggcattaaaccctattatcctraacacgcagtt
aatcattactttaaaactaggcattatttacatactctgtggaaatctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacggcatgggaggttggtcttccaaacctcggaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccaacagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccaccgctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439588_FT00000_P-C Feature FT:source MZ439588_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate CN149-2019-Quasi-9). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgaccactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcaccacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatc
ttcctcttcatcctgctgctatgcctcaccttcttgtgggttcttctggactaccgaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggcgaagtctgtacaacatcttgaatccctttttaccgctat
taccaattttcttttgtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttctgggctttgccgctccctttacacaatgtgg
gtacccggcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcaaaccttatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccgccaggtcttgcccaaggtcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgcggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtaag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgtttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtatcccttggactcataaggtgggaaac
tttactggactttattcttctactgtacctgtctttaatcctgactggaaaactccctcttttcctcacattcatttgaa
agaggatattatcaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaagaagattaaaattgatcatgc
ctgctaggttttatcctaaacgtaccaaatatttgcccttagataaaggcattaaaccttattatcctgaacatatagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttggcgatcaccagttggacccggcattcagagccaattc
aaacaatccagattgggacctcaaccccaacaaggatccatggccagcggcaaaccaggtaggagtgggatctttcggac
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcgtgttgacaacagtgccagcggcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|HM750135_FT00000_P-C Feature FT:source HM750135_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate QHX-14). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaaccaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtgcaaaaaattaagcaatgttttcggaaactgcct
gtaaatagacctattgattggaaagtctgtcaaagaattgtgggtcttttgggttttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgcctatttacaaggcctttc
tgtgtcaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggcaataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
tctagcagcttgttttgctcgcagccggtctggagcaaaactgatcggaaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
atgatctttgtattaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcatccgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttaaagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgttaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaaaaaaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcaaaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttcagctgtaactgtctttaatcctgattggcaaactccctcctttccgcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttagacaaaggcattaaaccgtattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY363275_FT00000_P-C Feature FT:source KY363275_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate geno14.3). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccaccacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcccgctgctatgcctcatcttcttgttggttcttctgggctaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggaacatattgtacaaaaaattaagcaatgttttcggaaactgcct
gtaaatagacctatcgattggaaagtatgtcaacgaattgtgggtcttttgggatttgctgccccttttacacaatgtgg
ctatcctgctttgatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgtcaacttacaaggcctttc
tgtgtaaacaatatctgcacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggccataggccatcggcgcatgcgtggaacctttgtggcttctctgccgatccatactgcggaact
cctagcggcttgttttgctcgcagccggtctggagcaaaccttatcgggactgacaactctgttgtcctccctcggaaat
acacctcattcccatggctgctcgggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccaaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccatcaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaagactgggaggagttgggggaggagattaggtta
atgatttttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcttgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggaccttgacacgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctccatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattgtg
tgttggggtgagttgatgaacctggccacctgggtggaaagtaatttggaagatccagcatccaggggattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcccgcttacagatcaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttactcttctactgtacctgtctttaatcctgattggcaaactccctcctttcctaacattcatttaca
ggaggacattattaatagatgtcaacaatatgtaggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttttatcctaaccttaccaaatatttgcccttggataaaggcattaaaccttattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcttcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgaaaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagtgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaccagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ439650_FT00000_P-C Feature FT:source MZ439650_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate TN122-2004-Quasi-11). Complete genome. [Riboviria] (length=3200 residues).
ctccagcacattccaccaagctctgatagatcccagagttcctgctggtggctccagttccggaacagtaaaccctgttc
cgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggagagcaccacatcagga
ttcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaataccacagagtctagactc
gtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaatttgcagtccccaacctccaatcact
caccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatcatcttcctcttcatcctg
ctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctctacttccaggaacatc
aactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccctcttgttgctgtacaa
aaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattcctatgggagtgggcctca
gtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccactgtttggctttcagt
tatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctttttaccgctattaccaattttctttt
gtctttgggtatacatttaaaccctaataaaaccaaacgttggggctactcccttaacttcatgggatatgtaattggaa
gttggggtaccttgccacaggaacatatagtacaaaaaatcaaacaatgttttcggaaacttcctataaatagacctatt
gattggaaagtatgtcaaagaattgtgggtcttttaggttttgccgctccttttacacaatgtggttacccagcattaat
gcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttctgtgtaaacaatatc
tgaacctttaccccgttgctcggcaacggtcaggtctttgccaagtgtttgctgacgcaacccccactggttggggcttg
gccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaactcctagcagcttgttt
tgctcgcagccggtctggagcaaaccttattggcaccgacaactctgttgtcctctctcggaaatacacctcctttccat
ggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggac
gacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccagccgaccacggggcgcacctctct
ttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagac
caccgtgaacgcccgccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaatgtcaacgaccgacc
ttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggttaatgatctttgtattg
ggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatcatctcatgttcatgt
tccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataaagaatttggagcttc
tgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccgcctctgctctgtatc
gggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctgtgttggggtgagttg
atgaatctggccacctgggtgggaagtaatttggacgacccggcatccagggaagcagtagtaggctatgtcaacgttaa
tatgggcctaaaattcagacaactattgtggtttcacatttcctgtcttacttttggaagcgcaactgttcttgagtatt
tggtgtcttttggagtgtggattcgcactcctcctgcctacagaccaccaaatgcccctatcttatcaacacttccggaa
actactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccgcg
tcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaactttactgggctttat
tcttctactgtacctgtctttaatcctgaatggcaaactccttcttttcctcacattcatttgaaagaggatattatcaa
tagatgtcaacaatatgtgggccctcttacagttaacgaaaagaggagattaaaattgatcatgcctgctaggttctatc
ctaagcttaccaaatatttgcccttagataaaggcatcaaaccttattatcctgaacatatagttaatcattacttccaa
actagacattatttacatactctgtggaaggctggtattttatataagagagaaactactcgcagcgcttcattttgtgg
gtcaccatattcttgggaacaagagctacagcatgggaggacggtcttccaaacctcgacaaggcatggggacgaatctt
tctgttcccaatcctctgggattctttcccgatcaccagttggacccggcattcggagccaattcaaacaatccagattg
ggatctcaaccccaacaaggatcaatggccagcggccaatcaggtaggagtgggatcattcgggccggggttaactccac
cacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcacctcctcctgcctcc
accaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctcaggccatacagtggaa
>gnl|hbvnuc|KY881892_FT00000_P-C Feature FT:source KY881892_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-05). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagctccggaa
caggaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgccctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttgtggactaccaaggtatgttgcccgtttgtcctct
actttcaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtataaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttcccatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccattcttctttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctgttcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgccattagacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagtattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|KY881994_FT00000_P-C Feature FT:source KY881994_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate patient-10). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
caggaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtatccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactccctcaacttcatgg
gatatgtaattggaagttggggtactttaccgcaagaacatattgtacaaaaaattaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctattggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggaaaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactgggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttccgacttctttccttctgttcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttcgagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttgggttgagttgatgaatctggccacctgggtgggaagtaatttgggagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaagatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggactcgcactcctactgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgcacctgtctttaatcctgattggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgagaaaaggagattaaaattaattatgc
ctgccaggttctatcctaaccttaccaaatatttgccattagacaaaggcattaaaccatattatcctgaacatgcagtt
aatcattacttccaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtaaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttttgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcgaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccgcaggctcagggcgtattgacaacggtgccagtagca
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|MZ671251_FT00000_P-C Feature FT:source MZ671251_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Viet_ocHBV/chr72). Complete genome. [Riboviria] (length=3215 residues).
ctccagcacattccaccaagctctgctagatcccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaatatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
gcagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcctgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaattgcacttgtattcccatcccatcatcttgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccttttttacctctgt
taccaattttcttctgtctttgggtatacatttgaaccctcataaaaccaagcgttggggctactccctaaacttcatgg
gatatgtaattgggagttggggtaccttaccacaggaacatattgtacaaaaaatcaaacaatgttttcggaaacttcct
ataaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgccgctccctttacccaatgtgg
ttacccagcattaatgcctttgtatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgccaggcaacggtcaggtctctgccaagtgtttgctgatgcaaccccc
actggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
ccttgcagcttgttttgctcgcagccggtctggagcgaaactcatcggaaccgacaactctgttgtcctctctcgcaaat
acacctcgtttccatggctgctcggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcgtctgccgttccgaccgaccac
ggggcgaacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgccaaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcac
tgtcaacgaccgaccttgaggcgtacttcaaagactgtgtgtttaaagactgggaggagttgggggaggagattaggtta
aaggtctttgtactaggaggctgtaggcataaattggtctgcgtaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcccactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgtgatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactaaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagatccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaagatcagacaactattgtggtttcacgtgtcttgtcttacttttggaagagaaa
cggttcttgagtatttggtgtccttcggggtgtggattcgcacaccccccgcatataggccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaat
tttactgggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcctgatatacatttaca
ggaggacattattaatagatgtcaacaatttgtgggccctcttaatgtaaatgaaaaaagaagattaaaattagttatgc
ctgctagattttttcctaaccttaccaaatatttacccttagataaaggtattaaaccttattatcctgaacatatagtt
aatcattacttcaaaactaggcattatttgcataccctttggaaggctggtattttatataagagagaaactactcgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccggtcaccagttggacccggcattcggagccaattc
aaacaatccagattgggacttcaaccccaacaaggatcaatggccagcggcaaaccaggtaggagtgggatcattcgggc
cagggttcactccaccacacggcaatcttttggggtggagccctcaggctcagggcatattgacaacagtaccagcagcg
cctcctcctgcctccaccaatcggcagtcaggaagacagcctactcccatctctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|AB670295_FT00000_P-C Feature FT:source AB670295_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate Non-HCC pt No.22). Complete genome. [Hepadnaviridae] (length=3215 residues).
caccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctctcccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
agcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagtacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggctcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctrt
taccaattttcttttgtctttgggtatacatttgaaccctcataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccacaggaacatattgtattaaaaatcaagcaatgttttcggaaactacct
gtaaatagacctattgattggaaagtatgtcaacgcattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtcaacaatacctgcacctttaccccgttgcccggcaacggtctggtctctgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcggcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctggcagcttgttttgctcgcagccggtctggagcaaaactgatcgggactgacaactctgttgtcctctctcggaaat
acacctccttcccatggctgctcggatgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttgggcctctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaagctcttatataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcacctgcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttagggcatggaccttgacccgtataa
agaatttggagcttctgcggagttagtctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctctgctctgtatcgggaggccttagagtctccggaacattgttcacctcaccatacagcaatcaggcaagctattatc
tgttggggtgagttgatgaatctggccacctgggtgggaggtaatctagacgatcaagcatccagggatttagtagtcag
ctatgtcaacgttaatatgggcctaaaactcagacaaatattgtggtttcacctttcctgtcttatgtttggaagagata
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctgccgcttatagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactggcctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctaacattcatttgca
ggaagacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaacttaccaaatatttgcccttggataaaggcattaaaccctattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataaaagagaaactacacgcag
cgcttcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctgtctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggaggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagcg
cctcctcctgcctccaccaatcggcagtcaggacgacagcctactcccatctctccacctctcagagacagtcatcctct
ggccgtgtgttggaa
>gnl|hbvnuc|FJ787442_FT00000_P-C Feature FT:source FJ787442_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate S171-4). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagatcccagagtgaggggcctatattttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccgcgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttgggtcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacaattcctgctcaaggaacctctatgtttccct
cttgctgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcatggctcagtttcttagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctagtaaaaccaaacgctggggttactcccttaacttcatgg
gatatgtaattggaagttggggtactttaccgcaggagcatattgtacgaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcaaagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttgatgcctttatatgcatgtatacaatccaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctttgccaagtgtttgctgacgcaaccccc
actggctggggcttggccataggccatcagcgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcctttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcg
ctgaatcccgcggacgacccgtctcggggccgtttggggctctatcgtccccttcttcgtctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcaa
tgtcaacgaccgaccttgaggcatacttcaaagactgtgtatttaaagactgggaggagttgggggaggagactaggtta
atgatctttgtactaggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttcgggcatggacattgacccatataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttccattcgagatctcctcgacaccg
cctcagctctatatcgggaggccttagagtctccggaacattgttcacctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatcttgccacctgggtgggaagtaatttggaagacccagcatcccgggaattaatagtcag
ctatgtcaatgttaatatgggcctgaaaatcagacaactattgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctaccgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtctttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttaccgttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgcccttggacaaaggcattaaaccgtattatcctgaacatgtagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagagagaaactacacgcag
cgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagccctcaggctcagggcatattgacaacagtgccagcagca
cctccccctgcatccaccaatcggcagtcagggagacagcctactcccatatctccacctctaagagacagtcatcctca
ggccatgcagtggaa
>gnl|hbvnuc|LC279262_FT00000_P-C Feature FT:source LC279262_FT00000_P-C of [Viruses] Hepatitis B Virus genotype C (isolate 41_serum). Complete genome. [Hepadnaviridae] (length=3215 residues).
ctccacaacattccaccaagctctgctagaccccagagtgaggggcctatactttcctgctggtggctccagttccggaa
cagtaaaccctgttccgactactgcctcacccatatcgtcaatcttctcgaggactggggaccctgcaccgaacatggag
aacacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctcacaatacc
acagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaattcgcagtccc
caacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgctggatgtgtctgcggcgttttatcata
ttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgcccgtttgtcctct
acttccaggaacatcaactaccagcacgggaccatgcaagacctgcacgattcctgctcaaggaacctctatgtttccct
cttgttgctgtacaaaaccttcggacggaaactgcacctgtattcccatcccatcatcctgggctttcgcaagattccta
tgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtagggctttcccccac
tgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttttacctctat
taccaattttcttttgtctttgggtatacatttgaaccctaataaaaccaaacgttggggctactcccttaacttcatgg
gatatgtaattggatgttggggtactttaccgcaagaacatattgtactaaaaatcaagcaatgttttcgaaaactgcct
gtaaatagacctattgattggaaagtatgtcagagaattgtgggtcttttgggctttgctgccccttttacacaatgtgg
ctatcctgccttaatgcctttatatgcatgtatacaagctaagcaggctttcactttctcgccaacttacaaggcctttc
tgtgtaaacaatatctgaacctttaccccgttgcccggcaacggtcaggtctctgccaagtgtttgctgacgcaaccccc
actggatggggcttggctatcggccatcgccgcatgcgtggaacctttgtggctcctctgccgatccatactgcggaact
cctagcagcttgttttgctcgcagccggtctggagcgaaacttatcggcaccgacaactctgttgtcctctctcggaaat
acacctcatttccatggctgctagggtgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcagcg
ctgaatcccgcggacgacccgtctcggggccgtttgggactctaccgtccccttcttcatctgccgttccggccgaccac
ggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctctgc
acgtcgcatggagaccaccgtgaacgcccaccaggtcttgcccaaggtcttacataagaggactcttggactctcagcga
tgtcaacgaccgaccttgaggcatacttcaaagactgtttgtttaaggactgggaggagttgggggaggagattaggtta
aaggtctttgtactcggaggctgtaggcataaattggtctgttcaccagcaccatgcaactttttcacctctgcctaatc
atctcatgttcatgtcctactgttcaagcctccaagctgtgccttgggtggctttggggcatggacattgacccgtataa
agaatttggagcttctgtggagttactctcttttttgccttctgacttctttccttctattcgagatctcctcgacaccg
cctcagctctgtatcgggaggccttagagtctccggaacattgttctcctcaccatacagcactcaggcaagctattctg
tgttggggtgagttgatgaatctggccacctgggtgggaagtaatttggaagacccagcatccagggaattagtagtcag
ctatgtcaatgttaatatgggcctaaaaatcagacaactactgtggtttcacatttcctgtcttacttttggaagagaaa
ctgttcttgagtatttggtgtcttttggagtgtggattcgcactcctcctgcttacagaccaccaaatgcccctatctta
tcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcgcctcgcagacgaag
gtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggactcataaggtgggaaac
tttactgggctttattcttctactgtacctgtttttaatcctgagtggcaaactccctcctttcctcacattcatttaca
ggaggacattattaatagatgtcaacaatatgtgggccctcttacagttaatgaaaaaaggagattaaaattaattatgc
ctgctaggttctatcctaaccttaccaaatatttgccattggacaaaggtattaaaccatattatcctgaacatgcagtt
aatcattacttcaaaactaggcattatttacatactctgtggaaggcgggcattctatataagagagaaactacacgcag
tgcctcattctgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttccaaacctcgacaaggc
atggggacgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactc
aaacaatccagattgggacttcaaccccaacaaggatcattggccagaggcaaatcaggtaggagcgggagcattcgggc
cagggttcaccccaccacacggcggtcttttggggtggagcccacaggctcagggcgtattgacaaccgtgccagtagca
cctcctcctgcctcca