HBVdb

Dataset for nucleotide sequence PreS2 of genotype B

[Download (right click)] [Alignment] [Repertoires]

2818 sequence(s)

>gnl|hbvcds|AB010289_PreS2_P-B Feature FT:CDS AB010289_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB010290_PreS2_P-B Feature FT:CDS AB010290_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-2). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttgtgtctctgggtatacatgtaa
>gnl|hbvcds|AB010291_PreS2_P-B Feature FT:CDS AB010291_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-3). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttgtgtctctgggtatacatgtaa
>gnl|hbvcds|AB010292_PreS2_P-B Feature FT:CDS AB010292_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-4). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atacagtggaacgccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatctcatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctgattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB014366_PreS2_P-B Feature FT:CDS AB014366_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 07D07HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaatagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB031267_PreS2_P-B Feature FT:CDS AB031267_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccgccacttttcatcaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctcccatatcatcaaccttctcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtttccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB033554_PreS2_P-B Feature FT:CDS AB033554_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate RTB299). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgacgactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacaggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AB033555_PreS2_P-B Feature FT:CDS AB033555_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAD744). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tttgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB048705_PreS2_P-B Feature FT:CDS AB048705_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacagcattccaccaagctctgcaggatcccagagtaaggggtctgtattttcctgctggtggctc
cagttccggaacagtaaaccctgttccgaatactgtctctcacatctcatcaatcttcacgaagactggggaccctgcat
cgaacatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaatacctcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaa
ttcgcagtcccaaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgatcactgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctt
tttaccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073821_PreS2_P-B Feature FT:CDS AB073821_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi20). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgygtgtcytggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB073822_PreS2_P-B Feature FT:CDS AB073822_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi32). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073823_PreS2_P-B Feature FT:CDS AB073823_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi35). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccaaagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagagcatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccgtgtgtcctggccaaaa
tttgcagtccccaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatccctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073824_PreS2_P-B Feature FT:CDS AB073824_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtacttccctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcgtcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatttggttttgggggccaagtctgtacaacaccttgaaaccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073825_PreS2_P-B Feature FT:CDS AB073825_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi51). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaagctcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcgtcctgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccargtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073826_PreS2_P-B Feature FT:CDS AB073826_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi89). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB073827_PreS2_P-B Feature FT:CDS AB073827_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaaytccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073828_PreS2_P-B Feature FT:CDS AB073828_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK37). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073829_PreS2_P-B Feature FT:CDS AB073829_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK38). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctgattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|AB073830_PreS2_P-B Feature FT:CDS AB073830_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH57). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaggatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttattgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactactgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctcgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073831_PreS2_P-B Feature FT:CDS AB073831_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH61). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgktgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatattgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073832_PreS2_P-B Feature FT:CDS AB073832_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Th65). Complete genome. [Hepadnaviridae] (length=846 residues).
atgaagtggaactcccccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgagtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccgtt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073833_PreS2_P-B Feature FT:CDS AB073833_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi59). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttttyctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073834_PreS2_P-B Feature FT:CDS AB073834_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi16). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073835_PreS2_P-B Feature FT:CDS AB073835_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi29). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaatagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtatctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073836_PreS2_P-B Feature FT:CDS AB073836_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw25). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgagtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcccctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB073837_PreS2_P-B Feature FT:CDS AB073837_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ku1). Complete genome. [Hepadnaviridae] (length=846 residues).
atacattggaaaccccccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcatgggcttccg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB073838_PreS2_P-B Feature FT:CDS AB073838_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ho7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcatggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073839_PreS2_P-B Feature FT:CDS AB073839_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw174). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcagaaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagattggggaccctgtac
cgaacatggagaccatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggacccactcgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073840_PreS2_P-B Feature FT:CDS AB073840_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw36). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgycaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggyggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggytcgtaggg
ctttcccccactgtctggctttcagttacatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073841_PreS2_P-B Feature FT:CDS AB073841_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw30). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccaaagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttacatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073842_PreS2_P-B Feature FT:CDS AB073842_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw11). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccattttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttccagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073843_PreS2_P-B Feature FT:CDS AB073843_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw27). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccacaactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagcaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagacttgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcaccactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaartctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073844_PreS2_P-B Feature FT:CDS AB073844_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-T11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagcaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073845_PreS2_P-B Feature FT:CDS AB073845_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ya16). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073846_PreS2_P-B Feature FT:CDS AB073846_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry565). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073847_PreS2_P-B Feature FT:CDS AB073847_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Fu53). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcctggccgaaa
ttcgcagtcccaaatctccagtcactcaccaatctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttctatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctcagattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073848_PreS2_P-B Feature FT:CDS AB073848_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HUS). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacgcccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073849_PreS2_P-B Feature FT:CDS AB073849_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na101). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttgtcgacgactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacaaccgtgtgtcttggccaaaa
ttcgcagtgccaaatctccagtcactcaccaaccttttgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctmtgattccaggatcatcaaccaccagcacgggrccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaartctgtacaacaccttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073850_PreS2_P-B Feature FT:CDS AB073850_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na102). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaagggatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073851_PreS2_P-B Feature FT:CDS AB073851_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgcttgatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacagctcctgctcaaggaaactt
tacgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttcttttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggcttttagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073852_PreS2_P-B Feature FT:CDS AB073852_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctaccacatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagagggaccacccgtgtgtcctggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073853_PreS2_P-B Feature FT:CDS AB073853_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry24). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtaagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttctcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggaccccttctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagacttgtggtggacttctctcagttttctaggggaaccacccgtgtgccatggccaaaa
ttcgcagtgccaaatctgcagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcccctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttatgtctttgggtatacatataa
>gnl|hbvcds|AB073854_PreS2_P-B Feature FT:CDS AB073854_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry30). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtccccaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatctkcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtrtacatttaa
>gnl|hbvcds|AB073855_PreS2_P-B Feature FT:CDS AB073855_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry34). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073856_PreS2_P-B Feature FT:CDS AB073856_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry46). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaatagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtgc
tgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073857_PreS2_P-B Feature FT:CDS AB073857_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry48). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaatttccatcaaactcttcaagatcccagagtcagagctctgtactttcctgctggtggctc
cagttcaggaatagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcgaggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaaccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB073858_PreS2_P-B Feature FT:CDS AB073858_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Shin). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaagatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttattggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB100695_PreS2_P-B Feature FT:CDS AB100695_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH133). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgttgtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB106884_PreS2_P-B Feature FT:CDS AB106884_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaatagtaagccctgctcagaacactgtctctaccatatcgtcaatcttatcgacgactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB115551_PreS2_P-B Feature FT:CDS AB115551_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB15). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcagggacagtgagccctgctcaaaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgngtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB117759_PreS2_P-B Feature FT:CDS AB117759_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB14). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcctggccaaaa
ttcgcagtcccaaatcttcagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcgaaacccctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB195933_PreS2_P-B Feature FT:CDS AB195933_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB195934_PreS2_P-B Feature FT:CDS AB195934_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB195935_PreS2_P-B Feature FT:CDS AB195935_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205119_PreS2_P-B Feature FT:CDS AB205119_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaatgccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205120_PreS2_P-B Feature FT:CDS AB205120_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgccctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggcttccg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205121_PreS2_P-B Feature FT:CDS AB205121_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF720-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagcgtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB205122_PreS2_P-B Feature FT:CDS AB205122_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH69-1). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcagaaacagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtttccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcccgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctcctggtatacatttaa
>gnl|hbvcds|AB212625_PreS2_P-B Feature FT:CDS AB212625_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1026). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccgctttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgcctctgggtatacatttaa
>gnl|hbvcds|AB212626_PreS2_P-B Feature FT:CDS AB212626_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1022). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaatagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtac
cgaacatggggaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaaaacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatggttccctcatgttgctgtacaaaacctacggacagaaactgcacctgtattcccatcccatcatcttgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB219426_PreS2_P-B Feature FT:CDS AB219426_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4014, PNN1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcggtggaactcccccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcctgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttatctttgggtatacatctaa
>gnl|hbvcds|AB219427_PreS2_P-B Feature FT:CDS AB219427_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4075, PNN2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttctatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcctgttgctgtacaaaacctacggaaggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttggggaccaagtctgtacaacatcttgagtccgtt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB219428_PreS2_C-B Feature FT:CDS AB219428_PreS2_C-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4076, PNN3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctctgggtatacatctaa
>gnl|hbvcds|AB219429_PreS2_P-B Feature FT:CDS AB219429_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4101, PNN4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtccaccgatttgtcctggctatcgctggatgtatctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactttcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcctgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB219430_PreS2_P-B Feature FT:CDS AB219430_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4148, PNN5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB231909_PreS2_P-B Feature FT:CDS AB231909_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VH10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaataccgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgctggttcttctggactatcaaggtatgttgccc
gtttgtcctccaattccaggatcatcaaccaccagcactggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB241117_PreS2_P-B Feature FT:CDS AB241117_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PhHCC05). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tacgtttccctcctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcggtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB246339_PreS2_P-B Feature FT:CDS AB246339_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacttttcaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttgtcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccgtcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctatacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB246340_PreS2_P-B Feature FT:CDS AB246340_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccagactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB246341_PreS2_P-B Feature FT:CDS AB246341_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtattttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggatcatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB246342_PreS2_P-B Feature FT:CDS AB246342_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccattttccaccaaactcttcaggatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB246343_PreS2_P-B Feature FT:CDS AB246343_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccattttccaccaaactcttcaggatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgacgactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggttgacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287314_PreS2_P-B Feature FT:CDS AB287314_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska433). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggagcagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287315_PreS2_P-B Feature FT:CDS AB287315_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska419). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggagcagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287316_PreS2_P-B Feature FT:CDS AB287316_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska427). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggagcagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggcccaaa
ttcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggataatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttatctttgggtatccatttaa
>gnl|hbvcds|AB287317_PreS2_P-B Feature FT:CDS AB287317_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska416). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggagcagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287318_PreS2_P-B Feature FT:CDS AB287318_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska2). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactcccccacgttccaccaaactcttcaacatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggagcagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctcattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatctcgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287319_PreS2_P-B Feature FT:CDS AB287319_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AlaskaG23). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggagcagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtccacaaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287320_PreS2_P-B Feature FT:CDS AB287320_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatctgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggtgcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287321_PreS2_P-B Feature FT:CDS AB287321_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagtttaggaacagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggt
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaagccctt
tataccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|AB287322_PreS2_P-B Feature FT:CDS AB287322_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggagacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287323_PreS2_P-B Feature FT:CDS AB287323_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagagtactgcctctgccatatcgtcaaccttatcgacgactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaatgcccgggtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggt
ctttcccccactgtatggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgaggccatt
tacaccgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AB287325_PreS2_P-B Feature FT:CDS AB287325_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
agaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggagacaaccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaagggacctc
tatgtttccctcatgttgttgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggcttttagttatatggatgatgtggtattgggggccaaatctgtgcaccatcttgagtccctt
tatgccgctgttaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|AB287326_PreS2_P-B Feature FT:CDS AB287326_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A44). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctctactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacatctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|AB287327_PreS2_P-B Feature FT:CDS AB287327_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A53). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaaactcatcgacgactgggggccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtccccaatctccaatcactcaccaacctgctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttctgtctttgggtatacatataa
>gnl|hbvcds|AB287328_PreS2_P-B Feature FT:CDS AB287328_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba 51). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacttttcaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttgtcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccgtcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctatacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB287329_PreS2_P-B Feature FT:CDS AB287329_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba A55). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaaaacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB300364_PreS2_P-B Feature FT:CDS AB300364_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB300371_PreS2_P-B Feature FT:CDS AB300371_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient13). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgctcagaatactgtctctaccacatcgtcaatcttatcgacgactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttaccc
gtttgtcctatgatacccggatcatcaacaaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccgtcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggacgatgtggttttgggggccaagtctgtacaacaccttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AB302095_PreS2_P-B Feature FT:CDS AB302095_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
gtgaagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtatcggccatatcgtcaatcttatcgacgactggggaccctgtga
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcgtggccaaaa
ttcgcagtcccaaacctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaaactc
ttcgattccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcgtcatgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctt
catgccgctgttaccaattttcttatgtctttgggtatacatttga
>gnl|hbvcds|AB302942_PreS2_P-B Feature FT:CDS AB302942_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3837NN). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccactttccaccaaactcttcacgatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctgattccaggatcatcaaccaccagcaccggaacatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB302943_PreS2_P-B Feature FT:CDS AB302943_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3639NN). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccactttccaccaaactcttcacgatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctgattccaggatcatcaaccaccagcaccggaacatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB302944_PreS2_P-B Feature FT:CDS AB302944_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3641NN). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccactttccaccaaactcttcacgatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctgattccaggatcatcaaccaccagcaccggaacatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB302945_PreS2_P-B Feature FT:CDS AB302945_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3643NN). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccactttccaccaaactcttcacgatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctgattccaggatcatcaaccaccagcaccggaacatgcaaaacctgcacgactcctgttcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB362933_PreS2_P-B Feature FT:CDS AB362933_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacaaccgagtgtcttggccaaaa
ttcgcagttccaaatctccaatcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccacaagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AB365445_PreS2_P-B Feature FT:CDS AB365445_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BOL1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaacaactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaacgcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggtgcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB368295_PreS2_P-B Feature FT:CDS AB368295_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatccccgagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AB471854_PreS2_P-B Feature FT:CDS AB471854_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-F). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagaggctagactcgtggtggaattctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB471855_PreS2_P-B Feature FT:CDS AB471855_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-C). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB493827_PreS2_P-B Feature FT:CDS AB493827_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25UC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccccgagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB493833_PreS2_P-B Feature FT:CDS AB493833_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttatctttgggtattcatttaa
>gnl|hbvcds|AB493835_PreS2_P-B Feature FT:CDS AB493835_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P30). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB555498_PreS2_P-B Feature FT:CDS AB555498_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA41). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccaaagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtcagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaaaacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctgattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB555499_PreS2_P-B Feature FT:CDS AB555499_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA62). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccactctcctcatgggcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagattactgtctctgccatatcgtcaatcttatcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcccaggacacctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgccc
gtttgtcctctgattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB642093_PreS2_P-B Feature FT:CDS AB642093_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagacttgtggtggacttctctcaattttctaggggaaacacccgtgtgtcytggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccmatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtccyctgattccaggatcatcaaccaccagcacgggaccatgcaaaacmtgcacaactcctgctcaaggaacctc
tatgtttccctcatgctgytgtacaaaacctacggacggaaactgcacctgtattcccatcccatcrtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggaygatrtkgttttgggggccaagwctgstcaacatcttgagtccctt
tatgccgctgttaccaattttcttwtgtctttgggtatacatttaa
>gnl|hbvcds|AB642094_PreS2_P-B Feature FT:CDS AB642094_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacractactgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB642101_PreS2_P-B Feature FT:CDS AB642101_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT2009-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcggtggaactccataactttccaccaaactcttcaagatcccaaagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttcgaggggaagcacccgtgtgtcctggccaaaa
ttcgcagtcccaaatctccagtcactcactaacctgctgtccaccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttgggtcttctggactaccacggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB675676_PreS2_P-B Feature FT:CDS AB675676_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10A37). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB713527_PreS2_P-B Feature FT:CDS AB713527_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv30). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccccgagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagattggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcatggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB713528_PreS2_P-B Feature FT:CDS AB713528_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv44). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcccccaagttccaccaaactcttcaagatccccgagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcctgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB713529_PreS2_P-B Feature FT:CDS AB713529_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv68). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaaatcttcaagaccccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB713530_PreS2_P-B Feature FT:CDS AB713530_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv94). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaaatcttcaagaccccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaaactc
tatgtttccctcatggtgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctctgggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttccccccctgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB713531_PreS2_P-B Feature FT:CDS AB713531_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv98). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccccgagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggaagacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
cttgcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB713532_PreS2_P-B Feature FT:CDS AB713532_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv132). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccccgagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagattggggaccctgtgc
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatccggctgctatggcccaacttcttgtgggttcttctggacaaataaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcatggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AB828708_PreS2_P-B Feature FT:CDS AB828708_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HB12-0626). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccacatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccaytgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatytaa
>gnl|hbvcds|AB900095_PreS2_P-B Feature FT:CDS AB900095_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctgcagtcacttaccaacctcttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctt
tatgccgctgttaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|AB900096_PreS2_P-B Feature FT:CDS AB900096_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtacctccctgctggtggctc
cagttcaggaacagtaaaccctgctcagactactgtctcagccatatcgtcaatctcatcgaagactggggaccctgtga
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttccagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcccctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggcaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagaccctt
tatgccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AB900097_PreS2_P-B Feature FT:CDS AB900097_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtatctgccatatcgtcaatcttatcsaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttccagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggctcttctggactatcaaggtatgttgccc
gtttgtccyctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
twtgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|AB900098_PreS2_P-B Feature FT:CDS AB900098_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctt
cagttcaggaacagtcagccctgctcagaatactgtctctaccatatcgtcaatctcatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgygttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AB900102_PreS2_P-B Feature FT:CDS AB900102_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtrc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttccagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattggggkccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900103_PreS2_P-B Feature FT:CDS AB900103_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcgaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacaaccgtgtgtcttggccaaaa
ttcgcagtcccaaatctgcagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcccctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900104_PreS2_P-B Feature FT:CDS AB900104_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaacctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900105_PreS2_P-B Feature FT:CDS AB900105_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcagaaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgacgactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtgccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcrctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900106_PreS2_P-B Feature FT:CDS AB900106_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgttttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcaagacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900107_PreS2_P-B Feature FT:CDS AB900107_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctaacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtccccaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttctttgttctttgggtatacatataa
>gnl|hbvcds|AB900108_PreS2_P-B Feature FT:CDS AB900108_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagcaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacaaccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900110_PreS2_P-B Feature FT:CDS AB900110_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcctggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900111_PreS2_P-B Feature FT:CDS AB900111_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatctcatcgacgactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtttctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcraccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaccatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB900112_PreS2_P-B Feature FT:CDS AB900112_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtmtcagccayatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttggktctttgggtatacatttaa
>gnl|hbvcds|AB931168_PreS2_P-B Feature FT:CDS AB931168_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1P_HB11-1417). Complete genome. [Hepadnaviridae] (length=846 residues).
atgaagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtatcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttctctaggggtaccacccgtgtgtcctggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttctatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcccctgattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AB931169_PreS2_P-B Feature FT:CDS AB931169_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1S_HB11-1418). Complete genome. [Hepadnaviridae] (length=846 residues).
atgaagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtatcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttctctaggggtaccacccgtgtgtcctggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcccctgattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtgcaacatcttgagtccctt
tatgccgctgttaccaattttctgttgtctttgggtattcatttaa
>gnl|hbvcds|AB976562_PreS2_P-B Feature FT:CDS AB976562_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AK8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccacgttccaccaaactcttcaagatcctcgagtcagggctctgtactttcctgctggtggctc
cagttcaggaactgtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccggtgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF100308_PreS2_P-B Feature FT:CDS AF100308_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF100309_PreS2_P-B Feature FT:CDS AF100309_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctctgaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121243_PreS2_P-B Feature FT:CDS AF121243_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/14611). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121244_PreS2_P-B Feature FT:CDS AF121244_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/15122). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121245_PreS2_P-B Feature FT:CDS AF121245_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/16091). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121246_PreS2_P-B Feature FT:CDS AF121246_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/IK29902). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121247_PreS2_P-B Feature FT:CDS AF121247_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/719). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacrrctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
yaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121248_PreS2_P-B Feature FT:CDS AF121248_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/139-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgaagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121249_PreS2_P-B Feature FT:CDS AF121249_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/4014). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121250_PreS2_P-B Feature FT:CDS AF121250_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/6395). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaagactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF121251_PreS2_P-B Feature FT:CDS AF121251_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/9873). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggcaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtgcaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF279464_PreS2_P-B Feature FT:CDS AF279464_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgaagtggaactcccccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF282917_PreS2_P-B Feature FT:CDS AF282917_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcactggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AF282918_PreS2_P-B Feature FT:CDS AF282918_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctatgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF461360_PreS2_P-B Feature FT:CDS AF461360_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH14-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcagaaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AF479684_PreS2_P-B Feature FT:CDS AF479684_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3c). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AJ627225_PreS2_P-B Feature FT:CDS AJ627225_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 19749). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagacttgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggcacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011084_PreS2_P-B Feature FT:CDS AP011084_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaagaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggtccgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011085_PreS2_P-B Feature FT:CDS AP011085_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcattttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011086_PreS2_P-B Feature FT:CDS AP011086_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcatcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctatgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatatttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AP011087_PreS2_P-B Feature FT:CDS AP011087_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcatcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctatgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AP011088_PreS2_P-B Feature FT:CDS AP011088_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011089_PreS2_P-B Feature FT:CDS AP011089_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaggatcccagagtcagggctctgtattttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagagcactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011090_PreS2_P-B Feature FT:CDS AP011090_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AP011091_PreS2_P-B Feature FT:CDS AP011091_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|AP011092_PreS2_P-B Feature FT:CDS AP011092_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011093_PreS2_P-B Feature FT:CDS AP011093_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatctcatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttattcagtggttcgtaggg
ctttcccccactgtctggctttcagttctatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011094_PreS2_P-B Feature FT:CDS AP011094_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AP011095_PreS2_P-B Feature FT:CDS AP011095_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AP011096_PreS2_P-B Feature FT:CDS AP011096_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgctcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|AY033072_PreS2_P-B Feature FT:CDS AY033072_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctatggacggaaactgcacatgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY033073_PreS2_P-B Feature FT:CDS AY033073_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtattttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctatggacggaaactgcacatgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatagtgatgatatggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY163869_PreS2_P-B Feature FT:CDS AY163869_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMClx-1). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccacaaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctgattccaggatcatcaacaaccagcacgggaacatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY163870_PreS2_P-B Feature FT:CDS AY163870_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMU001). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccacaaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctgattccaggatcatcaacaaccagcacgggaacatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgaatccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167089_PreS2_P-B Feature FT:CDS AY167089_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY167093_PreS2_P-B Feature FT:CDS AY167093_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIa). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaatatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgactccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167094_PreS2_P-B Feature FT:CDS AY167094_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIb). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggnaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacanctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167097_PreS2_P-B Feature FT:CDS AY167097_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIIb). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167098_PreS2_P-B Feature FT:CDS AY167098_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IVa). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|AY167100_PreS2_P-B Feature FT:CDS AY167100_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Va). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcattggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctccgaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgtatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatc
cttacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167101_PreS2_P-B Feature FT:CDS AY167101_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vb). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttctctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY167102_PreS2_P-B Feature FT:CDS AY167102_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vc). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcagaaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggaaaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaatacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgacgcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccattatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206373_PreS2_P-B Feature FT:CDS AY206373_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtctgtt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206375_PreS2_P-B Feature FT:CDS AY206375_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaaccgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtcggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206383_PreS2_P-B Feature FT:CDS AY206383_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcaaccactttccaccacactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggggacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY206390_PreS2_P-B Feature FT:CDS AY206390_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccaaagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacatgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacgtttaa
>gnl|hbvcds|AY206391_PreS2_P-B Feature FT:CDS AY206391_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccctcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcgaagactggggaccctgtac
cgaacatggagaacatcgcgtcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggcacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217355_PreS2_P-B Feature FT:CDS AY217355_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A6-2). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcccccactttccaccaaactcttcaggatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217356_PreS2_P-B Feature FT:CDS AY217356_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A9-2). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcccccactttccaccaaactcttcaggatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217357_PreS2_P-B Feature FT:CDS AY217357_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1r-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217358_PreS2_P-B Feature FT:CDS AY217358_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B8r-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217359_PreS2_P-B Feature FT:CDS AY217359_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Q6-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcggggccctgtattttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgcttgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgttcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217360_PreS2_P-B Feature FT:CDS AY217360_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtattttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgctgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217361_PreS2_P-B Feature FT:CDS AY217361_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 582-2). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttaagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217362_PreS2_P-B Feature FT:CDS AY217362_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 582-4). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggccctgtacgttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY217368_PreS2_P-B Feature FT:CDS AY217368_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 21949). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatattgtctcggccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaagctatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggcatacatttaa
>gnl|hbvcds|AY220697_PreS2_P-B Feature FT:CDS AY220697_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttaccggcggggttttccttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcgtggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatttggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY220698_PreS2_P-B Feature FT:CDS AY220698_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcaaaatactgtctctgccatatcgtcaatcttatcgaaaactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatttggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY220703_PreS2_P-B Feature FT:CDS AY220703_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgaagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcagaaatagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AY220704_PreS2_P-B Feature FT:CDS AY220704_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgaagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcagaaatagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatcgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY293309_PreS2_P-B Feature FT:CDS AY293309_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggattatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY517489_PreS2_P-B Feature FT:CDS AY517489_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaaccccacaacgttccatcaaactcttcaagatcccaaagtcagggctctgtacttccctgctggtagctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctcattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY517619_PreS2_P-B Feature FT:CDS AY517619_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccatcaaactcttcaagatcccaaagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctcattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY518556_PreS2_P-B Feature FT:CDS AY518556_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 57-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagattggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596102_PreS2_P-B Feature FT:CDS AY596102_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596103_PreS2_P-B Feature FT:CDS AY596103_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596104_PreS2_P-B Feature FT:CDS AY596104_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatctccttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596105_PreS2_P-B Feature FT:CDS AY596105_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-5). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596106_PreS2_P-B Feature FT:CDS AY596106_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596109_PreS2_P-B Feature FT:CDS AY596109_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate II-1). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacttctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|AY596110_PreS2_P-B Feature FT:CDS AY596110_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate II-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY596111_PreS2_P-B Feature FT:CDS AY596111_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-3). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacttctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacagcatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|AY596112_PreS2_P-B Feature FT:CDS AY596112_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY766463_PreS2_P-B Feature FT:CDS AY766463_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggcactatactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctccaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcaccttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccaccgtctggctttcagttatatggatgatgtggttttggggaccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY800389_PreS2_P-B Feature FT:CDS AY800389_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041024). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccccgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaccagtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY800391_PreS2_P-B Feature FT:CDS AY800391_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041026). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagggtcagggctctgtactttcctgctggtggctc
cagttcaggaactgtgaaccctgttcagagcactgcctcttccaaatcgtcaatctcatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcatggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgacgcctgctcaaggaaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|AY800392_PreS2_P-B Feature FT:CDS AY800392_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041027). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagggtcagggctctgtactttcctgctggtggctc
cagttcaggaactgtgaaccctgttcagagcactgcctcttccaaatcgtcaatctcatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcatggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgacgcctgctcaaggaaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|D00329_PreS2_P-B Feature FT:CDS D00329_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctatggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|D00330_PreS2_P-B Feature FT:CDS D00330_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccggagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|D00331_PreS2_C-B Feature FT:CDS D00331_PreS2_C-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgacgactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaatacctctgagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacaggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|D23678_PreS2_P-B Feature FT:CDS D23678_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-HBVYS2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtga
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|D23679_PreS2_P-B Feature FT:CDS D23679_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-HBVMS2). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccgccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacggggccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|D50521_PreS2_P-B Feature FT:CDS D50521_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgaccaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttccagggggcacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttggcc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcgaaacacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctt
tatgccgctgttacccattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|D50522_PreS2_P-B Feature FT:CDS D50522_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggtttttctcgttgaccaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttggcc
gtttgtcccctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcaaggcacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141615_PreS2_P-B Feature FT:CDS DQ141615_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH45AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcaatggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctccgaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141616_PreS2_P-B Feature FT:CDS DQ141616_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2061Chinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgatccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141617_PreS2_P-B Feature FT:CDS DQ141617_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH16AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgatccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141618_PreS2_P-B Feature FT:CDS DQ141618_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH21AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagggtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgttgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141619_PreS2_P-B Feature FT:CDS DQ141619_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH38AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141620_PreS2_P-B Feature FT:CDS DQ141620_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH30AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141621_PreS2_P-B Feature FT:CDS DQ141621_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH42AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaccactttccaccaaacttttcaagatcccagagtcaggggcctgtactttcctgttggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaaaatggagaacatcgcatcaggactcctaggacccctgctcgtggtacaggaggggattttctcgttgacaaaaatc
ctcacaataccacagagtctagaatcggggtggacttctctcaattttctaggggaaacacccgtgggtcttggtcaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgggtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggaatgttgccc
gcttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141622_PreS2_P-B Feature FT:CDS DQ141622_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1839Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcagaaacagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141623_PreS2_P-B Feature FT:CDS DQ141623_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1877Chinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcagaaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141624_PreS2_P-B Feature FT:CDS DQ141624_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2069Chinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccgagagtcagggcgctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141625_PreS2_P-B Feature FT:CDS DQ141625_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2360Chinese). Partial genome (Contains: Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccgagagtcagggcgctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tttgtttccctcatgttgctgaacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141626_PreS2_P-B Feature FT:CDS DQ141626_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2175Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccacgttccaccaaactcttcaagatcccagagtcagggctctgttccttcctgttggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccacatcgtcaaccttctcgaagactggggaccctgcgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacaaagtctaaactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttggtgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctccatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141627_PreS2_P-B Feature FT:CDS DQ141627_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2059Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggctctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141628_PreS2_P-B Feature FT:CDS DQ141628_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH44AJava). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcggtggaactcccccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141629_PreS2_P-B Feature FT:CDS DQ141629_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2028Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagtttaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141630_PreS2_P-B Feature FT:CDS DQ141630_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH24AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141631_PreS2_P-B Feature FT:CDS DQ141631_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1932Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaccacattccacaaaactcttcaagatcccagagtcagggctctgtactttcctgctggcggctc
cagttcaggaacagtaaaccctgttcagaccactgcctctcccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141632_PreS2_P-B Feature FT:CDS DQ141632_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIHM1Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141633_PreS2_P-B Feature FT:CDS DQ141633_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIHM2Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tttgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141634_PreS2_P-B Feature FT:CDS DQ141634_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIHM4Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcatccaccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|DQ141635_PreS2_P-B Feature FT:CDS DQ141635_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH27AJava). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacgttccaccaaactcttcaagatcccagagtcagggctctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tttgtttccctcatgtggctgtacaaaacctacggacggaaactgcacctgtattcccatcccgtcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141636_PreS2_P-B Feature FT:CDS DQ141636_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH31AJava). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccacgttccaccaaactcttcaagatccgagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcggggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacaactcctgcacaaggaacctc
tatgtttccctcttgtggctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141637_PreS2_P-B Feature FT:CDS DQ141637_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH32Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccacgttccaccaaactcttcaagatccgagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgcacaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggctttgggggccaagtctggacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141638_PreS2_P-B Feature FT:CDS DQ141638_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr026East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagattccagagtcagggctctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcgaggactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttca
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141639_PreS2_P-B Feature FT:CDS DQ141639_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr056East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggcgctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgctcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatccctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagccccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ141640_PreS2_P-B Feature FT:CDS DQ141640_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr178East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagattccagagtcagggctctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttacatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141641_PreS2_P-B Feature FT:CDS DQ141641_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2077Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtaaagtggaactcccccacgttccaccaaactcttcaagatcccagggtcaaggctctgtactttcctgctggtggctc
cagttcaggaatagtaaaccctgttcagaacactgcctcttccatatcgtcaatctcatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacaaccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagggccatttgttcaggggttcgtaggg
ctttcccccactgtcgggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|DQ141642_PreS2_P-B Feature FT:CDS DQ141642_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2052Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactcctccacgttccaccaaactcttcaagatcccgtagtcagggctctgtaccttcctgttggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaccatcttgagtccatt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ141643_PreS2_P-B Feature FT:CDS DQ141643_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2050Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacgttccacaaaactcttcaagatccccgagtcagggcgctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttga
>gnl|hbvcds|DQ141644_PreS2_P-B Feature FT:CDS DQ141644_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1813Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccccgagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141645_PreS2_P-B Feature FT:CDS DQ141645_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIHM3Java). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcctcgagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141646_PreS2_P-B Feature FT:CDS DQ141646_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH43AChinese). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcctcgagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgttc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgaccaccagcaccgggccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttgctagcgccatttgttcagtggttcgtaggg
ctttcccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141647_PreS2_P-B Feature FT:CDS DQ141647_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr001East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggacaagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgaatccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141648_PreS2_P-B Feature FT:CDS DQ141648_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr029East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctggacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141649_PreS2_P-B Feature FT:CDS DQ141649_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr040East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcctctggactatcaaggtatgttgccc
gtttgtcctctaattccaggattatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgttttcctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctctgggtatacatataa
>gnl|hbvcds|DQ141650_PreS2_P-B Feature FT:CDS DQ141650_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr049East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgtttcaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgaatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcgga
gttttatcatcttcctttgcatcctgctgctatgcctcatgttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatccaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|DQ141651_PreS2_P-B Feature FT:CDS DQ141651_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr052East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgtttcaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggacaagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
agaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagactagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctattcctaatcttcttgttggttctcctggactatcaaggtatgttgccc
ctttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgaatccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141652_PreS2_P-B Feature FT:CDS DQ141652_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr060East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatccaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141653_PreS2_P-B Feature FT:CDS DQ141653_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KD48East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacaactcctgctcaaggaatctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141654_PreS2_P-B Feature FT:CDS DQ141654_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SBT19East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaccaagttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctctcccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaacatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcctgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tttacctctattaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ141655_PreS2_P-B Feature FT:CDS DQ141655_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KD35East). Partial genome (Contains: LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaaactcttcaagatccgagagtcagggctctgtactttcctgctggtggctc
ccgttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaaccttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcacgactcccacgacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacaaagtctagactcgtggtggacttctctcaattttctaaggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagga
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ377158_PreS2_P-B Feature FT:CDS DQ377158_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WJT31). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtctgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448619_PreS2_P-B Feature FT:CDS DQ448619_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-DYH). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctctactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448620_PreS2_P-B Feature FT:CDS DQ448620_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-DYF). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448621_PreS2_P-B Feature FT:CDS DQ448621_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-HQY). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448622_PreS2_P-B Feature FT:CDS DQ448622_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-JSM). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggactctgtac
cgaacatggagaacatcgcatccggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448623_PreS2_P-B Feature FT:CDS DQ448623_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-LMX). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448624_PreS2_P-B Feature FT:CDS DQ448624_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-QSA). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgcttctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448625_PreS2_P-B Feature FT:CDS DQ448625_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-TXB). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaacttcaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448626_PreS2_P-B Feature FT:CDS DQ448626_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-XLB). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448627_PreS2_P-B Feature FT:CDS DQ448627_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-ZFL). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ448628_PreS2_P-B Feature FT:CDS DQ448628_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-ZX). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatccaagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ463787_PreS2_P-B Feature FT:CDS DQ463787_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_1979). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagtgtcttggccaaaa
ttcgcagttccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctt
tataccgctgttaccaattttcttatgtctttgggtatacatttga
>gnl|hbvcds|DQ463788_PreS2_P-B Feature FT:CDS DQ463788_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 739-11_1979). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463789_PreS2_P-B Feature FT:CDS DQ463789_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 650-15_1979). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgctcaaaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatccggactcctaggacccctgctcgtgttacaggcggggtttttcttgtkgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttctatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ463790_PreS2_P-B Feature FT:CDS DQ463790_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 621-14_1979). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcctcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463791_PreS2_P-B Feature FT:CDS DQ463791_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 539-16_1979). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggacacacccgtgtgtcctggccaaaa
ttcgcagtcccaaatctgcagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggctcttctggactatcagggtatgttgccc
gtttgtcctctaattccaggatcatcgaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggcttttagttatatggatgatgtggtcttgggggccaaatctgtgcaacaccttgagtccctt
tatgccgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463792_PreS2_P-B Feature FT:CDS DQ463792_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 524-3_1979). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggagacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463793_PreS2_P-B Feature FT:CDS DQ463793_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 462-4_1979). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagattactgcctctcccatatcgtcaatcttaccgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacttgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463794_PreS2_P-B Feature FT:CDS DQ463794_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 234-6_1979). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcagggacagtgaaccctgctcaaaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaaccacccgtgtgtcctggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463795_PreS2_P-B Feature FT:CDS DQ463795_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_2004). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaacaccgcagagtctagactcgtggtggacttctctcagttttctagggggaacacccgagtgtcttggccaaaa
ttcgcagttccaaatctccaatcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccgtgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtgcaacaccttgagtcgctt
tgtaccgctgtttccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463796_PreS2_P-B Feature FT:CDS DQ463796_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 739-11_2004). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcactggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463797_PreS2_P-B Feature FT:CDS DQ463797_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 650-15_2004). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatccggactcctaggacccctgctcgtgttacaggcggggtttttcttgtkgacaaaaatc
ctcacaataccgcagagtctagacttgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatacctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgcgcaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ463798_PreS2_P-B Feature FT:CDS DQ463798_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 621-14_2004). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463799_PreS2_P-B Feature FT:CDS DQ463799_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 539-16_2004). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggacacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcagggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggcttccg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatt
tatgccgctgttacccattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|DQ463800_PreS2_P-B Feature FT:CDS DQ463800_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 524-3_2004). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggagacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacaccttgagtccctt
tatgccgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463801_PreS2_P-B Feature FT:CDS DQ463801_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 462-4_2004). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagattactgcctctcccatatcgtcaatcttaccgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaaaacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacttgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ463802_PreS2_P-B Feature FT:CDS DQ463802_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 234-6_2004). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccacgttccaccaaactcttcaagattccacagtcaggactctgaaccttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgccacatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttctgtctttgggtatacatttga
>gnl|hbvcds|DQ904357_PreS2_P-B Feature FT:CDS DQ904357_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaacgcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtgtacatataa
>gnl|hbvcds|DQ975271_PreS2_P-B Feature FT:CDS DQ975271_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccagactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctgaatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgtaggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993680_PreS2_P-B Feature FT:CDS DQ993680_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 268). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaatagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtatctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993681_PreS2_P-B Feature FT:CDS DQ993681_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 290). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaatagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtatctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|DQ993682_PreS2_P-B Feature FT:CDS DQ993682_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 479). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcgtggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtatctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993683_PreS2_P-B Feature FT:CDS DQ993683_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 82). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaatagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtatctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctgtgggtatacatttaa
>gnl|hbvcds|DQ993684_PreS2_P-B Feature FT:CDS DQ993684_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 336). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtattttcctgctggtggctc
cagttcaggaacagtgagtcctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactccaaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaatcc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcccagtcccaaatctccagtcactcaccaacttgttgtcctcccgattgtcctggttatccccggatgtgtctgcggg
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993685_PreS2_P-B Feature FT:CDS DQ993685_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 554). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaatagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatcgctggatgtatctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993686_PreS2_P-B Feature FT:CDS DQ993686_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 342). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcctggccaaaa
ttcgcagtcccaaatcttcagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaactcctgctcgaaacccctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993687_PreS2_P-B Feature FT:CDS DQ993687_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 700). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaaccgtgagccctgctcakaakactgcctctgccatatcgkcaaccttctygaagactggggaccctgtac
ckaacatggagaacatcrcatcaggactcctrggacccctgctcgtgttacargcggggtttttctcgttgacaaaaatc
ctcacaataccacagagkctagactcgtggtggacttctctcaattttccagggggaacacccgtgtgtcttggccaaaa
ttcrcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcgcatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactattgccatttgttcagtggttcgtaagg
ctttcccccactgtctggttttcagttatatggatgatgtggaattgggggccaagtctgtacaaaatcgggagtccctt
tatgccgctgttacccattttcttttgtcyttsggwattcatttaa
>gnl|hbvcds|DQ993694_PreS2_P-B Feature FT:CDS DQ993694_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 234). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaacactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaaccgtgagccctgctcagactactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
stcacaataccacagagkctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcrcagtcccaaatctccagtcactcaccaacttgttgtcctcccatttgtcctggatatcgctggatgtgtctgcggc
gttctatcatcttcctctgcatcctgctgctatgcctcatcttggtgttggttcttctggactatcaaggtatgttgctc
gtttgtcctctaattcccggatcatcaaccacctacaccggaccatggagaacctgcatgactcctggtgaaggaacctc
tatgtttccctcatgttgctgtacaaaacctaccaacggaaactgcacctgtagtcccatctcatcatcatggactttcg
caaaatacctatggtagtgggccaccgtccgtttctctaggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993696_PreS2_P-B Feature FT:CDS DQ993696_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 452b1). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtgggggacttctctaaattttctggtgggagcacccgtgtgtcttgaccaaaa
ttcgcagtccccaatctccagtcactcaccaacctgttgtcctcccatttgtcctgattatccctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgatggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatggaatacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcgcctgtattcccgtcccatcatcttgggctttcc
caaaatacctatgggagtgggcctcagttcgtttctcttggctcggtttactagtgccatttgttcagtggttcgtaagg
ctttccccccttgtctggctttcagttatatggatgatgtggtactgggggccaagtctgtacaacatcttgagtccctt
tatgccsctgttaccawttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993697_PreS2_P-B Feature FT:CDS DQ993697_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 940b1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgttcaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993698_PreS2_P-B Feature FT:CDS DQ993698_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0327-ETCvs3TC-Naive). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttctctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcagaagctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993699_PreS2_P-B Feature FT:CDS DQ993699_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0226-ETCvs3TC-Break). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttctctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcagaagctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993700_PreS2_P-B Feature FT:CDS DQ993700_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0725-ETC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgcaatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggaagatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993701_PreS2_P-B Feature FT:CDS DQ993701_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0210-ETCvs3TC-Brack). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|DQ993702_PreS2_P-B Feature FT:CDS DQ993702_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0919-ETCvs3TC-Naive). Complete genome. [Hepadnaviridae] (length=846 residues).
atggaatggaactccaccactttccaccaaactcttcaagatcccaaagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcgga
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttccaccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttgtgtctttgggtatacctttaa
>gnl|hbvcds|DQ993703_PreS2_P-B Feature FT:CDS DQ993703_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 236-0526-Nature1.2-Sero). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993704_PreS2_P-B Feature FT:CDS DQ993704_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-1127-Nature3.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993705_PreS2_P-B Feature FT:CDS DQ993705_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-0625-Nature3.4-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggacctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttaccggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccatatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgccgc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993706_PreS2_P-B Feature FT:CDS DQ993706_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-0402-Nature3.3-unSero). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993707_PreS2_P-B Feature FT:CDS DQ993707_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-O218-Nature3.2-unSero). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993708_PreS2_P-B Feature FT:CDS DQ993708_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6136-1228-Naive). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993709_PreS2_P-B Feature FT:CDS DQ993709_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6136-0127-ETCvs3TC-Break). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagaccccaaagtcaaggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993710_PreS2_P-B Feature FT:CDS DQ993710_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0718-ETC). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttctctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccatt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ993711_PreS2_P-B Feature FT:CDS DQ993711_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 221-1120-Nature1.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggnaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgactcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995801_PreS2_P-B Feature FT:CDS DQ995801_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H60-6). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactctccaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtctctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgccctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtgcaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995802_PreS2_P-B Feature FT:CDS DQ995802_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H293-16). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacgggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaatacccgtgtgtcttggccaaaa
ttcgcagtccccaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgccggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaatctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagttccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995803_PreS2_P-B Feature FT:CDS DQ995803_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C265-15). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggccctgtactttcctgctggtggctc
cagttcagaaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagagcatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtttctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgattcgtaggg
ctttcccccactgtctggcttttagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|DQ995804_PreS2_P-B Feature FT:CDS DQ995804_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1691-11). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccaccaagttccaccaaactcttcaagatcccagagtcagggccctgtacattcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcggttttccaggggggacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tatgccgctgttactcattctcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF134945_PreS2_P-B Feature FT:CDS EF134945_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccccgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaagaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF134946_PreS2_P-B Feature FT:CDS EF134946_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaagaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF473971_PreS2_P-B Feature FT:CDS EF473971_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2059Java). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF473972_PreS2_P-B Feature FT:CDS EF473972_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1839Java). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcagaaacagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF473973_PreS2_P-B Feature FT:CDS EF473973_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH45AChinese). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctccgaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF473974_PreS2_P-B Feature FT:CDS EF473974_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH21AChinese). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagggtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgttgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF473975_PreS2_P-B Feature FT:CDS EF473975_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2061Chinese). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgatccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF473976_PreS2_P-B Feature FT:CDS EF473976_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr049East). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgaatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcgga
gttttatcatcttcctttgcatcctgctgctatgcctcatgttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatccaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EF473977_PreS2_P-B Feature FT:CDS EF473977_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KD048East). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacaactcctgctcaaggaatctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF494380_PreS2_P-B Feature FT:CDS EF494380_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TW836). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggagctccaccactttccaccaaactcttcaagatcccagagtcagggccctgtattttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttctatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcgcctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EF494381_PreS2_P-B Feature FT:CDS EF494381_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TW936). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactcaaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatctcatcgacgactggggaccctgtac
cgaacatggagaacatagcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatctgcttgttgggtcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacgggaactgcacctgtattcccatcccatcatcttgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU139543_PreS2_P-B Feature FT:CDS EU139543_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU158262_PreS2_P-B Feature FT:CDS EU158262_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G116). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccactttccaccaaactcttcaagatcccaaagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttttccttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctattaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU158263_PreS2_P-B Feature FT:CDS EU158263_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G108). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggcacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU305547_PreS2_P-B Feature FT:CDS EU305547_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M118-481). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cggttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtgcaaaacctacgaacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttctttcgtctttgggtatacatttaa
>gnl|hbvcds|EU305548_PreS2_P-B Feature FT:CDS EU305548_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M118-673). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgacgaccagcatcggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306677_PreS2_P-B Feature FT:CDS EU306677_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgcctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtctgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacatctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttaggggcgaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306678_PreS2_P-B Feature FT:CDS EU306678_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacatctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306679_PreS2_P-B Feature FT:CDS EU306679_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacgtttaa
>gnl|hbvcds|EU306680_PreS2_P-B Feature FT:CDS EU306680_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacgtttaa
>gnl|hbvcds|EU306681_PreS2_P-B Feature FT:CDS EU306681_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacatctcctgctcaaggaacctc
tatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306695_PreS2_P-B Feature FT:CDS EU306695_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtctgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306696_PreS2_P-B Feature FT:CDS EU306696_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtctgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagagggcctcagtccgtttctcttggctcagtttactagtgccattcgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306697_PreS2_P-B Feature FT:CDS EU306697_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtctgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306698_PreS2_P-B Feature FT:CDS EU306698_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtctgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306699_PreS2_P-B Feature FT:CDS EU306699_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcagaaccagcacaactcttgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcggtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctcccagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|EU306700_PreS2_P-B Feature FT:CDS EU306700_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306701_PreS2_P-B Feature FT:CDS EU306701_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306702_PreS2_P-B Feature FT:CDS EU306702_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306703_PreS2_P-B Feature FT:CDS EU306703_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttgcaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggttgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306704_PreS2_P-B Feature FT:CDS EU306704_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcagaaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatgcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306705_PreS2_P-B Feature FT:CDS EU306705_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccgctgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306706_PreS2_P-B Feature FT:CDS EU306706_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306707_PreS2_P-B Feature FT:CDS EU306707_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagcgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatgcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306708_PreS2_P-B Feature FT:CDS EU306708_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306709_PreS2_P-B Feature FT:CDS EU306709_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306710_PreS2_P-B Feature FT:CDS EU306710_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
caattcaggaacggtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306711_PreS2_P-B Feature FT:CDS EU306711_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccatcactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaaccgtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcacttaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcaacaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU306712_PreS2_P-B Feature FT:CDS EU306712_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330989_PreS2_P-B Feature FT:CDS EU330989_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84-74). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcagccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcgtgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaacacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggcttttagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330990_PreS2_P-B Feature FT:CDS EU330990_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84-146). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcagccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcgtgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaacacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggcttttagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330992_PreS2_P-B Feature FT:CDS EU330992_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-6). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcgaagactggggaccctgcac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacctgaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330994_PreS2_P-B Feature FT:CDS EU330994_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-10). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcgaagactggggaccctgcac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccggtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaagg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330995_PreS2_P-B Feature FT:CDS EU330995_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-80). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacagaaatc
ctcacaataccacagagcctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttgccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|EU330996_PreS2_P-B Feature FT:CDS EU330996_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-81). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330997_PreS2_P-B Feature FT:CDS EU330997_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-216). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330998_PreS2_P-B Feature FT:CDS EU330998_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1043). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcgaagactggggaccctgcac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtcgctggatgtgtctgcggc
tttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU330999_PreS2_P-B Feature FT:CDS EU330999_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1044). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcgaagactggggaccctgcac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtcgctggatgtgtctgcggc
tttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU331000_PreS2_P-B Feature FT:CDS EU331000_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1045). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcgaagactggggaccctgcac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU331001_PreS2_P-B Feature FT:CDS EU331001_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1046). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcgaagactggggaccctgcac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU350409_PreS2_P-B Feature FT:CDS EU350409_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BTO5856). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439018_PreS2_P-B Feature FT:CDS EU439018_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439020_PreS2_P-B Feature FT:CDS EU439020_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccgctttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatacagtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcggttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439021_PreS2_P-B Feature FT:CDS EU439021_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcagaaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagagcatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattctcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439022_PreS2_P-B Feature FT:CDS EU439022_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gtttcatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaaccgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU439023_PreS2_P-B Feature FT:CDS EU439023_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcctcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgctgccc
gtttgtcctctaattccaggaccatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU487256_PreS2_P-B Feature FT:CDS EU487256_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttcctccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactactgctcaaggaacctc
tttgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatacagctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU487257_PreS2_P-B Feature FT:CDS EU487257_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient14). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaagacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU522067_PreS2_P-B Feature FT:CDS EU522067_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 4T). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctccaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttacatggatgatgtggtattgggggccaagtctatacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU522072_PreS2_P-B Feature FT:CDS EU522072_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8N). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcagggacagtgaaccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtgttcatttaa
>gnl|hbvcds|EU522074_PreS2_P-B Feature FT:CDS EU522074_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcagggacagtgaaccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtgtacatttaa
>gnl|hbvcds|EU547563_PreS2_P-B Feature FT:CDS EU547563_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MC06). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaacgccaccacgttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggraacacccgtgtgtcytggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgttggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU564822_PreS2_P-B Feature FT:CDS EU564822_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10TA). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaacgccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcagaaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU564823_PreS2_P-B Feature FT:CDS EU564823_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10TB). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU564824_PreS2_P-B Feature FT:CDS EU564824_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10N). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgctgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU564826_PreS2_P-B Feature FT:CDS EU564826_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-11N). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccacaaaactcttcaagatcccagagtcagggccctgaactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU570069_PreS2_P-B Feature FT:CDS EU570069_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1-B24). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacgggaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgagtatacatttaa
>gnl|hbvcds|EU570070_PreS2_P-B Feature FT:CDS EU570070_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2-B24). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU570071_PreS2_P-B Feature FT:CDS EU570071_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4-B24). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU570075_PreS2_P-B Feature FT:CDS EU570075_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11-S142). Complete genome. [Hepadnaviridae] (length=846 residues).
attcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttccagggggaacacccgcgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcgtcgacaacgagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcaaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU579441_PreS2_P-B Feature FT:CDS EU579441_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12). Complete genome. [Hepadnaviridae] (length=846 residues).
attcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctcccaattttccagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcctgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcgtcgacaacgagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcaaaatctgtacaccatcttgagtccctt
tatgccgctgttaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU589335_PreS2_P-B Feature FT:CDS EU589335_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S142-5). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
attcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttccagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcgtcgacaacgagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcaaaatctgtacaccatcttgagtccctt
tatgccgctgttaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU595031_PreS2_P-B Feature FT:CDS EU595031_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtctggctttcagttatattgatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatttaa
>gnl|hbvcds|EU660224_PreS2_P-B Feature FT:CDS EU660224_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-12N). Non-functional genomic sequence. [Hepadnaviridae] (length=837 residues).
atgcagtggaactccaccactttcctccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtacgttgccc
gtttgtcctctaacaaacagaaccagcaccggaccatgcaaaacctgcacaactactgctcaaggaacctctttgtttcc
ctcatgttgctgttccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacc
tatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttccccc
actgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtatgccatcttgagtccctttatacagct
gttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU660230_PreS2_P-B Feature FT:CDS EU660230_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16T-del1). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcggtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatctcatcgacgactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttccaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcgtcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccgtt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU660231_PreS2_P-B Feature FT:CDS EU660231_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16T-del2). Partial genome (Contains: HBc, HBx, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
gtgcggtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatctcatcgacgactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttccaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcgtcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccgtt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU660232_PreS2_P-B Feature FT:CDS EU660232_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16N-del1). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=837 residues).
gtgcggtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatctcatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttccaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggaaccagcaccggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtttcc
ctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacc
tatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttccccc
actgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgct
gttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU660233_PreS2_P-B Feature FT:CDS EU660233_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-16N-del2). Partial genome (Contains: HBc, HBx, MHBs, SHBs). [Hepadnaviridae] (length=837 residues).
gtgcggtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatctcatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttccaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggaaccagcaccggaccatgcaggacctgcacgactcctgctcaaggaacctctatgtttcc
ctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacc
tatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttccccc
actgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttatgccgct
gttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU796066_PreS2_P-B Feature FT:CDS EU796066_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU796067_PreS2_P-B Feature FT:CDS EU796067_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttattggagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggcttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU796068_PreS2_P-B Feature FT:CDS EU796068_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggcactgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggtgaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU796071_PreS2_P-B Feature FT:CDS EU796071_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccatcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgtaggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttttctttgggtatacatttaa
>gnl|hbvcds|EU881997_PreS2_P-B Feature FT:CDS EU881997_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient18). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccgctttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcgaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU881998_PreS2_P-B Feature FT:CDS EU881998_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient18). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU882002_PreS2_P-B Feature FT:CDS EU882002_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient20). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU882003_PreS2_P-B Feature FT:CDS EU882003_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient21). Non-functional genomic sequence. [Hepadnaviridae] (length=837 residues).
atgcagtggaactccaccactttccacaaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggaaacagcaccggaccatgcaaggcctgcacgactcctgctcaaggaacctctatgtttcc
ctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacc
tatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttccccc
actgcctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttatgccgct
gttaccaattttctattgtctttgggtatacatttaa
>gnl|hbvcds|EU882004_PreS2_P-B Feature FT:CDS EU882004_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient21). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaggcctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgctcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|EU919171_PreS2_P-B Feature FT:CDS EU919171_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient29). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttgtcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctgattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU919172_PreS2_P-B Feature FT:CDS EU919172_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient30). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactcccccactttccaccaaactcttcaagatcccaaagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
cacaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU919173_PreS2_P-B Feature FT:CDS EU919173_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient30). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|EU919175_PreS2_P-B Feature FT:CDS EU919175_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient34). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcttcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU919176_PreS2_P-B Feature FT:CDS EU919176_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient34). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcttcgacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939559_PreS2_P-B Feature FT:CDS EU939559_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C67). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939633_PreS2_P-B Feature FT:CDS EU939633_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C181). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgaagtggaactccaccactttccaccaaactcttcaagatcccaaagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctt
tatgccgctattaccaattttctttggtctttgggtatacatgtaa
>gnl|hbvcds|EU939634_PreS2_P-B Feature FT:CDS EU939634_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C19). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgaagtggaactccaccactttccaccaaactcttcaagatcccaaagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacccacgtgtcctggccaaaa
ttcgcagtccccaacctccaatcactcaccaacctcttgtcctccaatttgtcctggctatcgttggatgtgtctgcggc
gttttatcatattcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctt
tatgccgctattaccaattttctttgstctttgggtatacatgtaa
>gnl|hbvcds|EU939635_PreS2_P-B Feature FT:CDS EU939635_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B125). Partial genome (Contains: HBc, LHBs, MHBs, SHBs, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtatttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaaaactgtacagcatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939636_PreS2_P-B Feature FT:CDS EU939636_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctatacttccctgctggtggctc
cagttcagggacagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtac
cgaatatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttggggtccaaatctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939637_PreS2_P-B Feature FT:CDS EU939637_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C13). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaagacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaagtctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggcttccg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacgacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939638_PreS2_P-B Feature FT:CDS EU939638_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C17). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgttgtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatatttccctcatgttgctgtacaaaacctacggacggcaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939639_PreS2_P-B Feature FT:CDS EU939639_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C28). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccacttttcaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtattacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggaacatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939661_PreS2_P-B Feature FT:CDS EU939661_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C40). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtatcggccatatcgtcaatctcatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaagacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaacctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939663_PreS2_P-B Feature FT:CDS EU939663_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C74). Complete genome. [Hepadnaviridae] (length=846 residues).
atgaagtggaactcccccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcagaaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939664_PreS2_P-B Feature FT:CDS EU939664_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C85). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctygttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaamcacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939665_PreS2_P-B Feature FT:CDS EU939665_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C129). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctrccatatcgtcaatcttatygaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939666_PreS2_P-B Feature FT:CDS EU939666_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C150). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagacctcagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939667_PreS2_P-B Feature FT:CDS EU939667_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C171). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagagtactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatttggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939669_PreS2_P-B Feature FT:CDS EU939669_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C185). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939670_PreS2_P-B Feature FT:CDS EU939670_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C189). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtacattcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaagtc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcatggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctaattccaggaacatcaacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagcgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939671_PreS2_P-B Feature FT:CDS EU939671_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C201). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgcagtggaactccaccactttcctccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctccgaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tttgactccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939672_PreS2_P-B Feature FT:CDS EU939672_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacactcgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939673_PreS2_P-B Feature FT:CDS EU939673_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C219). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggccctgtattttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacatgcacatctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939674_PreS2_P-B Feature FT:CDS EU939674_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaactgtgaaccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttatctttgggtatacatttaa
>gnl|hbvcds|EU939675_PreS2_P-B Feature FT:CDS EU939675_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C235). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggt
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaccatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939676_PreS2_P-B Feature FT:CDS EU939676_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D54). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggccctgtatcttcctgctggtggctc
cagttcaggaacagtgagccctgctccgaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaactaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939677_PreS2_P-B Feature FT:CDS EU939677_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D95). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaatacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatccacaaccagcacgggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|EU939678_PreS2_P-B Feature FT:CDS EU939678_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D106). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggccctgtatcttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttctcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttctatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcgtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctt
catgccgctgttacccattttcttgtgtctttgggcatacatttaa
>gnl|hbvcds|EU939679_PreS2_P-B Feature FT:CDS EU939679_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D134). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgtaggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgaccaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgattccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023631_PreS2_P-B Feature FT:CDS FJ023631_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2_C04-1213). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccgagctcttcaaactcccaaagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctcccatatcgtcaaactcatcgacgactggggtccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacaaccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctttcattccaggatcatcaacaaccagcaccggaccatgcaaaacttgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtaccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttacatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgtttccaattttcttgtgtctttgggtatacatttaa
>gnl|hbvcds|FJ023632_PreS2_P-B Feature FT:CDS FJ023632_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-0254). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|FJ023633_PreS2_P-B Feature FT:CDS FJ023633_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-0583). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaaccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatwcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023634_PreS2_P-B Feature FT:CDS FJ023634_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_C04-1358). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctatactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023635_PreS2_P-B Feature FT:CDS FJ023635_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_M04-0467). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccactactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttcttgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023636_PreS2_P-B Feature FT:CDS FJ023636_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B4_M04-0876). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaactcccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcaccaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatatttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023637_PreS2_P-B Feature FT:CDS FJ023637_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B5_M04-0013). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggcgctgtactttcctgctggtggctc
cagttcaggaacactgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgcac
cgaacatggagaacatcrcatcargactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ023638_PreS2_P-B Feature FT:CDS FJ023638_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B5_M04-0465). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtccccaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032342_PreS2_P-B Feature FT:CDS FJ032342_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S659-2). Complete genome. [Hepadnaviridae] (length=846 residues).
acgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggcactgtactttcctgctggtggctc
cagttcaggaacactgagccctgctcagaacactgtctctaccacatcgtcaatctcatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcgtggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaaactc
ttcgttaccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
catgccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|FJ032344_PreS2_P-B Feature FT:CDS FJ032344_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S659-5). Complete genome. [Hepadnaviridae] (length=846 residues).
attcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcgtggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaaactc
ttcgcttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
catgccgctgttaccaattttcttgtgtctttgggtatacatctaa
>gnl|hbvcds|FJ032349_PreS2_P-B Feature FT:CDS FJ032349_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S734-1). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagattggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcatcaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcaccaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcacgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatttggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032352_PreS2_P-B Feature FT:CDS FJ032352_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-3). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tacgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcgtcttgggctttcg
caaaatatctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032353_PreS2_P-B Feature FT:CDS FJ032353_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tacgcttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032354_PreS2_P-B Feature FT:CDS FJ032354_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1026-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tacgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032357_PreS2_P-B Feature FT:CDS FJ032357_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1607-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcggtggaactcccccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcccaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ032358_PreS2_P-B Feature FT:CDS FJ032358_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1607-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcggtggaactcccccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttggcaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtggccc
gtttgtcctctaattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcaatttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccacgtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttgtgtctttgggtatacatgtaa
>gnl|hbvcds|FJ349236_PreS2_P-B Feature FT:CDS FJ349236_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C15). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386582_PreS2_P-B Feature FT:CDS FJ386582_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1765). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggcactgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtttgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386583_PreS2_P-B Feature FT:CDS FJ386583_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1780). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgttc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386584_PreS2_P-B Feature FT:CDS FJ386584_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1798). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtttgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386600_PreS2_P-B Feature FT:CDS FJ386600_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1893). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtttgcggc
gttttatcctcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tacgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386608_PreS2_P-B Feature FT:CDS FJ386608_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1998). Complete genome. [Hepadnaviridae] (length=846 residues).
attcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcaaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgacaaccagcactggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcgtcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatattgatgatgtggttttggggaccaagtctgtacaacatcgtgaggccatt
tatgccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|FJ386610_PreS2_P-B Feature FT:CDS FJ386610_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2000). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttgtcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386615_PreS2_P-B Feature FT:CDS FJ386615_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2061). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactytcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386634_PreS2_P-B Feature FT:CDS FJ386634_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2392). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactctgcaaaatcccaaagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaactaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386636_PreS2_P-B Feature FT:CDS FJ386636_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1813). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctgccaatttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagtttaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtttgcggc
gttttatcctcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386642_PreS2_P-B Feature FT:CDS FJ386642_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1829). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctamttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386648_PreS2_P-B Feature FT:CDS FJ386648_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2419). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagaccccaaagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaacctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctaattccaggaacatcaactaccagcacgggaccctgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcttgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caagatacctatgggagtgggcctcaatccgtttctcttcgctcaatttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctt
tttgcctctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386654_PreS2_P-B Feature FT:CDS FJ386654_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S51). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgacaaccagcaccgggccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386655_PreS2_P-B Feature FT:CDS FJ386655_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S121). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaacccttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggggtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386656_PreS2_P-B Feature FT:CDS FJ386656_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S142). Complete genome. [Hepadnaviridae] (length=846 residues).
attcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttccagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcgtcgacaacgagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccctttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcaaaatctgtacaccatcttgagtccctt
tatgccgctgttaccacttttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386658_PreS2_P-B Feature FT:CDS FJ386658_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S185). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggtgtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386660_PreS2_P-B Feature FT:CDS FJ386660_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S221). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtatyttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386666_PreS2_P-B Feature FT:CDS FJ386666_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S367). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatatttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386668_PreS2_P-B Feature FT:CDS FJ386668_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S395). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386669_PreS2_P-B Feature FT:CDS FJ386669_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S411). Complete genome. [Hepadnaviridae] (length=846 residues).
atgacccggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgttggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatctcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386675_PreS2_P-B Feature FT:CDS FJ386675_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S734). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagattggggaccctgtac
cgaacatggagaacatckcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcaccaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatttggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386676_PreS2_P-B Feature FT:CDS FJ386676_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1055). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgtttccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386680_PreS2_P-B Feature FT:CDS FJ386680_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1244). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggccctatacttccctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccgtt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|FJ386681_PreS2_P-B Feature FT:CDS FJ386681_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1336). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggttcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatt
cataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386682_PreS2_P-B Feature FT:CDS FJ386682_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1416). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctygttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386683_PreS2_P-B Feature FT:CDS FJ386683_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1450). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggacctccaccactgtccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggaacatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386684_PreS2_P-B Feature FT:CDS FJ386684_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1554). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttgtcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ386688_PreS2_P-B Feature FT:CDS FJ386688_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S1632). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaattccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctccttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ518812_PreS2_P-B Feature FT:CDS FJ518812_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtattacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttgtctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562219_PreS2_P-B Feature FT:CDS FJ562219_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
ttcgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562222_PreS2_P-B Feature FT:CDS FJ562222_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I14). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562224_PreS2_P-B Feature FT:CDS FJ562224_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I16). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatctccttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562231_PreS2_P-B Feature FT:CDS FJ562231_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I44). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttgtcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacagaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562234_PreS2_P-B Feature FT:CDS FJ562234_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I49). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttttcctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562236_PreS2_P-B Feature FT:CDS FJ562236_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I51). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggcactgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttatctttgggtatacatttaa
>gnl|hbvcds|FJ562237_PreS2_P-B Feature FT:CDS FJ562237_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I53). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaggcctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562240_PreS2_P-B Feature FT:CDS FJ562240_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I65). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggccctgtatcttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgactaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562246_PreS2_P-B Feature FT:CDS FJ562246_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I74). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtctgtcctctcattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562253_PreS2_P-B Feature FT:CDS FJ562253_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I86). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggttttccttgttgataaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562254_PreS2_P-B Feature FT:CDS FJ562254_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I87). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccgctttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562257_PreS2_P-B Feature FT:CDS FJ562257_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I96). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgttc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcatcggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562259_PreS2_P-B Feature FT:CDS FJ562259_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I106). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccacctaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562260_PreS2_P-B Feature FT:CDS FJ562260_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I107). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaattccaccacattccaccaaactctacaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctcccayatcgtcaaccttatcgacgactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcayaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgttggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562289_PreS2_P-B Feature FT:CDS FJ562289_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I160). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacttttcaccaaactcttcaagatcccagagtcagggccctgtaytttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgttc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562296_PreS2_P-B Feature FT:CDS FJ562296_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I171). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaaaactgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562303_PreS2_P-B Feature FT:CDS FJ562303_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I189). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcctcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tttgtttccatcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|FJ562311_PreS2_P-B Feature FT:CDS FJ562311_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I202). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttcmaccaaactcttcaaratcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacaccttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562312_PreS2_P-B Feature FT:CDS FJ562312_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I203). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacatctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccgtcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562316_PreS2_P-B Feature FT:CDS FJ562316_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I208). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaatctcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcctcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562321_PreS2_P-B Feature FT:CDS FJ562321_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I214). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ562322_PreS2_P-B Feature FT:CDS FJ562322_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I216). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctatggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ787444_PreS2_P-B Feature FT:CDS FJ787444_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S208-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgctgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ787475_PreS2_P-B Feature FT:CDS FJ787475_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcaatggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcagaaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctagggcccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacctctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggtgtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccgta
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ787476_PreS2_P-B Feature FT:CDS FJ787476_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CX-3). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaaaatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgacctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcgccggaccatgcaaaacctgcacgacgcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggtgtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccgtt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ787477_PreS2_P-B Feature FT:CDS FJ787477_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LWM-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatcgcttgatgtgtctgcggc
gttttatcatcctcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgctc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaccttgagcccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ899779_PreS2_P-B Feature FT:CDS FJ899779_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C185-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gtcttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcctgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ899784_PreS2_P-B Feature FT:CDS FJ899784_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacactcgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ899785_PreS2_P-B Feature FT:CDS FJ899785_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcgatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacactcgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ899786_PreS2_P-B Feature FT:CDS FJ899786_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-7). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacactcgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ899787_PreS2_P-B Feature FT:CDS FJ899787_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C215-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaacaccacagagtctagactcgtggtggacttctctcagttttctaggggaaacactcgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|FJ899790_PreS2_P-B Feature FT:CDS FJ899790_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaactgtgaaccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttatctttgggtatacatttaa
>gnl|hbvcds|FJ899791_PreS2_P-B Feature FT:CDS FJ899791_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C232-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaactgtgaaccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttatctttgggtatacatttaa
>gnl|hbvcds|GQ358136_PreS2_P-B Feature FT:CDS GQ358136_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIHB134). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatccaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgttcccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ358137_PreS2_P-B Feature FT:CDS GQ358137_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY001). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgacaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ358138_PreS2_P-B Feature FT:CDS GQ358138_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY041). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ358139_PreS2_P-B Feature FT:CDS GQ358139_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FLT032). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtattttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagaatctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ358140_PreS2_P-B Feature FT:CDS GQ358140_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FLT020). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtattttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggatcatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ358141_PreS2_P-B Feature FT:CDS GQ358141_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LBY009). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|GQ358142_PreS2_P-B Feature FT:CDS GQ358142_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate LAR070). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatccaccaccagcaccggaccatgcagaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ358143_PreS2_P-B Feature FT:CDS GQ358143_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate CBL027). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ358144_PreS2_P-B Feature FT:CDS GQ358144_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI15). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaaactcttcaagatccgagagtcagggctctgtactttcctgctggtggctc
ccgttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaaccttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcacgactcccacgacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacaaagtctagactcgtggtggacttctctcaattttctaaggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctaagggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagga
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ358145_PreS2_P-B Feature FT:CDS GQ358145_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI04). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaaactcttcaagatccgagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaaccttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagga
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ358146_PreS2_P-B Feature FT:CDS GQ358146_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI35). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaaactcttcaagatccgagagtcagggctctgtactttcctgctggtggctc
cggttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaaccttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagga
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ358147_PreS2_P-B Feature FT:CDS GQ358147_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KDI43). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacattccaccaaactcttcaagatccgagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacattgcctcttccatatcgtcaaccttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagga
ctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ358148_PreS2_P-B Feature FT:CDS GQ358148_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ALO36). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggcgctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcatcttccatatcgtcaatcttatcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ358149_PreS2_P-B Feature FT:CDS GQ358149_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN001). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcatcttccatatcgtcaatcttatcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ358150_PreS2_P-B Feature FT:CDS GQ358150_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN009). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcatcttccatatcgtcaatcttatcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggcatacatctaa
>gnl|hbvcds|GQ358151_PreS2_P-B Feature FT:CDS GQ358151_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN011). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcatcttccatatcgtcaatcttatcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ358152_PreS2_P-B Feature FT:CDS GQ358152_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAN037). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcatcttccatatcgtcaatcttatcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ377519_PreS2_P-B Feature FT:CDS GQ377519_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J16). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccagcactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377525_PreS2_P-B Feature FT:CDS GQ377525_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J24). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377537_PreS2_P-B Feature FT:CDS GQ377537_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J48). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctctgggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377542_PreS2_P-B Feature FT:CDS GQ377542_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J61). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttacatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377547_PreS2_P-B Feature FT:CDS GQ377547_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J78). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377550_PreS2_P-B Feature FT:CDS GQ377550_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J81). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagaggaactccaccactttccaccaaactctgcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggacycctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgactgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaactaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377558_PreS2_P-B Feature FT:CDS GQ377558_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J89). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctatacaacatcttgaatccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377561_PreS2_P-B Feature FT:CDS GQ377561_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J96). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaacactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagctatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377566_PreS2_P-B Feature FT:CDS GQ377566_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J101). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377567_PreS2_P-B Feature FT:CDS GQ377567_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J102). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgttc
cgaacatggagaacatcwcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccaccaccggaccatgcaaaacctgcacagttcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caagatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377568_PreS2_P-B Feature FT:CDS GQ377568_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J103). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377569_PreS2_P-B Feature FT:CDS GQ377569_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J105). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377582_PreS2_P-B Feature FT:CDS GQ377582_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J131). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacttttcaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377587_PreS2_P-B Feature FT:CDS GQ377587_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J138). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377588_PreS2_P-B Feature FT:CDS GQ377588_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J141). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377606_PreS2_P-B Feature FT:CDS GQ377606_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J171). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagaggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaagacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377610_PreS2_P-B Feature FT:CDS GQ377610_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J177). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctygttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaactcccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ377612_PreS2_P-B Feature FT:CDS GQ377612_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J180). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgtatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377622_PreS2_P-B Feature FT:CDS GQ377622_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J207). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaacactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactactgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377625_PreS2_P-B Feature FT:CDS GQ377625_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J222). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377629_PreS2_P-B Feature FT:CDS GQ377629_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J234). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtwc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctygttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccgggccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377638_PreS2_P-B Feature FT:CDS GQ377638_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J250). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgagtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377639_PreS2_P-B Feature FT:CDS GQ377639_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J251). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaatagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377641_PreS2_P-B Feature FT:CDS GQ377641_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J254). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtwc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377643_PreS2_P-B Feature FT:CDS GQ377643_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J258). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtwc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ377644_PreS2_P-B Feature FT:CDS GQ377644_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate J294). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgttgtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagttggcctcagcccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggcatacacttaa
>gnl|hbvcds|GQ475340_PreS2_P-B Feature FT:CDS GQ475340_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KOR36HCC). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924603_PreS2_P-B Feature FT:CDS GQ924603_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaacacttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924605_PreS2_P-B Feature FT:CDS GQ924605_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924606_PreS2_P-B Feature FT:CDS GQ924606_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924607_PreS2_P-B Feature FT:CDS GQ924607_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M13). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcataggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924608_PreS2_P-B Feature FT:CDS GQ924608_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M15). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924610_PreS2_P-B Feature FT:CDS GQ924610_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M19). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924611_PreS2_P-B Feature FT:CDS GQ924611_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M28). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924617_PreS2_P-B Feature FT:CDS GQ924617_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M34). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccgccaagttccaccaaactcttcaagataccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaatagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagacttgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgacgcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924621_PreS2_P-B Feature FT:CDS GQ924621_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M39). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggacccctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcattggttcggaggg
ctttcccccactgtctggctttcacttatatggatgatatggttttgggggccaagtctgtacaacatcttgagtccctt
tatcccgctgtttccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924624_PreS2_P-B Feature FT:CDS GQ924624_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M42). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggatcatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ924625_PreS2_P-B Feature FT:CDS GQ924625_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M43). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccacgttccaccaaactcttcaagatccccgagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggcatacatctaa
>gnl|hbvcds|GQ924626_PreS2_P-B Feature FT:CDS GQ924626_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M47). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacactcgtgtgtcgtggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaacatgcagaacatgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924627_PreS2_P-B Feature FT:CDS GQ924627_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M48). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924628_PreS2_P-B Feature FT:CDS GQ924628_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M50). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccccgagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcactaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924630_PreS2_P-B Feature FT:CDS GQ924630_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M52). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcggtggaactccaccactttccaccaaactcttcaagatcccagagtcaggcacctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaaaacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggacacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtacaacatcttgaatccatt
tatgccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ924631_PreS2_P-B Feature FT:CDS GQ924631_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M53). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggcacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924632_PreS2_P-B Feature FT:CDS GQ924632_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M54). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagcgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924634_PreS2_P-B Feature FT:CDS GQ924634_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M57). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaatatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccgggccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924635_PreS2_P-B Feature FT:CDS GQ924635_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M67). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagagctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatattgtcaatcttgtcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccatt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924637_PreS2_P-B Feature FT:CDS GQ924637_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M69). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaagttccaccaaactcttcaagatcctcgagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctctcccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924638_PreS2_P-B Feature FT:CDS GQ924638_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M70). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttcctcctaactcttcaggatcatcgagtcagggatctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttcttttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924639_PreS2_P-B Feature FT:CDS GQ924639_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M71). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttcctccaaactcttcaggatcctcgagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgtctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttcttttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924640_PreS2_P-B Feature FT:CDS GQ924640_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M72). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924641_PreS2_P-B Feature FT:CDS GQ924641_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M76). Complete genome. [Hepadnaviridae] (length=846 residues).
gtgaagtggaactcccccacgttccaccaaactcttcaagatcctcgagtcagggctctgtaccttcctgctggtggctc
cagttcaggaactgtgatccctgttcagagcactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggtggggttttccttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgcgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcccctaattccaggatcatcgaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924644_PreS2_P-B Feature FT:CDS GQ924644_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M79). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924645_PreS2_P-B Feature FT:CDS GQ924645_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M82). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccacatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttcgagagggaacacccgtgtgtcctggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatctgcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatccaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GQ924646_PreS2_P-B Feature FT:CDS GQ924646_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M83). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaaccttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgacacctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaccatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924647_PreS2_P-B Feature FT:CDS GQ924647_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84). Complete genome. [Hepadnaviridae] (length=846 residues).
atgaagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgttggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttgttctggactgtcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|GQ924648_PreS2_P-B Feature FT:CDS GQ924648_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacttttcaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcagaaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924651_PreS2_P-B Feature FT:CDS GQ924651_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M88). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924653_PreS2_P-B Feature FT:CDS GQ924653_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M90). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaacactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924654_PreS2_P-B Feature FT:CDS GQ924654_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M91). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcgggatttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GQ924656_PreS2_P-B Feature FT:CDS GQ924656_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M93). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcagggacagcgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttctgtctttgggtatacatttaa
>gnl|hbvcds|GQ924660_PreS2_P-B Feature FT:CDS GQ924660_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M74). Partial genome (Contains: HBc, HBx, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaatactgcctctcccatatcgtcaatcttattgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctggccgtgtcccaggaggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactagtggtggccttctctcaattttcaagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgacttctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|GU332695_PreS2_P-B Feature FT:CDS GU332695_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMD74). Partial genome (Contains: HBc, HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaactttccaccaaactcttcaagatcccagagtcagggccctgtaccttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatctgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaacatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU357842_PreS2_P-B Feature FT:CDS GU357842_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C4371). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatattatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccaaagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaaactc
tacgtttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttctgttgtctttgggtatacagttaa
>gnl|hbvcds|GU434372_PreS2_P-B Feature FT:CDS GU434372_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 011-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtctgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatctggagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU434373_PreS2_P-B Feature FT:CDS GU434373_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 209-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU451682_PreS2_P-B Feature FT:CDS GU451682_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate pLL-EGFP). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgcac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815548_PreS2_P-B Feature FT:CDS GU815548_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815549_PreS2_P-B Feature FT:CDS GU815549_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggcttccagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815550_PreS2_P-B Feature FT:CDS GU815550_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttctcgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815551_PreS2_P-B Feature FT:CDS GU815551_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815552_PreS2_P-B Feature FT:CDS GU815552_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815553_PreS2_P-B Feature FT:CDS GU815553_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815554_PreS2_P-B Feature FT:CDS GU815554_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgctatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gttcgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815555_PreS2_P-B Feature FT:CDS GU815555_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815556_PreS2_P-B Feature FT:CDS GU815556_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815557_PreS2_P-B Feature FT:CDS GU815557_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815558_PreS2_P-B Feature FT:CDS GU815558_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815559_PreS2_P-B Feature FT:CDS GU815559_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A1-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815560_PreS2_P-B Feature FT:CDS GU815560_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccaatttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815561_PreS2_P-B Feature FT:CDS GU815561_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815562_PreS2_P-B Feature FT:CDS GU815562_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815563_PreS2_P-B Feature FT:CDS GU815563_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815564_PreS2_P-B Feature FT:CDS GU815564_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815565_PreS2_P-B Feature FT:CDS GU815565_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggccc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815566_PreS2_P-B Feature FT:CDS GU815566_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815567_PreS2_P-B Feature FT:CDS GU815567_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggccc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815568_PreS2_P-B Feature FT:CDS GU815568_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815569_PreS2_P-B Feature FT:CDS GU815569_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815570_PreS2_P-B Feature FT:CDS GU815570_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815571_PreS2_P-B Feature FT:CDS GU815571_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815572_PreS2_P-B Feature FT:CDS GU815572_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-1). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815573_PreS2_P-B Feature FT:CDS GU815573_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-2). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctagatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccagtatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaagaaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815574_PreS2_P-B Feature FT:CDS GU815574_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcgtggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctc
catgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815575_PreS2_P-B Feature FT:CDS GU815575_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815576_PreS2_P-B Feature FT:CDS GU815576_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggccc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815577_PreS2_P-B Feature FT:CDS GU815577_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcgtggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaagacctgcacaactcctgctcaaggaacctc
catgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815578_PreS2_P-B Feature FT:CDS GU815578_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactctaccactttccatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcgtggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcctcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815579_PreS2_P-B Feature FT:CDS GU815579_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815581_PreS2_P-B Feature FT:CDS GU815581_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagattccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815583_PreS2_P-B Feature FT:CDS GU815583_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815584_PreS2_P-B Feature FT:CDS GU815584_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacacttaa
>gnl|hbvcds|GU815585_PreS2_P-B Feature FT:CDS GU815585_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815586_PreS2_P-B Feature FT:CDS GU815586_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815587_PreS2_P-B Feature FT:CDS GU815587_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggcggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815588_PreS2_P-B Feature FT:CDS GU815588_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815589_PreS2_P-B Feature FT:CDS GU815589_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-8). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815590_PreS2_P-B Feature FT:CDS GU815590_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815591_PreS2_P-B Feature FT:CDS GU815591_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815593_PreS2_P-B Feature FT:CDS GU815593_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815594_PreS2_P-B Feature FT:CDS GU815594_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815595_PreS2_P-B Feature FT:CDS GU815595_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815596_PreS2_P-B Feature FT:CDS GU815596_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgtctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815597_PreS2_P-B Feature FT:CDS GU815597_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815598_PreS2_P-B Feature FT:CDS GU815598_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815599_PreS2_P-B Feature FT:CDS GU815599_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815600_PreS2_P-B Feature FT:CDS GU815600_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-7). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815601_PreS2_P-B Feature FT:CDS GU815601_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815602_PreS2_P-B Feature FT:CDS GU815602_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B2-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggttcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815603_PreS2_P-B Feature FT:CDS GU815603_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815604_PreS2_P-B Feature FT:CDS GU815604_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815605_PreS2_P-B Feature FT:CDS GU815605_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815606_PreS2_P-B Feature FT:CDS GU815606_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815607_PreS2_P-B Feature FT:CDS GU815607_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaacacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815608_PreS2_P-B Feature FT:CDS GU815608_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggtggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815609_PreS2_P-B Feature FT:CDS GU815609_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815610_PreS2_P-B Feature FT:CDS GU815610_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaagactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815611_PreS2_P-B Feature FT:CDS GU815611_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-6). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctagatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815612_PreS2_P-B Feature FT:CDS GU815612_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815613_PreS2_P-B Feature FT:CDS GU815613_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815614_PreS2_P-B Feature FT:CDS GU815614_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B3-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815616_PreS2_P-B Feature FT:CDS GU815616_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-11). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgtagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagga
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815617_PreS2_P-B Feature FT:CDS GU815617_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccacaaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtccgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815618_PreS2_P-B Feature FT:CDS GU815618_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccatgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815619_PreS2_P-B Feature FT:CDS GU815619_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcaggaccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815620_PreS2_P-B Feature FT:CDS GU815620_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgcccgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815621_PreS2_P-B Feature FT:CDS GU815621_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgcccgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815622_PreS2_P-B Feature FT:CDS GU815622_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccacaaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtccgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815623_PreS2_P-B Feature FT:CDS GU815623_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815624_PreS2_P-B Feature FT:CDS GU815624_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-7). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815625_PreS2_P-B Feature FT:CDS GU815625_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtcagtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815626_PreS2_P-B Feature FT:CDS GU815626_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctttgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815627_PreS2_P-B Feature FT:CDS GU815627_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815628_PreS2_P-B Feature FT:CDS GU815628_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815629_PreS2_P-B Feature FT:CDS GU815629_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815630_PreS2_P-B Feature FT:CDS GU815630_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815631_PreS2_P-B Feature FT:CDS GU815631_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815632_PreS2_P-B Feature FT:CDS GU815632_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815633_PreS2_P-B Feature FT:CDS GU815633_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C2-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctg
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815634_PreS2_P-B Feature FT:CDS GU815634_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-10). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagcgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctgactttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815635_PreS2_P-B Feature FT:CDS GU815635_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaaaacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815636_PreS2_P-B Feature FT:CDS GU815636_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815637_PreS2_P-B Feature FT:CDS GU815637_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815638_PreS2_P-B Feature FT:CDS GU815638_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagaccggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815639_PreS2_P-B Feature FT:CDS GU815639_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctagaacccctgctcgtgttacaggcggggcttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815640_PreS2_P-B Feature FT:CDS GU815640_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815641_PreS2_P-B Feature FT:CDS GU815641_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815642_PreS2_P-B Feature FT:CDS GU815642_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccctactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815643_PreS2_P-B Feature FT:CDS GU815643_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815644_PreS2_P-B Feature FT:CDS GU815644_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactgtcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815645_PreS2_P-B Feature FT:CDS GU815645_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C3-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcacggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcgaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815646_PreS2_P-B Feature FT:CDS GU815646_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1.D1.5-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815647_PreS2_P-B Feature FT:CDS GU815647_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2.D1.5-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815648_PreS2_P-B Feature FT:CDS GU815648_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3.D1.5-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815649_PreS2_P-B Feature FT:CDS GU815649_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4.D1.5-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815650_PreS2_P-B Feature FT:CDS GU815650_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 5.D1.5-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacgcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815651_PreS2_P-B Feature FT:CDS GU815651_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6.D1.5-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtctttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815652_PreS2_P-B Feature FT:CDS GU815652_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 7.D1.5-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815653_PreS2_P-B Feature FT:CDS GU815653_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 8.D1.5-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815654_PreS2_P-B Feature FT:CDS GU815654_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 9.D1.5-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815656_PreS2_P-B Feature FT:CDS GU815656_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11.D1.5-11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagcggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815657_PreS2_P-B Feature FT:CDS GU815657_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12.D1.5-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcctcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ccttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815658_PreS2_P-B Feature FT:CDS GU815658_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttcccttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815659_PreS2_P-B Feature FT:CDS GU815659_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815660_PreS2_P-B Feature FT:CDS GU815660_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815661_PreS2_P-B Feature FT:CDS GU815661_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815662_PreS2_P-B Feature FT:CDS GU815662_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815663_PreS2_P-B Feature FT:CDS GU815663_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctactgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815664_PreS2_P-B Feature FT:CDS GU815664_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815665_PreS2_P-B Feature FT:CDS GU815665_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815666_PreS2_P-B Feature FT:CDS GU815666_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D2-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815667_PreS2_P-B Feature FT:CDS GU815667_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815668_PreS2_P-B Feature FT:CDS GU815668_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815669_PreS2_P-B Feature FT:CDS GU815669_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815670_PreS2_P-B Feature FT:CDS GU815670_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttgattcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815672_PreS2_P-B Feature FT:CDS GU815672_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815673_PreS2_P-B Feature FT:CDS GU815673_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815674_PreS2_P-B Feature FT:CDS GU815674_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815675_PreS2_P-B Feature FT:CDS GU815675_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815676_PreS2_P-B Feature FT:CDS GU815676_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815677_PreS2_P-B Feature FT:CDS GU815677_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815678_PreS2_P-B Feature FT:CDS GU815678_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate D3-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggccttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815679_PreS2_P-B Feature FT:CDS GU815679_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815680_PreS2_P-B Feature FT:CDS GU815680_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815681_PreS2_P-B Feature FT:CDS GU815681_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacacttaa
>gnl|hbvcds|GU815683_PreS2_P-B Feature FT:CDS GU815683_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815684_PreS2_P-B Feature FT:CDS GU815684_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815685_PreS2_P-B Feature FT:CDS GU815685_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815686_PreS2_P-B Feature FT:CDS GU815686_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815687_PreS2_P-B Feature FT:CDS GU815687_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815688_PreS2_P-B Feature FT:CDS GU815688_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815689_PreS2_P-B Feature FT:CDS GU815689_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E1-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815691_PreS2_P-B Feature FT:CDS GU815691_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815692_PreS2_P-B Feature FT:CDS GU815692_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815693_PreS2_P-B Feature FT:CDS GU815693_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815694_PreS2_P-B Feature FT:CDS GU815694_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815695_PreS2_P-B Feature FT:CDS GU815695_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815696_PreS2_P-B Feature FT:CDS GU815696_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815697_PreS2_P-B Feature FT:CDS GU815697_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815698_PreS2_P-B Feature FT:CDS GU815698_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E2-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815699_PreS2_P-B Feature FT:CDS GU815699_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttatctttgggtatccatttaa
>gnl|hbvcds|GU815700_PreS2_P-B Feature FT:CDS GU815700_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815701_PreS2_P-B Feature FT:CDS GU815701_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttatctttgggtatccatttaa
>gnl|hbvcds|GU815702_PreS2_P-B Feature FT:CDS GU815702_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttatctttgggtatccatttaa
>gnl|hbvcds|GU815703_PreS2_P-B Feature FT:CDS GU815703_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815704_PreS2_P-B Feature FT:CDS GU815704_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815705_PreS2_P-B Feature FT:CDS GU815705_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815706_PreS2_P-B Feature FT:CDS GU815706_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815707_PreS2_P-B Feature FT:CDS GU815707_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815708_PreS2_P-B Feature FT:CDS GU815708_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815709_PreS2_P-B Feature FT:CDS GU815709_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaatctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttatctttgggtatccatttaa
>gnl|hbvcds|GU815710_PreS2_P-B Feature FT:CDS GU815710_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate E3-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttaccatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttatctttgggtatccatttaa
>gnl|hbvcds|GU815711_PreS2_P-B Feature FT:CDS GU815711_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcacagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgtcgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815712_PreS2_P-B Feature FT:CDS GU815712_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815713_PreS2_P-B Feature FT:CDS GU815713_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgttatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgctatttgttcagtggttcgtaggg
ctttcccccactgtccggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815715_PreS2_P-B Feature FT:CDS GU815715_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctagggcccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815716_PreS2_P-B Feature FT:CDS GU815716_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815717_PreS2_P-B Feature FT:CDS GU815717_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815718_PreS2_P-B Feature FT:CDS GU815718_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggaccatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815719_PreS2_P-B Feature FT:CDS GU815719_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815720_PreS2_P-B Feature FT:CDS GU815720_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815721_PreS2_P-B Feature FT:CDS GU815721_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815722_PreS2_P-B Feature FT:CDS GU815722_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F1-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggctcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgctaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815723_PreS2_P-B Feature FT:CDS GU815723_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccagaatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815724_PreS2_P-B Feature FT:CDS GU815724_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815725_PreS2_P-B Feature FT:CDS GU815725_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815726_PreS2_P-B Feature FT:CDS GU815726_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815727_PreS2_P-B Feature FT:CDS GU815727_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggaatgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815728_PreS2_P-B Feature FT:CDS GU815728_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcgtcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagcctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815729_PreS2_P-B Feature FT:CDS GU815729_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggtacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815730_PreS2_P-B Feature FT:CDS GU815730_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815731_PreS2_P-B Feature FT:CDS GU815731_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815732_PreS2_P-B Feature FT:CDS GU815732_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815733_PreS2_P-B Feature FT:CDS GU815733_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgtctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815734_PreS2_P-B Feature FT:CDS GU815734_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F2-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatctcatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815735_PreS2_P-B Feature FT:CDS GU815735_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgacttctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagttcctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815736_PreS2_P-B Feature FT:CDS GU815736_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815737_PreS2_P-B Feature FT:CDS GU815737_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815738_PreS2_P-B Feature FT:CDS GU815738_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815739_PreS2_P-B Feature FT:CDS GU815739_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815740_PreS2_P-B Feature FT:CDS GU815740_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815741_PreS2_P-B Feature FT:CDS GU815741_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-4). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttaggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815742_PreS2_P-B Feature FT:CDS GU815742_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815743_PreS2_P-B Feature FT:CDS GU815743_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggccttagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815744_PreS2_P-B Feature FT:CDS GU815744_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815745_PreS2_P-B Feature FT:CDS GU815745_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815746_PreS2_P-B Feature FT:CDS GU815746_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F3-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaacactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcacggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815747_PreS2_P-B Feature FT:CDS GU815747_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctccaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815748_PreS2_P-B Feature FT:CDS GU815748_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctccaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815749_PreS2_P-B Feature FT:CDS GU815749_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815750_PreS2_P-B Feature FT:CDS GU815750_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-14). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815751_PreS2_P-B Feature FT:CDS GU815751_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815752_PreS2_P-B Feature FT:CDS GU815752_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tgtgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815753_PreS2_P-B Feature FT:CDS GU815753_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815754_PreS2_P-B Feature FT:CDS GU815754_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815755_PreS2_P-B Feature FT:CDS GU815755_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815756_PreS2_P-B Feature FT:CDS GU815756_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815757_PreS2_P-B Feature FT:CDS GU815757_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815759_PreS2_P-B Feature FT:CDS GU815759_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G1-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815760_PreS2_P-B Feature FT:CDS GU815760_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccttcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815761_PreS2_P-B Feature FT:CDS GU815761_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815762_PreS2_P-B Feature FT:CDS GU815762_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815764_PreS2_P-B Feature FT:CDS GU815764_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815765_PreS2_P-B Feature FT:CDS GU815765_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815766_PreS2_P-B Feature FT:CDS GU815766_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815767_PreS2_P-B Feature FT:CDS GU815767_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-5). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815768_PreS2_P-B Feature FT:CDS GU815768_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815769_PreS2_P-B Feature FT:CDS GU815769_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815770_PreS2_P-B Feature FT:CDS GU815770_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccccgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaagcctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815771_PreS2_P-B Feature FT:CDS GU815771_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G2-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815772_PreS2_P-B Feature FT:CDS GU815772_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-10). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggacacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggtctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815773_PreS2_P-B Feature FT:CDS GU815773_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-11). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggccc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggacacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttctcttgtctttgggtatacatttaa
>gnl|hbvcds|GU815774_PreS2_P-B Feature FT:CDS GU815774_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-12). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggacacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaatctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815775_PreS2_P-B Feature FT:CDS GU815775_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggacacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815776_PreS2_P-B Feature FT:CDS GU815776_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-21). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggccc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggacacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttctcttgtctttgggtatacatttaa
>gnl|hbvcds|GU815777_PreS2_P-B Feature FT:CDS GU815777_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-2). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggacacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815778_PreS2_P-B Feature FT:CDS GU815778_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815779_PreS2_P-B Feature FT:CDS GU815779_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-4). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaaaacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttctttcgtctttgggtatacatttaa
>gnl|hbvcds|GU815780_PreS2_P-B Feature FT:CDS GU815780_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-6). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815781_PreS2_P-B Feature FT:CDS GU815781_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-7). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggacacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815782_PreS2_P-B Feature FT:CDS GU815782_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-8). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggacacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|GU815783_PreS2_P-B Feature FT:CDS GU815783_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G3-9). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggacacctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccaatcactcaccaaccagttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011466_PreS2_P-B Feature FT:CDS HM011466_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccackttccaccaaactcttcargatcccagagtcagggccctgtactttcctgctggtggctc
cagttcagraacagtgagccctgctcagaatactgtctcwgccayatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatccggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggagaaactcgtgtgtcctggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaycaaggtatgttgccc
gtttgtcctctaattccaggatcatcgacaacaagcacgggaccatgcaagacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatctggttatgggggccaaatctgtacaacaycttgartccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011467_PreS2_P-B Feature FT:CDS HM011467_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaatactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatmttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcarggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggytttcg
caaaatwcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tataccgctgtttccaattttcttttgtctttgggyatacatttaa
>gnl|hbvcds|HM011469_PreS2_P-B Feature FT:CDS HM011469_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtrc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggamayacccgtgtgtcwtggccaaaa
ttcgcagtcccaaayctccagtcactcaccaacttgttgtcctccracttgtcctggttatcgctggatgtrtctgcggc
rttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtgcaacatctygagkccatt
tatrccgctgtttccaattttctkttgtctttgggtatacatttaa
>gnl|hbvcds|HM011470_PreS2_P-B Feature FT:CDS HM011470_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgcacgttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcgtggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaaactc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttyagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011471_PreS2_P-B Feature FT:CDS HM011471_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgaagtggaactccaccacttttcaccaaactctccaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcwgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgtggacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
attttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcaccactcctgctcaaggcacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtgcaacatcttgagtccctt
tatgccgctgttayyaattttcttttgtctttgggcatacatttaa
>gnl|hbvcds|HM011473_PreS2_P-B Feature FT:CDS HM011473_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaacwccaccackttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcarttttctaggggaaacacccgtgtgtcytggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacmaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011474_PreS2_P-B Feature FT:CDS HM011474_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atacggtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcgtggccaaaa
ttcgcagtcccaaacctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011475_PreS2_P-B Feature FT:CDS HM011475_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtacttycctgctggtggctc
cagttcagraacagtgagccctgctcagaatactgtctcdgccatatcgtcaatcttrtcgaagactggggaccctgtac
cgaacatggagaacatcrcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggraacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011476_PreS2_P-B Feature FT:CDS HM011476_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactattcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagagtactgtctctcccacatcgtcaatcttaccgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagagggaacacccgtgtgtcgtggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctkcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacytgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaaytgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011477_PreS2_P-B Feature FT:CDS HM011477_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctcggccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcctggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatmttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
taaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtwttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttctkttgtctttgggtatacatttaa
>gnl|hbvcds|HM011478_PreS2_P-B Feature FT:CDS HM011478_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacyttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcarttttctaggggwaayacccgkgtgtcytggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctscatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcacsggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcrtcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacaycttgartccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011480_PreS2_P-B Feature FT:CDS HM011480_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagnctagactcgtggtggacttctctcagttttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatctkcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011482_PreS2_P-B Feature FT:CDS HM011482_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatckcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccratttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttyagttatatggatgatgtggttttgggggccaartctgtacamcaycttgartccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011483_PreS2_P-B Feature FT:CDS HM011483_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgccctggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttggggrccaagtctgtacaacatcttgagtccstt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011484_PreS2_P-B Feature FT:CDS HM011484_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
tgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaayc
ctcacaataccacagartctagactsgtggtggacttctctcagttttctaggggtaccacccgtgtgtcctggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011487_PreS2_P-B Feature FT:CDS HM011487_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtccgggctctgtactttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaacctcatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaagacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgttgtggacttctctcagttttctaggggggacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactaccaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgccgaacctgcacgactcctgctcrmggaaactc
tacgtttccctcatgttgctgtacaaaacctacggacgcaaactgcacctgtattcccatcccaycatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagygccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttctgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttga
>gnl|hbvcds|HM011490_PreS2_P-B Feature FT:CDS HM011490_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
rtgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtatcttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcgtggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccattgtctggctttcagttatatggatgatgtggttttgggggccaartctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011492_PreS2_P-B Feature FT:CDS HM011492_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgt
cgaacatggagaacatcacatcaggactcctaagacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgttgtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011494_PreS2_P-B Feature FT:CDS HM011494_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaacycttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgamgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttttyctygttgayaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcarttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaracctgcacarctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011496_PreS2_P-B Feature FT:CDS HM011496_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagcaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctcmaatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtatgtcctctaatyccaggatcatcaaccaccagcacsggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagkccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|HM011499_PreS2_P-B Feature FT:CDS HM011499_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atrcrgtggaactccmccacgttccaccatactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
tgarcatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctygttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggraacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggytcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttktgggggccaagtctgtgcagcatcttgagtccstw
tatgycgctgtttcccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM011503_PreS2_P-B Feature FT:CDS HM011503_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcrgtggaactccaccactttccaccaaactcttcaagaycccagagtcagggccctgtacwttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttrtcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgygttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaacraccagcacsggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacamcatcttgagkccctt
tataccgctgttaccaattttcttktgtctttgggtatacatttaa
>gnl|hbvcds|HM011504_PreS2_P-B Feature FT:CDS HM011504_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacmactttccaccaaactcttcaagatcccagagtcagggcyctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatctyatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgytggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctgattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
yaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagkccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HM153811_PreS2_P-B Feature FT:CDS HM153811_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 712005001256). Non-functional genomic sequence. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcaggacactgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatattgatgatatggttctgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ700546_PreS2_P-B Feature FT:CDS HQ700546_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BC_NC_AM263). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaatttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaaccgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcscatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctcaaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ700548_PreS2_P-B Feature FT:CDS HQ700548_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I_WA1031A). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccavgttccaccaaactcttcaagattccagagtcagggctctgtattttcctgctggtggctc
cagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttctgctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggrgtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttacatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|HQ700549_PreS2_P-B Feature FT:CDS HQ700549_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate I_WA1098A). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtgc
cgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgahttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctctgggtatacatttaa
>gnl|hbvcds|JF412801_PreS2_P-B Feature FT:CDS JF412801_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBVJSTZ3). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JF436921_PreS2_P-B Feature FT:CDS JF436921_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate SZ7). Complete genome. [Hepadnaviridae] (length=846 residues).
atacagtggaactacaccactttccaccaaactcttcaagatcccaaagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctccgaatactgtctctgcaatatcgtcaatcttatcgacgactggggaccctgtac
cgaacatggcgaccaacttatcagaactcctaaaactcctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgccgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgcagctgttactaattttcttttgtctttgggtatccatttga
>gnl|hbvcds|JF899335_PreS2_P-B Feature FT:CDS JF899335_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10B1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN406371_PreS2_P-B Feature FT:CDS JN406371_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WHUB1). Complete genome. [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604119_PreS2_P-B Feature FT:CDS JN604119_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 476-6420-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggraacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604122_PreS2_P-B Feature FT:CDS JN604122_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 476-8130-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604123_PreS2_P-B Feature FT:CDS JN604123_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 476-8616-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcctcgagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgaacactgttcacaacactgcctcttccatatcgtcaatcttatcgacgactggggaccctgtgc
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgacttgtcctggttatcgctggatgtatctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgcttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgcaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604124_PreS2_P-B Feature FT:CDS JN604124_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 476-8619-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccgctttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagctcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604125_PreS2_P-B Feature FT:CDS JN604125_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 477-1766-8). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604127_PreS2_P-B Feature FT:CDS JN604127_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 477-2999-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgwgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgartccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604130_PreS2_P-B Feature FT:CDS JN604130_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 477-7793-5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaacaccaccacgtttcatcaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggcggacatcacatcaggactcctasgacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcggggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcgaggtatgttgccc
gtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaactcctgctcgaagcacctc
tacgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgacgtggtattgggggccaagtctgtacaacaccttgagtccctt
aatgccgctgttactacttttcttttgtctttgggtatacacttaa
>gnl|hbvcds|JN604132_PreS2_P-B Feature FT:CDS JN604132_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 477-9698-5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctcggccatatcgtcaatcttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaactcccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctcmaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcagaacatgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagyccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacaccttgagtccatt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604134_PreS2_P-B Feature FT:CDS JN604134_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 478-1993-5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttytgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604138_PreS2_P-B Feature FT:CDS JN604138_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 478-6805-7). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ccaacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggtattgggggccagatctgcacaacatcttgagtccctt
tatgccgctgttaccaattttcttttatctttgggtatacatttga
>gnl|hbvcds|JN604141_PreS2_P-B Feature FT:CDS JN604141_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 478-9028-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtraaccctgttcagaacactgcctcttccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcctgggctttcg
caaaatacctatgggagtgggcctcagcccgtttctcttggctcagtttactagtgccatctgttcaatggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatctaa
>gnl|hbvcds|JN604143_PreS2_P-B Feature FT:CDS JN604143_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 479-0606-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtaagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcarggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacatgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccrtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tataccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604146_PreS2_P-B Feature FT:CDS JN604146_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 479-2316-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaactttccaccatactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604149_PreS2_P-B Feature FT:CDS JN604149_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 479-5331-1). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaacagcaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctgtac
cgaacatggacaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacatctcctgctcaaggcacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604154_PreS2_P-B Feature FT:CDS JN604154_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 480-0167-2). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604187_PreS2_P-B Feature FT:CDS JN604187_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 479-1713-5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcaatggaactccaccactttccaccaagctcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgggttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttatgtctttgggtatacatttaa
>gnl|hbvcds|JN604212_PreS2_P-B Feature FT:CDS JN604212_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 476-7995-9). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcgtggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccratttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaaacacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtttggcttttagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttacccattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604213_PreS2_P-B Feature FT:CDS JN604213_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 476-9306-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtacttccctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcarttttctaggggacacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604219_PreS2_P-B Feature FT:CDS JN604219_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 477-2927-5). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atrcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagactactgcctttgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtatgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaaactc
ttcgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcartttactagygccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtgcaacatcttgagtccctt
tatgccgctattaccaattttctgttgtctttgggtatacatttaa
>gnl|hbvcds|JN604221_PreS2_P-B Feature FT:CDS JN604221_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 477-4136-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
rtgcagtggaactccaccactktccatcaaactcttcaagatcccaragtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctygttgacaaaaatc
ctcayaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcraccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604223_PreS2_P-B Feature FT:CDS JN604223_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 477-4979-4). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccaccaaactcttcaagatccaagagtcagggctctgtactttcctgctggtggctc
cagttcaggaactgtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604224_PreS2_P-B Feature FT:CDS JN604224_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 477-5048-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcayaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaa
ttctcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttctatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggcacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagga
ctttcccccactgtctggctttcagttatatggatgatgtggtattggggtccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604234_PreS2_P-B Feature FT:CDS JN604234_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 478-0688-3). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccaccttccatcaaactcttcaagatcccagagtcagagctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaattctgcctctgccatatcgtcaaccttctcaaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttcyagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactactgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctattaccaattttctttkstctttgggtatacrtgtaa
>gnl|hbvcds|JN604244_PreS2_P-B Feature FT:CDS JN604244_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 479-0396-0). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccacaactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctccgaatactgcctctgccatatcgtcaaccttctcgacgactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctacttccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaa
>gnl|hbvcds|JN604253_PreS2_P-B Feature FT:CDS JN604253_PreS2_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 479-5640-6). Partial genome (Contains: HBe, HBc, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=846 residues).
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtactttcctgctggtggctc
cagttcaggaacagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtac
cgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcg
caaaatacctatgggagtgggcc