HBVdb

Dataset for nucleotide sequence P of genotype B

[Download (right click)] [Alignment] [Repertoires]

2237 sequence(s)

>gnl|hbvcds|AB010289_P_P-B Feature FT:CDS AB010289_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtataccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggatattattgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaaataataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgctcacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacttggccacaggatcatattgtacaaa
aaatcaaactatgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcatt
tactttctcgccaacttataaggcctttctaagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB010290_P_P-B Feature FT:CDS AB010290_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcagactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacagaagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccaggcgagacattatttgcatactctttggaaggcgggcatcttatataaaaga
gagtcaacacatagcgcttcattttgcgggtcaccttattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccccacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccgtgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttctgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttgtgtctctgggtatacatgtaaaccctcacaaaacaaa
aagatggggatactcccttaatttcatgggatatgtaattgggagttggggcacattgccacaggaacatattagacaaa
aaatcaaactatgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
gggtttgcggccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatatcagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtcaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccg
cttctccgtctaccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB010291_P_P-B Feature FT:CDS AB010291_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcagactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccaggcgagacattatttgcatactctttggaaggcgggcatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccttattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccgtgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttctgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttgtgtctctgggtatacatgtaaaccctcacaaaacaaa
aagatggggatactcccttaatttcatgggatatgtaattgggagttggggcacattgccacaggaacatattagacaaa
aaatcaaactatgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
gggtttgcggccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatatcagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtcaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtagtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccg
cttctccgtctaccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB010292_P_P-B Feature FT:CDS AB010292_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Yamagata-4). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcagactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatattttcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttgcatactctttggaaggcgggcatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccttattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaagggcaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatacagtggaacgccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatctcatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtactgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctctgggtatacatttaaaccctcacaaaacaaa
aagatggggatactcccttaatttcatgggatatgtaattgggagttggggcacattgccacaggaacatattatacaaa
aaatcaaactatgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
gggtttgcggccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatatcagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtcaacagtatctgaccctttaccccgttgctcggcaacgctctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccg
cttctccgtctcccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB014366_P_P-B Feature FT:CDS AB014366_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 07D07HCC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactc
ataaggtggggaactttacggggctttattcttctacagtacctgtctttaatcccgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacaataaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaaagttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgaggcattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtctacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcggaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcagatcatgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaatagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtatctgcggcgttttatcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactatgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatccaagcgaaacaggcttt
tactttctcgccaacttacaaggcctttctgagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB031267_P_P-B Feature FT:CDS AB031267_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV VietF-6). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
acaaggtgggaaactttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaagatattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaatcaggagact
aaaattaattatgcctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatc
ccgagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatccactgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcactcctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcaatggaactccgccacttttcatcaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgcctctcccatatcatcaaccttctcga
cgactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgtttcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaatcgggagttggggttccttgccacaagaacatattgtacaaa
aaatcaaattatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggattcgctgccccttttacccaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctgagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tatgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattctgtcgtgctgtcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccg
ctcctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB033554_P_P-B Feature FT:CDS AB033554_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate RTB299). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctcaatggcaaactccttcatttcct
gacattcatttgcaggaggacatcattgataagtgtaaacaatttgtgggaccccttacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcccaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgaaaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccaacagctcctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaaga
gacactcatcctcaggcaatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
cgactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacaggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggcatacatttaaaccctcagaaaacaaa
aagatggggctactcccttaacttcatggggtatgtaattggaagttgggggaccttaccccaagaacatattgtgttga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttttcgccaacgtataaggcctttctccacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggac
tgacaattctgtcgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB033555_P_P-B Feature FT:CDS AB033555_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PAD744). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccccgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggttcctagctttaaccctcaatggcaaactccttcctttcct
gacattcatttgcaggaggacatcattaatagatgtaaccaatttgtgggaccccttacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcccaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgacaaggcatggggacaaatctttccgtccccaatccgctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccaacagctcctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaaga
gacactcatcctcaggcaatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcagaaaacaaa
aagatggggctactcccttaacttcatggggtatgtaattggaagttggggcaccttaccccaagaacatattgtgttga
aaatcaaacaatgttttagaaaacttcctgtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttttcgccaacatataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaccttatcgggac
tgacaattctgtcgtcctttcccgcaaatatacatcgtttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgccct
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB048705_P_P-B Feature FT:CDS AB048705_P_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=2511 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctactgtacctgtctttaatcctgattggcaaactcccaagtttcct
gatattcatttaaaggaggacattatcaataggtgtcaaaattatgtaggccctcttacagtcaatgaaaaaagaagatt
aaaattaattatgcctgctaggttctatcctactcttaccaaatatttgcccctagataaaggcataaaaccttattatc
ctgaacatgcagttaatcattacttcaaaactaggcattatttacatactctgtggaaggctggcattctatataagaga
gaaactacacgcagcgcctgattttgtgggtcaccatattcttgggaacaagagctacagccttcggaaaggcatgggga
cgaatctttctgttcccaatcctctgggattctttcccgatcaccagttggaccctgcgttcggagccaactcaaacaat
ccagattgggacttcaaccccaacaaggatcactggccagaggcaaatcaggtaggagcgggagcattcgggccagggtt
caccccaccacacggaggtcttttggggtggagcccgcaggcccagggcatattgacaacagtgccagcagctcctcctc
ctgcatccaccaatcggcagtcaggaagacaacccactcccatctcaccacctctaagagacactcaccctcaggccatg
cagtggaactccacagcattccaccaagctctgcaggatcccagagtaaggggtctgtattttcctgctggtggctccag
ttccggaacagtaaaccctgttccgaatactgtctctcacatctcatcaatcttcacgaagactggggaccctgcatcga
acatggagagcacaacatcaggattcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaagaatcctc
acaatacctcagagtctagactcgtggtggacttctctcaattttctagggggagctcccgcgtgtcttggccaaaattc
gcagtcccaaacctccaatcactcaccaacctcttgtcctccaacctgtcctggctatcgttggatgtgtctgcggcgtt
ttatcatcttcctcttcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctacttccaggatcaacgaccaccagcacgggaccttgcagaacctgcacgatcactgctcaaggaacctctat
gtttccctcatgttgctgtacaaaaccttcggacggaaattgcacctgtattcccatcccatcatcttgggctttcgcaa
aattcctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccatttgttcagtggttcgcagggctt
tcccccactgtttggctttcagttatatggatgatctggtattgggggccaagtctgtacaacatcttgagtcccttttt
accgctgttaccaattttcttttgtctttgggtatacatttaaatccccacaaaacaaaaagatggggttattccctcaa
ctttatgggatatgtgatcgggagttggggaagcttaccgcaagagcatattgtacacaaactcaaacactgttttagaa
aacttcctgttaataggcccattgattggaaagtatgccaacgaattgtgggtttattgggctttgctgccccttttaca
caatgtggttatcctgccttaatgcctttgtatgcctgcatacaagccaagcaagctttcactttctcgccaacttataa
ggcctttctgtgtaaacaatatctgaacctttaccccgttgcccggcaacgggctggtctctgccaagtgtttgctgacg
caacccccactggttggggcttggccataggccatcagcgcgtgcggggaacctttgtggctcctctgccgatccatact
gcggaactcctagcagcttgtttcgctcgcagccggtctggagcgaacattctcgggaccgacaactctgttgttctctc
tcggaaatacacctcctttccatggctgctaggctgtgctgccaactggatcctacgcgggacgtcctttgtctacgtcc
cgtcggcgctgaatcccgcggacgacccgtctcggggccgcttggggatctaccgtccccttctgcgtctaccgttccga
ccatcgacggggcgcacctctctttacgcggactccccgtctgcgccttctcatctgccggaccgtgtgcacttcgcttc
acctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073821_P_P-B Feature FT:CDS AB073821_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi20). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaygaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtatcccttggacwc
ayaaggtgggaaactttactgggctttattcttctackgtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccacatgggggattgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgcaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgygtgtcytggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaa
aagatggggatattcccttaactttatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
agataaaaatgtgttttcggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgcagcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttt
tactttctcgccaacttacaagacctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcccg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtatcgaccawccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073822_P_P-B Feature FT:CDS AB073822_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi32). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgtcgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccctattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgcagcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctacgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccaaccacggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073823_P_P-B Feature FT:CDS AB073823_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi35). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttctatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatcttgctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgcttggaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggccwactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccaaagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagagcatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggagcacc
cgtgtgtcctggccaaaatttgcagtccccaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatccctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctcttgttccgaccgaccacggggcgaacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB073824_P_P-B Feature FT:CDS AB073824_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi4). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggacac
ataaggtgggaaactttacgggactttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaacaggagact
taaattaattatgcctgctaggttttatccaaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacaccctttggaaggcgggcatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctaccgcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttcccggatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccacatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
cttccctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcgtcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatttggttttgggggccaagtctgta
caacaccttgaaaccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttcgg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073825_P_P-B Feature FT:CDS AB073825_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi51). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactcctgcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggaggct
aaaattaattatgcctgctaggttttatcccaatgttacaaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagaccacacatagcgcctcattctgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgcaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcactcctccccatggaggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcaactcctcctcctgcctccaccaatcggcngtcaggaaggcagcctacgcccatatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaagctcttcaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
gcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcgtcctgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccargtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaa
aaatcaaaacatgttttaggaaacttcctgtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggccttcctccgtaaacagtatctgaacctttaccccgttgctcggcaacggactggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgttccgaccatccacggggcgcacctctctttacgaggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073826_P_P-B Feature FT:CDS AB073826_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi89). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
caaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaagctcagggcctactcacaa
ctatgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctatgtaaacagtatctgtacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgccttgtgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073827_P_P-B Feature FT:CDS AB073827_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK11). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagaatatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggaagccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaaytccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattcggtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccaaacacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073828_P_P-B Feature FT:CDS AB073828_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK37). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgccattagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcggatcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgttcaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgtaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccgggrccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073829_P_P-B Feature FT:CDS AB073829_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HK38). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttaatcattactttcagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagtgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggyctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttctgtctttgggtatacatttaaaccctcgcaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgtttcaggaaactacctgtacacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073830_P_P-B Feature FT:CDS AB073830_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH57). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacrcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
aatattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
aggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaggatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttattgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatctcgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccg
cttctccgcctggtgtaccgaccgaccacggggcgcacctctcttcacgcggactccccgtctgtgccttctcatctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB073831_P_P-B Feature FT:CDS AB073831_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TH61). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacacactttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcc
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatacacacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgktgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatattgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggttattcccttaacttcatgggatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaacatcatcgggac
tgacaattctgtcgtgctttcccgcaagtatacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctggtataccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073832_P_P-B Feature FT:CDS AB073832_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Th65). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttaatattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctgawtggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtrmgcaatttgtggggccccttacagtaaatgaaaccaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcattcctccccacgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaagccatgaagtggaactcccccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgagtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtatctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccgtttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggggttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcaccaacttacaaggcctttctaagtcaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctggagtaccgaccaaccacggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgcc
ggaccgtgtgcacttcgattcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073833_P_P-B Feature FT:CDS AB073833_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Chi59). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcttcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
tyctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcctggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaatcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaaccttcgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073834_P_P-B Feature FT:CDS AB073834_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi16). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gatattcatttgcaggaggatattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtacacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggttatcctgctttaatgcctttgtatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctacgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073835_P_P-B Feature FT:CDS AB073835_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Vi29). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaagacattgttgataggtgtaagcaatttgtaggacccctaacagtaaatgaaatcaggagact
aaaattaataatgcctgctagattttatcccaaggttaccaaatacttgcccttagataaaggaatcaaaccctattatc
ccgagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagwcaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacttcaatccacacaaggacaattggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaatagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatc
gctggatgtatctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattggtagttggggttccttgccacaggaacatattgtacaaa
aaatcaaattatgttttaggaaacttcctgtaaacaggcctattgatgggaaagtatgtcaacgaattgtgggtcttctg
gggttcgctgccccttttacacaatgtggatatcccgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattctgtcgtgctgtcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
ctcctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073836_P_P-B Feature FT:CDS AB073836_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw25). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccctgctttaatcctgaatggaaaactccttcttttcct
gatattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttctatcccaatgttactaaatatttgcccctagataaagggatcaaaccatattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacatactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggactactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacacccatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacc
cgagtgtcttggccaaaattcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcccctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctctgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaaaaaacttcctgtaaacaggcctattgattggaaagtctgtcaacgaatcgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcactaacttacaaggcctttctacgtaaacagtatttgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccaccagcgcatgcgtggaacctttgtg
tctccccggccgatccatactgcggaactcctggccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtacacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073837_P_P-B Feature FT:CDS AB073837_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ku1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
acaaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcgggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcgggaatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccaggattcacccctccccatgggggactgttggggtggagccctcacgctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatacattggaaaccccccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcatgggcttccgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccaccggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073838_P_P-B Feature FT:CDS AB073838_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ho7). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacaacgaygcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcatgaggatattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgtcaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaatatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggctctgta
cttccctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcatggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactatgttttagaaaactgcctgtaaataggcctatcgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaagcaggcttt
tactttctcgccgacttataaggcctttctaagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgyctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073839_P_P-B Feature FT:CDS AB073839_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw174). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaccaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatattatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacacgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggattgttggggtggagccctcaggctcagggcctgctcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcagaaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agattggggaccctgtaccgaacatggagaccatctcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggacccact
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaagaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcagcgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatattcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctcagaaaccagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctcttccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073840_P_P-B Feature FT:CDS AB073840_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw36). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtggttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcttcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgycaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggyggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggytcgtagggctttcccccactgtctggctttcagttacatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
acgatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacagaaccatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccaaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073841_P_P-B Feature FT:CDS AB073841_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Tw30). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
aacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaaagttactaaatatttgcccttagacaaagggatcaaaccgtattatc
cagagtatgtggttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gaatccacacgtagcgcttcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggtgtgtcttcca
aacctcgaaaaggcatggggacaaatcttgctgtccccaatcccctgggattcttccccgatcatcagttggaccctcta
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccaaagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttacatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
acgatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacagaaccatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtcaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccaaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073842_P_P-B Feature FT:CDS AB073842_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw11). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttgcatactctttggaaggcaggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttgtctccacctctaagg
gacactcatcctcaggccatacagtggaactccaccattttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttccagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcttcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacgaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggtacattgccacaggaacatattgtccaaa
aaatcaaactatgttttaggaaacttcctgtaaacagacctattgattggaaagtttgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttgaagcctttatatgcatgtatacaagcgaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctccaggggccgcttgggcctctaccgcccg
cttttccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073843_P_P-B Feature FT:CDS AB073843_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Iw27). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttacaggaggacattgttgatagatgtaagcaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagataatgtagttaatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgaccatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttgtctccacctctaagg
gacactcatcctcaggccatgcagtggaattccacaactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagcaagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagacttgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcaccac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaartctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggagttggggcacattgccacaggaacatattatacaaa
aaatcaaagtatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtagtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgtttggggctctaccgcccg
cttctccgcctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB073844_P_P-B Feature FT:CDS AB073844_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-T11). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgctagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttgatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacccatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcaaggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttgtctccacctttgagg
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagcaagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcaccttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaattatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacctacaaggcctttctaagtcaacaatatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccataccgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctatcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccg
ctactccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073845_P_P-B Feature FT:CDS AB073845_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ya16). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactc
ataaggtgggaaactttacggggctctattcttctacagtgcctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaacctttctgtccccaatccactgggattcttccccgatcatcagctggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcactt
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctcccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaacccgcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaattaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacaatatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaattggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctccaggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgcccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB073846_P_P-B Feature FT:CDS AB073846_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry565). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccacgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctacagtacctgtctttaatcctgaatggcaaacgccttcttttcca
gacattcatttgcaggaggacattgttaatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattagtaatgcctgctagattttatcctaatgctaccaaatatttgcctttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagactagacattatttgcatactctttggaaggcgggtatattatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggaagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcagactgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtttgtcaacgaattgtgggtctcttg
gggttcgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgcattcaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacaatatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacctcatttccatggctgctaggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcagcgctgaatcccgcagacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctctacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073847_P_P-B Feature FT:CDS AB073847_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Fu53). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactc
ataaggtgggaaactttacagggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtaggaccccttacagtaaatgaaaacaggagatt
aaaattaataatgcctgctagattttatcctaatgttacaaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttactcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaacga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcaccagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggaatggtggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacc
cgtgtgtcctggccgaaattcgcagtcccaaatctccagtcactcaccaatctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttctatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctcagattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacttgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtttgtcagcgaattgtgggtcttttg
gggtttgctgccccctttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctacgtaaccagtatctgamcctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctaccgatccatactgcggaactcctagccgcttgttttgctcgcagaaggtctggagctaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073848_P_P-B Feature FT:CDS AB073848_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-HUS). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaattctgaatggcaaactccttcttttcca
gacattcatttacaggaggatattgttgatagatgtaagcaatttgtaggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattactttcagacaagacattatttgcataccctttggaaggcgggtatcttatataaaaga
gagtctacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagcaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacgcc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaattatgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtctttta
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
cactttctcgccaacttataaggcctttctaagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgtccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073849_P_P-B Feature FT:CDS AB073849_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na101). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaacttstgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcrccgcgtcgcagaagatctcaatctagggaaccccaatgttagvatcccttggactc
ataaggtgggaaactttacggggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttctttccca
gacattcatttgmaggaggatattgttgatagatgtcagcaatttgtgggaccccttacagtcaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
crgagcatgtagttaatcattacttccagacragacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctctctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctaaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgytggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttgtcga
cgactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacaac
cgtgtgtcttggccaaaattcgcagtgccaaatctccagtcactcaccaaccttttgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctmtgattccaggatcatcaaccaccagcacgggrccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaartctgta
caacaccttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaactaa
acgatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactatgttttagaaaacttcctgtaaacaggcctattgattggaaagtttgccaacgaattgtgggtcttttg
gggtttgctgccccttttacrcaatgtggatatcctgccttaaagcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgcvaacttacaaggcctttctgcgtcaccagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tcccctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcacaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073850_P_P-B Feature FT:CDS AB073850_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Na102). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgctagtatcccttggactc
ataaggtgggaaactttaccgggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaagaagatattgttgatagatgtaagcaatttgtgggaccccttacaataaatgaaaacaggagact
aaaattaataatgcctgctaggttttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcaccagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccgaacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaagggatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattccctcaactttatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaca
aaatcaaactatgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctgagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgattgctgacgcaactcccactggttggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB073851_P_P-B Feature FT:CDS AB073851_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
gaagttagtaatgcctgctagattttatcctaatgttaccaaatatttgcctttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagactagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtcctcaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattggaacctcaacctacacaaggacaattggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatc
gcttgatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacagc
tcctgctcaaggaaactttacgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttcttttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggcttttagttacatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtccaca
aaatcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtttgtcaacggattgtgggtctcttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgcatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatatgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgccgacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073852_P_P-B Feature FT:CDS AB073852_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry11). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttaatatcccttggactc
ataaggtgggaaatttcacggggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgaaggaggacattgttgatagatgtgagcaatttgtgggaccccttacagtaaatgaaaaaaggagatt
aaaattaataatgcctgctagattttttcctaagggtaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcaggtagttaatcattactttcagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcatttttcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctgtctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccgcaaggtgggagt
gggagcattcgggccagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagg
gacacgcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctaccacatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagagggaccacc
cgtgtgtcctggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaatcgggagttgggggacattgccacaggaacatattgtacaaa
aaatcaaacaatgtttcaggaaacttcctgtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttg
gggtttgcagccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttttacgtaaccagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgatgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggagcctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073853_P_P-B Feature FT:CDS AB073853_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry24). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttgatattccttggactc
ataaggtgggaaactttacggggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgataggtgtcagcaatttgtggggcccctcacagcaaatgaaaccagaagact
aaaattaattatgcctgccagattttatcctaaggttaccaaatatttgcccttagavaaagggatcaaaccctattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagtcaacacgtagcgcttcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgtccccaatcccctgggattcttccccgatcatcagttggacccagca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcactcctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacacacatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtaagggctctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttctcga
agactggggaccctgcaccgaacatggagaacatcgcatcaggactcctaggaccccttctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagacttgtggtggacttctctcagttttctaggggaaccacc
cgtgtgccatggccaaaattcgcagtgccaaatctgcagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcccctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttatgtctttgggtatacatataaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacgttgccacaagaccatattgtacaaa
aaatcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtctgttg
gggtttgctgccccttttacacaatgtggatatcctgctttaaagcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctccgtcaacagtatttgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtgggacctttstg
tcccctctgccgatccatacagcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgatgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgacgacggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073854_P_P-B Feature FT:CDS AB073854_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry30). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttgatataccttggactc
ataaggtgggaaactttacggggctttattcttctacagtacctgtttttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtgggaccccttacagtgaatgaaaggaggagact
aaaattagtaatgcctgctagattttatcctaaggttaccaaatatctgccgttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagactagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcatcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtccccaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtatctgcggcgttttatcatctkcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcccttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtrtacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactatgttttagraaacttcctgtaaacaggcctattgattggaaagtttgtcaaagaattgtgggtcttttg
gggtttgctgccccttttacacaatgtggatatcctgctttaaagcctttatatgcatgcatacaagccaaacaggcttt
tactttctcgccaacttacaaggcctttctacgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgtttcgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaaatatacatcctttccatggctgctaggctgtgctgccaactggatactgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073855_P_P-B Feature FT:CDS AB073855_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry34). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgagggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctacagtacctgtttttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattagtaatgcctgctagattttatcctaatgttaccaaatatttgcctttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagactagacattatttacatactctttggaaggcgggtatcttatacaaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatggtaggttggtcttaca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctcccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcccttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaga
aaatcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtttgtcaaagaattgtgggtcttttg
ggatttgctgccccttttacacaatgtggatatccagctttaatgcctttatatgcatgcatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttttacgtaaccagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggatgtgctgccaactggatactgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccttctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtcaacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073856_P_P-B Feature FT:CDS AB073856_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry46). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaatccttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcataagatctcaatctcgggaaccccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctacagtacctgtctttaatccggaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattagtcatgcctgctagattttatcctaaggttaccaaatatttgcctttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccaaactagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtaccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaatagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtgctgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaagtttgtcaacgaattgtgggtctttta
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgcatacaagcaaaacaggcttt
tactttctcgccaacctacaaggcctttctaagtcaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccacgggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073857_P_P-B Feature FT:CDS AB073857_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Ry48). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccactgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggatattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattagtcatgcccgctagattttatcctaatgttaccaaatatttgcctttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagactagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcctgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtaccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccaatttccatcaaactcttcaagatcccagagtcagagctctgta
ctttcctgctggtggctccagttcaggaatagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcgaggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacaac
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgcatacaagcaaaacaggcttt
tactttctcgccaacctacaaggcctttctaagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcttgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgcaaactggatactgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB073858_P_P-B Feature FT:CDS AB073858_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-Shin). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaacttgtgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctaggggatcccaatgttaatatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtgcctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggatcccttacagcaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagacaaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcctcca
aacctcgaaaaggcatggggacaaacctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggtcagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcactt
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtgccgaagatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtatctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttattggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtgattgggagttggggcacattgccacaggaacatattacacaaa
aaattaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgacttgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagccaaacgggcttt
tactttctcgccaacttacaaggcctttctacgtcaccagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB100695_P_P-B Feature FT:CDS AB100695_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH133). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatccccccttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttacaggaagatattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaatcaggagact
aaaattaattatgcctgctagattttatcccaatgtcaccaaatacttgcccttagataaaggaatcaaaccctattatc
ccgagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagtatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgta
cttccctgctggtggctccagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgttgtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcactaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggagttggggttccttaccacaggaacatattggacaaa
aaatcaaattgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttaccgcaatgtggatatccagctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcaccaacttacaaggcctttctgagtaaacagtatctgaccctgtaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcgtgcgcggaacctttctg
tctccgctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattctgtcgtgttatcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
ctcctccgtctgccgtatcgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatgtgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB106884_P_P-B Feature FT:CDS AB106884_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactc
acaaggtgggaaactttacagggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggatattgttgatagatgtgaacaatttgtgggaccccttacagtaaatgaaaaaaggagact
gaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcagggagttaatcattacttccagactagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgctggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaatagtaagccctgctcagaacactgtctctaccatatcgtcaatcttatcga
cgactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtatctgcggcgttttatcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacgaa
aagatggggatactcccttaacttcatgggatatgtaattgggggttggggcacattgccacaggaacatattgtacaaa
aaatcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcgaaaaaggcttt
tactttttcgccaacttacaaggcctttctacgtcaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tcccctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctccaggggccgcctggggctataccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcacatggagaccaccgtga
>gnl|hbvcds|AB115551_P_P-B Feature FT:CDS AB115551_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB15). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
acaaggtgggaaactttacggggctttattcttctacggtaccggtctttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaagacattgttgataggtgtaagcaattcgtgggacccctaacagtaaatgaaaccaggagact
aaaattaattatgcctgctagattttatcccaatattaccaaatacttgcccttagataaaggaatcaaaccctattatc
ccgagcatgtagttaatcattactttcagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacaagtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaacaggcatgggtacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggtctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcagggacagtgagccctgctcaaaatactgcctctgccatatcgtcaaccttctcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgngtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggagttggggttccttgccacaggaacatattgtacaaa
aaatcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctg
gggttcgctgccccttttacacaatgtggatatcctgctttaatgcctttgtatgcatgtaaacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttttaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctcctctgccgatccatactgcggaactccttgcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattctgtcgtgctatcccgcaagtatacatcgtttccatggctgctcggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
ctcctccgtctgccgtaccgaccgaccacggggcgcaccatactttacgcggactccccgtctgtctcttctctgctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB117759_P_P-B Feature FT:CDS AB117759_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-CB14). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgataggtgtaagcaatttgtgggacccctaacaataaatgaaaacaggagact
gaaattaattatgcctgctagattttatcctaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatccactgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaatccacacaaggacacttggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcactcctccccatgggggtctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtccggaaggcagcctactcccttgtctccacctctacgg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacc
cgtgtgtcctggccaaaattcgcagtcccaaatcttcagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcgaaacccctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacataacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggggttggggctccttgccacaggaacatattgtaccca
aaatcaatctatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggattcgctgccccttttacacaatgtggatatcctgctttaatgcctttgtatgcatgtatacaagcacaacaggcttt
tactttctcgccaacttacaaggcctttctacgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattctgtcgtgctatcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
ctcctccgtctgccgtaccgaccgaccacggggcgcacctctctctacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195933_P_P-B Feature FT:CDS AB195933_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatattatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgcaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacacctccccatgggggactgttggggtggagccctcaggctcagggactactcacaa
cggtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacggattgtgggtcttttg
gggtttgccgccccgttcacgcaatgtggatatcctgcattaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcaccaacttacaaggcctttctaagtaaacagtatctgaacctttaccctgtggctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195934_P_P-B Feature FT:CDS AB195934_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatattatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgcaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcgcacctccccatgggggactgttggggtggagccctcaggctcagggactactcacaa
cggtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacggattgtgggtcttttg
gggtttgccgccccgttcacgcaatgtggatatcctgcattaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccctgtggctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB195935_P_P-B Feature FT:CDS AB195935_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatattatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgcaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcgcacctccccatgggggactgttggggtggagccctcaggctcagggactactcacaa
cggtgccagcagttcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggatatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcaacaaccagcacgggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacggattgtgggtcttttg
gggtttgccgccccgttcacgcaatgtggatatcctgcattaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccctgtggctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB205119_P_P-B Feature FT:CDS AB205119_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aatctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctctgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaatgccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattggatgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggactggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagctgcctgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtactctcccgcaaatatacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctggtgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgcgccttctcatcttcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB205120_P_P-B Feature FT:CDS AB205120_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF687-2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccgacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgccctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggcttccgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattggatgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggactggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagctgcctgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtactctcccgcaaatatacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctggtgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatcttcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB205121_P_P-B Feature FT:CDS AB205121_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-IF720-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctacagtacctgtttttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagatt
aaaattaataatgcctgctagattttttcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattactttcagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagcgtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttgggggacattgccacaggaacatattgtacaaa
aaatcaaactatgttttaggaaaattcctgtaaacaggcctattgattggaaagtttgtcaacgaattgtgggtcttttg
gggtttgcagccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
ttctttctcgccaacttacaaggcctttctaagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacccggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB205122_P_P-B Feature FT:CDS AB205122_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-VH69-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
acaaggtgggaaactttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaagacattattgataggtgtcagcaatttgtgggacccctaacagtaaatgaaatcaggagatt
aaaattaattatgcctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatc
ccgagcatgtagtgaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgtccccaatccactgggattcttccccgaccatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagg
gacactcatcctcaggccgtgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcagaaacagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgtttcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcccgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctcctggtatacatttaaaccctcacaaaacaaa
aagatggggatattctcttaatttcatgggatatgtaattgggggttggggttccttgccacaggaacatattgtacaaa
aaatcaaattgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctg
gggttcgctgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaagactcttctgagtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattctgtcgtgctctcccgcaagtacacatcgtttccatggctgctaggctgtactgccaactggatcctgcgcg
ggacgtccttcgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
ctcctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB212625_P_P-B Feature FT:CDS AB212625_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1026). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaacaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcctttcct
gacattcatttgcaggaggacattgttgataggtgtaagcaatttgtgggacccctaacaataaatgaaaacaggagact
aaaattgattatgcctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgttccccatcctctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagt
gggagcatttgggccagggttcattcctccccatgggggcctgttggggtggagcccgcaggctcagggcatactcgcaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtccggaaggcagcctactcccttatctccacccctaagg
gacactcatcctcaggccatgcagtggaactccaccgctttccatcaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcccttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgcctctgggtatacatttaaaccctcacaaaacaaa
acgatggggatattcccttaatttcatgggatatgtaattggtagttggggctccttgccacaggaacatattgtacaaa
aaatcaaatcatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggttcgctgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaaagggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
cgacaattctgtcgtactctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgaccg
ctcctccgtctaccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttttcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB212626_P_P-B Feature FT:CDS AB212626_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VT1022). Non-functional genomic sequence. [Hepadnaviridae] (length=2514 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaagacatcgttgataggtgcaagcaatttgtgggacccctaacagcaaatgaaatcaggagact
aaaattaattatgcctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatc
ccgagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatacctcgataaggcatgg
ggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggacccagcattcaaagccaactcagaa
aatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagtgggagcattcgggccagg
gttcacccctccccatgggggcctgttgggttggagccctcaggctcagggcatactcacaactgtgccagtagcacctc
ctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctcaggcc
atgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgtaccttcctgctggtggctc
cagttcaggaatagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcgaagactggggaccctgtac
cgaacatggggaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttcttgttgacaaaaatc
ctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaaaacccgtgtgtcttggccaaaa
ttcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggc
gttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgccc
gtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgactcctgctcaaggaacctc
tatggttccctcatgttgctgtacaaaacctacggacagaaactgcacctgtattcccatcccatcatcttgggctttcg
taaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgtttgttcagtggttcgtaggg
ctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctt
tatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattccct
taatttcatgggatatgtaattgggagttggggttccttgccacaggaacatattgtacaaaaaatcaaatcatgtttta
ggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctggggttcgctgcccctttt
acacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcctttactttctcgccaactta
caaggcctttctaagaacacaatatctgaacctttaccccgttgctcggcaacggcctggtctatgccaagtgtttgctg
acgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtgtctcctctgccgatccat
actgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaacttatcgggactgacaattctgtcgtgct
atcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacg
tcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgctcctccgtctgccgtac
cgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgc
ttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB219426_P_P-B Feature FT:CDS AB219426_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4014, PNN1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccgggctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggatattgttgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgccaggttctatcctaatgttaccaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatggggggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgtccccaatccgctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggactactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagcatctcctcctcctgcctccaccaatcggcaggtagcaaggccgcctactcccctgtctccacctctaagg
gacactcatcctcaggccatgcggtggaactcccccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcctgttgctgtataaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttatctttgggtatacatctaaaccctcataaaacaaa
aagatggggctattcccttaacttcatgggatatgtaattggaagttggggcactttaccccaggaacatattgtgttga
aaatcaaacaatgttttagaaaacttcctgtaaataggcctattgattggaaagtgtgtcaacgaattgtaggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcttttctaaacaaacagtatatgcacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
cgacaattctgtcgtcctgtcccgtaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccctcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgnga
>gnl|hbvcds|AB219427_P_P-B Feature FT:CDS AB219427_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4075, PNN2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccgggctttaatcctgattggcaaactccttcttttcct
aacattcatttgcaggaggatattgttgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttctatcctaatgttaccaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgtccccaatccgctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggactactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagtcctcaagctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtagcaaggccgcctactcccctgtctccaccgctaagg
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatc
gctggatgtgtctgcggcgttctatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaacctacggaaggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttggggaccaagtctgta
caacatcttgagtccgtttatgccgctgttaccaattttcttttgtctttgggtatacatctaaaccctcataaaacaaa
aagatggggctattccctgaacttcatgggatatataattggaagttggggcactttgccccaggaacatattgtgttga
aaatcaaacaatgttttcgaaaacttcctgtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttg
ggttttgctgctcctttcacacaatgtggttatcctgctttaatgcctttatatgcatgtatacaagctaaacaagcttt
tactttctcgccaacttataaggcttttctaaacaaacagtatctgaacctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggagcaagacttatcgggac
cgacaattctgtcgtcctgtcccgtaaatatacatcatttccatggctgctcggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccctcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccaaccgaccacggggcgcacctctctctacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB219428_P_C-B Feature FT:CDS AB219428_P_C-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4076, PNN3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccgggctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggatattgttgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttctatcctaatgttacaaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatccgctgggattttttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccgcacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggctgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggtatacttacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtagcaaggccgcctactcccctgtctccacctctaagg
gatactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctctgggtatacatctaaaccctcataaaacaaa
aagatggggctattcccttaacttcatgggatatgtaattggaagttggggcaccttacctcaggaacatattgtgttaa
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttg
ggatttgctgcgcctttcacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcttttctacacaaacagtatttgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
cgataattctgtcgtcttgtcccgtaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccctctcggggccgcttggggctttaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB219429_P_P-B Feature FT:CDS AB219429_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4101, PNN4). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccgggctataatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggatattgttgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttctatcctaatgttaccaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgtccccaatccgctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggactactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaatctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtagcaaggccgcctactcccctgtctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtccaccgatttgtcctggctatc
gctggatgtatctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tttcaaggtatgttgcccgtttgtcctctaattccaggatcatcgaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcctgttgctgtataaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatctaaaccctcataaaacaaa
aagatggggctattcccttaacttcatgggatatgtaattggaagttggggcactttaccccaggaacatattgtgttga
aaatcaaacaatgttttagaaaacttcctgtaaaccggcctattgattggaaagtgtgtcaacgaattgtaggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcttttctaaccaaacagtatctgaacctttaccccgttgcccggcaacggcccggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagctgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
cgacaattctgtagtcctgtcccgtaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccctcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB219430_P_P-B Feature FT:CDS AB219430_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Patient #4148, PNN5). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctcaatggcaaactccttcctttcct
gacattcatttgcaggaggacatcattaataggtgtaaacaatttgtgggaccccttacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcccaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcaa
aacctcgacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgagcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccaacagctcctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaaga
gacactcatcctcaggcaatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaatcctcagaaaacaaa
aagatggggctactcccttaatttcatggggtatgtaattggaagttggggcaccttaccccaagaacatattgtgttga
aaatcaaacaatgttttagaaaacttcctgtaaacaggcccattgactggaaagtgtgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctttgatgccgttatatgcatgtatacaagcgaaacaggcttt
tactttttcgccaacttacaaggcctttctgagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggac
tgataattctgtcgtcctttctcggaaatatacatcatttccatggctgctaggttgtactgccaactggattcttcgcg
ggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccttcgcgaggtcgcttgggactctttcgtccc
cttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgttgcatggagaccaccgtga
>gnl|hbvcds|AB231909_P_P-B Feature FT:CDS AB231909_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate VH10). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtttcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaggatattgttgataggtgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagatt
aaaattaatcatgcctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaatcctattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacgacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggcttgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccatcaaactcttcaagatccaagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaataccgcctctgccatatcgtcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgctggttcttctggac
tatcaaggtatgttgcccgtttgtcctccaattccaggatcatcaaccaccagcactggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaactaa
gagatggggttattccttaaacttcatgggatatgtaattggaagttggggtaccttgccacaagatcatattatacaga
aaatcaaacaatgctttagaaaactccctgttaacagacccattgattggaaagtatgtcaacgaatttcaggactcttg
ggctttgctgctccattcacacaatgtggttaccctgcgttaatgcctttgtatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttacaaggcctttctgtgtaaacaatatatgaacctttaccccgttgccaggcaacggcccgggc
tatgccaagtgtttgctgatgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
gctcctctgccgatccatactgcggaactgctagccgcctgttttgctcgcagccggtctggagcaaaacttatcgggac
tgataattctgtcgtcctttcgcggaaatatacatcatttccatggctgctaggctgtgccgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcctgcggacgacccctctcggggccgcttggggatctaccgtcct
cttcttcgtctgccgtaccgaccgtccacggggcgcacctctctttacgcggtctccccgtttgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaggccaccgtga
>gnl|hbvcds|AB241117_P_P-B Feature FT:CDS AB241117_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate PhHCC05). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatccacacttccggaaactactgttattagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccgggctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggatattgttgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttctatcctaatgttaccaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattactttcaaacaagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgtccccaatccgctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggactactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccacgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtagcaaggccgcctactcccctgtctccacctctaagg
gacactcatcctcaggccacgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctacgtttccctcctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcggtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatctaaaccctcataaaacgaa
aagatggggctattcccttaacttcatgggatatgtaattggaagttggggcactttaccccaggaacatattgtgttga
aaatcaaacaatgttttagaaaacttcctgtaaacaggcctattgattggaaagtgtgtcaacgaattgtaggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctttaatgcctttatatgcatgtatacaagctaagcaggcttt
tactttctcgccaacttacaaggcttttctaaacaaacagtatctgaccctttaccccgttgcccggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcacgcgaagaacctttgtg
tctccactgccgatccatactgcggaactcctagctgcttgttttgctcgcagccggtctggagcgaaacttatcgggac
cgacaattctgtcgtcctgtcccgtaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccctcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgtccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB246339_P_P-B Feature FT:CDS AB246339_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaagctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccacttttcaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttgtcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
cgtcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctata
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacgttgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcacgacaggcttt
tactttctcgccaacttacaaggcctttttaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB246340_P_P-B Feature FT:CDS AB246340_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcattccgccccatgggggactgatggggtggagccctcaggctcagggcatacttacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccagactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaagaaacttcctgtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaagcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcggaac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgttccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB246341_P_P-B Feature FT:CDS AB246341_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaaacaatttgtgggaccccttacagtaaatgaaaccaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcaggtagttaatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcaaccaactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ttttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggatcatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatactcccttaacttcatgggatatgtaattgggagttggggaacattgccacaggaacatattgtacaaa
aaatcaaactatgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcagagaattgtgggtcttttg
gggtttgctgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgtccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcatgtcgcatggagaccaccgtga
>gnl|hbvcds|AB246342_P_P-B Feature FT:CDS AB246342_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttacgggtctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcacgaggatattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccaaacaagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttccaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccattttccaccaaactcttcaggatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaactctcataaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactatgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcaccaacttataaggcctttctaagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaacactcatcgggac
tgacaattctgtcgtactctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtatcgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB246343_P_P-B Feature FT:CDS AB246343_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttacgggtctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcacgaggatattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccaaacaagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttccaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccattttccaccaaactcttcaggatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
cgactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggttgacttctctcagttttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcaccttgccacaggaacatattgtacaaa
aaatcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtttgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacatacaaggcctttctaagcaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
ctcctccgcctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB287314_P_P-B Feature FT:CDS AB287314_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska433). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttacggggctctattcttctacggtacctatctttaatcctgaatggcaaactccttcttttcct
aacatacatttgcaggagaacattattgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttttatcctaatactactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccaacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagc
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctacctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaaga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggagcagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcccttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattacctcaagaacacatagtgtcaa
aaatcaaacaatgttttagaaaacttcctgtaaaccgacccattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtg
tctcctctggcgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaacctcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB287315_P_P-B Feature FT:CDS AB287315_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska419). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttacggggctctattcttctacggtacctatctttaatcctgaatggcaaactccttcttttcct
aacatacatttgcaggagaacattattgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttttatcctaatactactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccaacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagc
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctacctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaaga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggagcagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcccttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattacctcaagaacacataatgtcaa
aaatcaaacaatgttttagaaaacttcctgtaaaccgacccattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggcacctttgtg
tctcctctggcgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaacctcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB287316_P_P-B Feature FT:CDS AB287316_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska427). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttacggggctctattcttctacggtacctatctttaatcctgaatggcaaactccttcttttcct
aacatacatttgcaggagaacattattgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttttatcctaatactactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccaacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggaga
gggagcattcgggccgggattcactccgccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctacctccaccaatcgccaggtaggaaggcagcctactcccctttctccacctctaaga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggagcagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaaacacc
cgtgtgtcttggcccaaattcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcccttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggataatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttatctttgggtatccatttaaaccctcataaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattacctcaagaacacatagtgtcga
aaatcaaacaatgttttagaaaacttcctgtaaaccgacccattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatccaagctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttactcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggcacctttgtg
tctcctctggcgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaacctcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB287317_P_P-B Feature FT:CDS AB287317_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska416). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaatacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaagatctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctatctttaatcctgaatggcaaactccttcttttccc
aacatacatttgcaggaaaacattattgataggtgtgaacaatttgtgggacccctcacagcaaatgaaaaaaggagact
aaaattgatcatgcctgctaggttttatcctaatactactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcaagtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aaccacgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagccgactcccctttctccacctctacga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggagcagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaatcctcataaaaccaa
acgttgggggtactcccttcactttatgggatatgtaattggaagttggggcacattacctcaagaacacatcgtgtcaa
aaatcaaacaatgttttagaaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgcattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatccggctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tacgttctcgccaacttataaggcctttctaaaccaacaatatctaaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacctttctg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB287318_P_P-B Feature FT:CDS AB287318_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alaska2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctatctttaatcctgaatggcaaactccttcttttccc
aacatacatttgcaggaaaacatcattgataggtgtaaacaatttgtgggacccctcacagcaaatgaaaacaggagact
aaaattgatcatgcctgctaggttttatcctaatactactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcaagtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aaccacgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcccactcccctttctccacctctaaga
gacactcatcctcaagccatacagtggaactcccccacgttccaccaaactcttcaacatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggagcagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctcggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctcattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatctcgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcctcataaaacaaa
acgttgggggtactcccttcactttatgggatatgtaattggaagttggggcacattacctcaagaacacatcgtgtcaa
aaatcaaacaatgttttagaaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgcattgtgggtcttttg
gggtttgctgccccttttacacaatgtgggtatccggctttaatgcctttgtatgcaagtatacaagctaaacaggcttt
tacgttctcgccaacttataaggcctttctacgcaaccaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacctttctg
tctccactgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB287319_P_P-B Feature FT:CDS AB287319_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AlaskaG23). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccgtggactc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcca
aacatacatttgcaggaaaacattattgataggtgtaaacaatttgtgggacccctcacagcaaatgaaaacaggagact
aaaattaatcatgcctgctaggttttatcctaatactactaaatattttcctttagataaaggaattaaaccttattatc
cagagcaagtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataagaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aaccacgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcc
ttcaaagccaactccgacaatccagactgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaaga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggagcagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtccacaaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaatcctcataaaacaaa
acgttgggggtactcccttcactttatgggatatgtaattggaagttggggcacattacctcaagaacacatcgtgtcaa
aaatcaaacaatgttttagaaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgcattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatccagctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tacgttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacctttttg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcatctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB287320_P_P-B Feature FT:CDS AB287320_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcca
aacatacatttgcaggagaacattattgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttttatcctaatactactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcaggtatcttatataaaaga
gaaactacacgtagtgcctcattctgtgggtcaccctattcgtgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccagacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccacgggggattattggggtggagcccccaggctcagggcatactgacat
ctttgccagcagctcctcctcctgcctccaccaatcggcaggtggggaggcggcctacgcccatttctccacctctaaga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcga
cgactggggaccctgtaccgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaagaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatctgtcctggttatc
gctggatgtatctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggtgcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataagacaaa
acgttggggttactcccttaacttcatgggatatgtaattggcagttggggcacattacctcaagaacacatcgtatcaa
aaatcaaacaatgttttagaaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaggctaaacaggcttt
tactttctcaccaacttataaggcctttctgaacaaacaatatctgaccctttaccccgttgctcggcaacggtcaggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggctatgggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgcccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB287321_P_P-B Feature FT:CDS AB287321_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctattattagacgacgaggcaggagccctagaagaagaactccctcg
cctcgcagacccagatctcaatcaccgcgtcgcagaagatctcaatctcggggaccccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcct
aacattcatttgcaggaggatattattgataggtgtacacaatttgtgggacccctcacaccaaatgagaacaggagact
gaaaatgatcatgcctgctaggttttatcctaatgctactaaatatttgcccttggataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaactacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtctgcca
aacctcgaaaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccagacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggattattggggtggagccctcaggctcagggcatactcacct
ctctgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggctgcctactcccctttctccacctctaaga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagtttaggaacagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctagggggagcacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatctgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcccttt
gttcagtggttcgtaggtctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaagccctttataccgctgttaccaattttcttttgtctttgggtgtacatttaaaccctcataaaacaaa
acgttggggttactcccttaacttcatgggatatgaaattggcagttggggtacattacctcaagaacacatcgtgtcaa
aaatcaaacaatgttttagaaaacttcctgtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttg
ggatttgctgcaccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcaccaacttataaggcctttctaaacaaacagtatctgaacctttaccccgttgctcggcaacggtcaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgtttcgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccca
cttctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB287322_P_P-B Feature FT:CDS AB287322_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggacgc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccctcttttcct
aacattcatttgcaggagaacattattgataggtgtaaacaatttgtgggacccctcacagtaaatgagaacaggagact
aaaattgatcatgcctgctaggttttatcctaatactactaaatatttgcccttggataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttcaagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtctgcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccagacgccaacaaggtgggagt
gggagcattcgggccgggattcactcccccccatgggggattattggggtggagccctcaggctcagggcatactcacct
ctctgccagcagctcctcctcctgcctccaccaatcgtcaggtaggaaggctgcctactcccctctctccacctctaaga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagaatactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggagacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatctgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggtagttggggtaccttacctcaagaacacatcgtgtcaa
aaatcaaacaatgttttcgaaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgcaccttttacacaatgtgggtatcctgctttaatgcctttgtatgcatgtatacaagctaaacaggcttt
tactttctcaccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgttccgaccgaccacggggcgtacctctctttacgcggactccccgtctgtgccttctcacctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB287323_P_P-B Feature FT:CDS AB287323_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-4). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagaccaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcct
aacattcatttgcaggaggacattattaataggtgtgaacaatttgtgggacccctcacagtaaatgagaaacggagact
aaatttggtcatgcctgctaggttttatcctaatactactaaatatttccccttggagaaaggaattaaacctcattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcaggtatcttatataaaaga
gaaactacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtctgcca
aacctcgaaaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccagacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggattattggggtggagccctcaggctcagggcatactcacct
ctctgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggctgcccactcccctttctccacctctaaga
gacactcatcctcaagccatgcaatggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagagtactgcctctgccatatcgtcaaccttatcga
cgactggggaccctgcaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaatgcc
cgggtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatctgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcccttt
gttcagtggttcgtaggtctttcccccactgtatggctttcagttatatggatgatgtggtattgggggccaagtctgtg
caacatcttgaggccatttacaccgctgttaccaattttcttatgtctttgggtatacatttaaaccctcataaaacaca
acgttggggttactcccttaacttcatgggatatgtaattggcagttggggcacattacctcaagaacacatcgtgtcaa
aaatcaaacaatgttttagaaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgcaccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcaccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcggaac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB287325_P_P-B Feature FT:CDS AB287325_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Greenland-6). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcct
aacattcatttgcaggagaacattattgataggtgtaaacaatttgtgggacccctcacagtaaatgagaacaggagact
aaaattgatcatgcctgctaggttttatcctaacactactaaatatttgcccttggataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggagggcgggtatcttatataaaaga
gagactacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtctgcca
aacctcgaaaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgaccaccagttggaccctgca
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaatcagtcagacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggattattggggtggagccctcaggctcagggcatactcacct
ctctgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggctgcctactcccctttctccacctctaaga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtacagaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggagacaac
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatctgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaagggacctctatgtttccctcatgttgttgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggcttttagttatatggatgatgtggtattgggggccaaatctgtg
caccatcttgagtccctttatgccgctgttaccaattttctgttgtctttgggtatacatttaaaccctcataaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggcagttggggtacattacctcaagaacacatagtgtcaa
aaatcaaacaatgttttcgaaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgcaccttttacacaatgtgggtatccagctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcaccaacttataaggcctttctatacaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaacctcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB287326_P_P-B Feature FT:CDS AB287326_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A44). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtgggaccccttacagtaaatgaaaaaaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcaggtagttaatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaacctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctcta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacatc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttctgttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacgaa
aaatcaaactctgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcacctacgtacaaggcctttctaagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtactctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB287327_P_P-B Feature FT:CDS AB287327_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Bj A53). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgcaggtctaaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctatctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaagacattgttgatagatgtaagaattttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaaagttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaacctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagactgggacctcaacccacacaaggacaattggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaaactcatcga
cgactgggggccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtccccaatctccaatcactcaccaacctgctgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgta
caacatcttgagtccctttatgccgctgttaccaattttcttctgtctttgggtatacatataaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattggaagttggggcacattgccacaagaacatattgtacaaa
aaatcaaactgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtctttta
gggttcgctgccccttttacacaatgtggatatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttttcgccaacttacaaggcctttctacgtcaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB287328_P_P-B Feature FT:CDS AB287328_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba 51). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaagctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccacttttcaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttgtcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
cgtcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctata
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacgttgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcacgacaggcttt
tactttctcgccaacttacaaggcctttttaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB287329_P_P-B Feature FT:CDS AB287329_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JPN Ba A55). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgaaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccaaacgcgacattatttacacactctttggaaggcggggatattatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaaaacccctgctcgggttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctcaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB300364_P_P-B Feature FT:CDS AB300364_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient6). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccaaacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaagctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtcaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctcttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB300371_P_P-B Feature FT:CDS AB300371_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient13). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaactcttccggaaactactgttgttagacaacgaggcaggtcctctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgctagtatcccttggactc
ataaggtgggaaactttactgggctttattcttctacagttcctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagttaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataagggaatcaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggacttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccctatctccacctctaagg
gacactcatcctcaggccatgcagtggaactctaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgctcagaatactgtctctaccacatcgtcaatcttatcga
cgactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcgggattt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttacccgtttgtcctatgatacccggatcatcaacaaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
cgtcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggacgatgtggttttgggggccaagtctgta
caacaccttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtcattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatatgttttaggaaacttcctgtaaacaggcctattgattggaaagtttgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
taccttctcgccaacttacaaggcctttttacgtaaccaatatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccacgggttggggcttggccatcggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB302095_P_P-B Feature FT:CDS AB302095_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaattttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattattgatagatgtaagaattttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatggtaccaaatatttgcccttagataaagggatcaaaccttattacc
caaatcaggtagttaatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtctgcca
aacctcgaaaaggcatggggacaaacctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctcctcatgggggactgttggggcggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagg
gacactcatcctcaggccgtgaagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtatcggccatatcgtcaatcttatcga
cgactggggaccctgtgacgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcgtggccaaaattcgcagtcccaaacctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcacggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaaactcttcgattccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcgtcatgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacaccttgagtcccttcatgccgctgttaccaattttcttatgtctttgggtatacatttgaaccctcacaaaacaaa
aaggtggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacata
aaatcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgcattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaaagcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctccgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcggcac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB302942_P_P-B Feature FT:CDS AB302942_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3837NN). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcctctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtactccctggacac
ataaggtgggaaactttacggggctttattcttctacagtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaccaggagact
aaaattaattatgcctgctaggttttatcccaagggtactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacattctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcagactcagggcctactaacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatacagtggaactccaccactttccaccaaactcttcacgatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gttggatgtatctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcatcaaccaccagcaccggaacatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccatttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgccaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttttacgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactgggtggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccg
cttctccgcctgctgtaccgaccattcacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB302943_P_P-B Feature FT:CDS AB302943_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3639NN). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtactccctggacac
ataaggtgggaaactttacggggctttattcttctacagtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaccaggagact
aaaattaattatgcctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacattctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcagactcagggcctactaacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatacagtggaactccaccactttccaccaaactcttcacgatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gttggatgtatctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcatcaaccaccagcaccggaacatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccatttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgccaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttttacgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactgggtggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccg
cttctccgcctgctgtaccgaccatccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB302944_P_P-B Feature FT:CDS AB302944_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3641NN). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcctctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtactccctggacac
ataaggtgggaaactttacggggctttattcttctacagtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaccaggagact
aaaattaattatgcctgctaggttttatcccaagggtactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacattctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcagactcagggcctactaacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatacagtggaactccaccactttccaccaaactcttcacgatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gttggatgtatctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcatcaaccaccagcaccggaacatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccatttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgccaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttttacgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactgggtggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccg
cttctccgcctgctgtaccgaccattcacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB302945_P_P-B Feature FT:CDS AB302945_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GRE3643NN). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcctctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtactccctggacac
ataaggtgggaaactttacggggctttattcttctacagtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaccaggagact
aaaattaattatgcctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacattctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcagactcagggcctactaacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatacagtggaactccaccactttccaccaaactcttcacgatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gttggatgtatctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcatcaaccaccagcaccggaacatgcaaaacctgcacgac
tcctgttcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgcagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccatttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgccaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttttacgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactgggtggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccg
cttctccgcctgctgtaccgaccatccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB362933_P_P-B Feature FT:CDS AB362933_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggatattgttgagagatgtaagcaatttgtaggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaaggttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctaccgcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttccaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaagctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaagccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacaac
cgagtgtcttggccaaaattcgcagttccaaatctccaatcactcaccaacttgttgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccacaagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttatgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattggaagttggggcacattgccacaggaacatattgtacaaa
aaatcaaatcatgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatattcatgtatacaagcaaaacaggcttt
tactttctcgccaacttataaggcctttctgagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagcggcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacctcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcgcgctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB365445_P_P-B Feature FT:CDS AB365445_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BOL1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagact
aaaattagttatgcctgctaggttttatcccaaagttactaaatatttgcccttagataaagggattaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctaccgcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgtacaaggacaattggccggacgccaacaaggtgggagc
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagtcctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaagccatgcagtggaactcaacaactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaac
gcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggtgcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacaccttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacacattatacaaa
aaatcaaaatgtgttttagraaacttcctgtaaacaggcctattgattggaaagtatgtcaacgtattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttataaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatacggcggaactcctggccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggac
cgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgtcgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB368295_P_P-B Feature FT:CDS AB368295_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctaactttaattctgattggcaagctccttcctttcct
gacattcatttgcaggaggacattgttaataggtgtaagcaatttgtgggacccctaacaaaaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcacgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagt
gggagcatttgggccagggttcattcctccccatgggggcctgttggggtggagccctcaggctcagggcatactcgcaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtccggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccatcaaactcttcaagatccccgagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgtcacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctctgggtatacatttaaaccctcacaaaacaaa
acgatggggatattcccttaatttcatgggatatgtaattggtagttggggctccttgccacaggaacatattgtacaaa
aaatcaaatcatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgtattgtgggtcttttg
gggttcgctgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctccgctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagctaagctcatcgggac
cgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctatcgtccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB471854_P_P-B Feature FT:CDS AB471854_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-F). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttgtcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaagacatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagcccctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagaggctagactcgtggtggaattctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgagggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttcttagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcacagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctatggtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB471855_P_P-B Feature FT:CDS AB471855_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate F5M-C). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagcccctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttcttagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcacagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctatggtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB493827_P_P-B Feature FT:CDS AB493827_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 25UC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcct
gacattcatttacaggaggacattgttaataggtgtgaacaatttgtgggacccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacactatttacatactctttggaaggcgggtattttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggattgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggaagcctactcccctgtctccacctctaaga
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatccccgagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatctaaaccctcataaaacaaa
aagatggggctactcccttaacttcatgggatatgtaattggaagttggggcaccttaccccaggaacatattgtattga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctctaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttataaggcctttctcaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcagaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattccgttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB493833_P_P-B Feature FT:CDS AB493833_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P9). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcctttcct
gacattcatttgcaggaggacattgttaataggtgtaaacaatttgtgggaccccttacagtgaatgaaaacaggagact
aaaattgatcatgcctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
ccgagcatgtagttaatcattacttccagacgaggcattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgacacggcatggggacaaatctttccgtccccaatcctctgggattctttcccgagcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccaacagctcctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaaga
gacactcatcctcagacaatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaacagtaaaccctgttcagaacactgcctctcccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttatctttgggtattcatttaaaccctcataaaacaaa
aagatggggctactcccttcacttcatggggtatgtaattggaagttggggcaccttaccccaggaacatattgtgttga
agctcaaacaatgttttaggaaacttcctgtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacgcaatgtggttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttttcgccaacgtataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggtcaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctttgccgatccatactgcagaactcctggccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggac
tgacaattctgtcgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccg
cttctccgtctgccgtaccgaccatccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB493835_P_P-B Feature FT:CDS AB493835_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate P30). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctagctttaatcctaattggcaaactccttcctttcct
gacattcatctgcaggaggacatcattaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgacaaggcatggggacaaatctttccgtccccaatccgctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
cggtgccaacagctcctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaaga
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaacccccagaaaacaaa
aagatggggctactcccttaacttcatggggtatgtaattggaagttggggcaccttaccccaagaacatattgtgttga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaggtgtgtcagcgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttttcgccaacgtataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacatttgtg
tctcctctgccgatccatactgcagaactcctagccgcttgttttgctcgcagcaggtctggagctaaactcatcgggac
tgacaattctgttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggcgaccaccgtga
>gnl|hbvcds|AB555498_P_P-B Feature FT:CDS AB555498_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA41). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttaatattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacaatcataagcaggagaacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaagaagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccaggcgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacagggagcgcctcattttacgggtcaccgttcttttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatcttgctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccaggtttcgtccctccacatgggggacagttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccaaagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtcagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaaaacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacaccttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggggttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaactgcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaagtcgtagcagcatgttttgctcgcagcaggtctggggcgaaactcatcgggac
tgacaattctgtcgtactctcccgcaagtatacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctggtgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatcttcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB555499_P_P-B Feature FT:CDS AB555499_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-TA62). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttcttcggtaccttgctttaatcctaaatggcaaactccttcttttcct
aacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgggacattatttacacactctttggaaggcgggaatcttatacaaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacgaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
tccaaagccaactcagaaaatccagattgggacctcaacccgcacaaggatcaatggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggattgttggggtggagccctcaggctcagggcctactctcat
ctgtgtcagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccactctcctcatgggcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagattactgtctctgccatatcgtcaatcttatcga
agactggggaccctgcaccgaacatggagaacatcgcatcaggactcccaggacacctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgtgggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttcgcaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggac
tgacaattctgtcgtgctttcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctctggtaccgaccgaccacggggcgcacctctcttttcgcggactccccgtctgtgccttctcatctgcc
ggaccgtcagcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB642093_P_P-B Feature FT:CDS AB642093_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagacgacgagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgctagtattccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaagacattgtcgatagrtgtaagcaatttgtgggaccactcacagtaaatgaaaacagaagact
aaaattaattatgcctgctagattttatcccaatgttacyaartatttgcccttagataaagggatcaaaccctattatc
cagagcatgcagttaatcattacttccagacaagacattatttacatactctttggaaggcrggtatcttatataaaaga
gagtcaacacgtagcgcctcattytgtgggtcaccatattcttgggaacaagatctacagcatgggargttggtctwcca
aacctcgaaaaggcatggggacaaatctytctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggwctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagg
gacacmcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagacttgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcytggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccmatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtccyctgattccaggatcatcaaccaccagcacgggaccatgcaaaacmtgcacaac
tcctgctcaaggaacctctatgtttccctcatgctgytgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcrtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggaygatrtkgttttgggggccaagwctgst
caacatcttgagtccctttatgccgctgttaccaattttcttwtgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtmattgggagttggggcactttgccacaagaccatattgtacaaa
aamtcaaactmtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgccccttttactcaatgtggttatcctgctttamtgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggcmataggccatcagcgcttgcgtgggacctttgtg
tcccctctgccgatccatactgcggaactcctrgccgcytgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaaatatacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgyctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB642094_P_P-B Feature FT:CDS AB642094_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT1999-2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcccgctaggttttatcccaatgttactaaatatttgccattagataaagggatcaaatcttattatc
cagagcatgtagttaatcattacttccagacgagrcattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttcccggatcatcagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagg
gacactcatcctcaggccatgcagtggaactcaaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gttggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacrac
tactgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgcctcaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgacttgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgcgctaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctacgcaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctccactgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcgacgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB642101_P_P-B Feature FT:CDS AB642101_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BFJT2009-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctagggaaccccaatgttagtatcccttggactc
atagggtgggaaactttactgggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttccc
gacattcatttgcaggagaacattgttgatagatgtcagcaatttgtgggaccacttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaaggttaccaaatatttgccactagataaagggataaaaccgtattatc
cagagcatgtagttaatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataagaga
gagtcaacacatagcgcctcattttatgggtcaccatattcttgggaacaagatctacagcatgggaggttcgtattcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctaaatccgcacaaggacaactggccggacgcccacaaggtgggagt
gggagcatttgggccagggttcacccctccccatgggggactggtggggtggagccctcaggctcagggcatactcacat
cggtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcggtggaactccataactttccaccaaactcttcaagatcccaaagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttcgaggggaagcacc
cgtgtgtcctggccaaaattcgcagtcccaaatctccagtcactcactaacctgctgtccaccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttgggtcttctggac
taccacggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacagc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaactaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaagtttgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttgatgcctttatatgcatgtatacaagcgaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatttgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacttcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtwccgtccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB675676_P_P-B Feature FT:CDS AB675676_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 10A37). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccctagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcaaggcatactcacaa
ctgtgccagcaactccacctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaagctcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattaccgcaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggccttcctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctggccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtatcgcccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB713527_P_P-B Feature FT:CDS AB713527_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv30). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttacatactctttggaaggcgggtattttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtccgcca
aacctcgacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggaagcctactcccctctctccacctctaaga
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatccccgagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agattggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcatggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatctaaaccctcataaaacaaa
aagatggggctactcccttaacttcatggggtatgtaattggaagttggggcaccttgccccaggaacatattgtgttga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtctttta
ggatttgctgctcctttcacacaatgtggttatcctgctttgatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggac
tgacaattcccttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaacgtgtgcacttcgcttcacttctgcacgtcgcaaggagaacaccgtga
>gnl|hbvcds|AB713528_P_P-B Feature FT:CDS AB713528_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv44). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctatctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacatcgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagact
aaaattgatcatgcctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcacgtagttaatcattacttccagacgagacactatttacatactctttggaaggcgggtattttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagc
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaatctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaaga
gacactcatcctcaggccatgcagtggaactcccccaagttccaccaaactcttcaagatccccgagtcagggctctgta
cttccctgctggtggctccagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaacctatggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaatcctcataaaacaag
aagatggggctactcccttaactttatggggtatgtaattggaagttggggcaccttaccccaggaacatattgtgttga
aaatcaaacaatgttttaggaaacttcctgtaaatcggcctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctctaatgcctttatatgcatgtatacaagctaaacaggcttt
ttctttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgcgcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcagaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattctgtcgttctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctccaggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB713529_P_P-B Feature FT:CDS AB713529_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv68). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacatcattaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttacataccctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctagacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccaacagctcctcctcctgccttccacaatcggcagttaggaaggaagcctactcccctgtctccacctctaaga
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaaatcttcaagaccccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaaactctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcagaaaacaaa
aagatggggctactcccttaacttcatggggtatgtaattggaagttggggcaccttaccccaagaacatattgtgttga
aaatcaaacaatgttttaagaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgcggttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttttcgccaacgtataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgataattctgtcgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcgggactcccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcaaggagaccaccgtga
>gnl|hbvcds|AB713530_P_P-B Feature FT:CDS AB713530_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv94). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccctggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacatcattaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttacataccctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctagacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccaacagctcctcctcctgcctccaccaatcggcagttatgaaggaagcctactcccctgtctccacctctaaga
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaaatcttcaagaccccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaaactctatgtttccctcatggtgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctctgggctcagtttactagtgccattt
gttcagtggttcgtagggctttccccccctgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcagaaaacaaa
aagatggggctactcccttaacttcatggggtatgtaattggaagttggggcaccttaccccaagaacatattgtgttga
aaatcaaacaatgttttaagaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgcggttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttttcgccaacgtataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgataattctgtcgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcagggaaaccaccgtga
>gnl|hbvcds|AB713531_P_P-B Feature FT:CDS AB713531_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv98). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacatcattaataggtgtgaacaatttgtgggacccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctagattctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtattttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggcgggacgccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggaagcctactcccctgtctccacctctaaga
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatccccgagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggaagacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggcttgcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggctactcccttaacttcatggggtatgtaattggaagttggggcaccttaccccaggaacatattgtgttga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctctgatgcctttatatgcatgtatacaagcgaaacaggcttt
cactttctcgccaacttataaggcctttctaaacaaacaatatctaaacctttaccccgttgcgcggcaacggtcaggtc
tatgccaagtgtttgctgacgcaacccccactggctggggcttggccataggtcatcagcgcatgcgtgggacctttgtg
tctcctctgccgattcatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattccgttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgcggtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB713532_P_P-B Feature FT:CDS AB713532_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate YOGHhbv132). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttacatactctttggaaggcgggtattttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtccgcca
aacctcgacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacca
ctgtgccagcagctcctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctctctccacctctaaga
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatccccgagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agattggggaccctgtgccgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatccggctgctatggcccaacttcttgtgggttcttctggac
aaataaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcatggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatctaaaccctcataaaacaaa
aagatggggctactcccttaacttcatggggtatgtaattggaagttggggcaccttgccccaggaacatattgtgttga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtctttta
ggatttgctgctcctttcacacaatgtggttatcctgctttgatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttattgggac
tgacaattccgttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB828708_P_P-B Feature FT:CDS AB828708_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HB12-0626). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcrccgcgtcgcagaagatctcaatctcgggactctcaatgttagcatcccttggactc
ataaggtgggaaattttacggggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaagacattgttgatagatgtacgcaatttgtgggaccccttacagtaaatgaaaaaaggagact
taaattgataatgcctgctagattttatcctaakgttaccaaatatttgcccttagataaaggaatcaaaccttattatc
cagaacatgtagttaatcattacttccagacaagacattatttacatactctttggaaggcgggcatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcataatcacat
cggtgccagctgctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccgtgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccacatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcctgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccaytgtctggctttcagttatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatytaaaccctcacaaaacaaa
aagatggggatactcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaactatgttttaggaaacttcctgtaaataggcctattgattggaaagtatgtcaacgaattgtgggtctttkg
gggtttgctgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttataaagcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctcgccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB900095_P_P-B Feature FT:CDS AB900095_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactc
acaaggtgggaaactttacggggctttattcttctacagtacctgtctttaatccggaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaaggaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagaacatgtagttaatcattacttccaaacgagacattatttgcatactctttggaaggcaggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggagcaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaagacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtaccagctgctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctgcagtcacttaccaacctcttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcccttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtg
caacatcttgagtccctttatgccgctgttaccaattttctgttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacacaatgtggatatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctttcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB900096_P_P-B Feature FT:CDS AB900096_P_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgtcagtatcccttggactc
ataaggtgggaaacttcacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggacccctcacagtaaatgagaacaggagact
aaaattaataatgcctgccagattttatcctaatgctaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttgatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggacccagca
ttcaaagccaactcagaaaatccagattgggacctcaatccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcataaccacat
ctctgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
cctccctgctggtggctccagttcaggaacagtaaaccctgctcagactactgtctcagccatatcgtcaatctcatcga
agactggggaccctgtgacgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttccagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcccctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggcaactctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagaccctttatgccgctgttaccaattttcttttgtctttgggcatacatttaaaccctcacaaaacaaa
aagatggggatactcccttaacttcatgggatatgtaattgggagttggggtacattgccacaagaacatattgtacaaa
aactcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcagagaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
cactttctcgccaacttacaaggcctttctaagtaaacagtatttgtccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctatcgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcacatggcgaccaccgtga
>gnl|hbvcds|AB900097_P_P-B Feature FT:CDS AB900097_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgccgacgcaggtctcaatcgccgcgtcgcagaagatctcaatctagggaaccccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatccggaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcagtttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttccccttagataaagggatcaaaccctattatc
cagagcatgtagttaatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggcccgtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcagrctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccttatctccacctctgagg
gacackcatcctcaggccatgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtatctgccatatcgtcaatcttatcsa
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttccagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggctcttctggac
tatcaaggtatgttgcccgtttgtccyctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctwtgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttatgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatactcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aamtcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaaagaattgtgggtctattg
gggtttgctgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgtttcgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcttttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcgtttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB900098_P_P-B Feature FT:CDS AB900098_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctacagtacctgtctttaaccctgaatggcaaactccttcttttcca
gacattcatttgcaggaggatattgttgatagatgtaagcaatttgtgggaccccttactgtaaatgaaaacagaagact
aaaattaattatgcctgccagattttatcctaaagttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataagaga
gagtcaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctatctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcgcac
atgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggcttcagttcaggaacagtcagccctgctcagaatactgtctctaccatatcgtcaatctcatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgygttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacagc
tcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggcatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattggaagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactatgttttagaaaacttcctgtaaataggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacacaatgtggctatcctgctttaatgcctttatatgcatgtatacaagcaaaacgggcttt
tactttctcgccaacttacaaggcctttctgagcaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtgggacttttgtg
tcccctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaacctcatcgggac
tgacaattctgtcgtgctctcccgcaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB900102_P_P-B Feature FT:CDS AB900102_P_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcctaatgttggtattccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcagactccttcttttcca
gacattcatttgaaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagcaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaattggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcaactcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtrccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttccagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattggggkccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacraa
aagatggggatactcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaattatgttttaggaaacttcctgtmaataggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctacgtaaccagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB900103_P_P-B Feature FT:CDS AB900103_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttaatatcccttggactc
ataaggtgggaaactttacggggctatattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgaaggaggatattgttgatagatgtgagcaatttgtgggtccccttacagtaaatgaaaaaaggagatt
taaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagtcaatcattacttccagacaagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaattcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ckgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactcgaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacaac
cgtgtgtcttggccaaaattcgcagtcccaaatctgcagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcccctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcacaaaacmaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaacaatgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgcattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttataaggcctttctgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaactctgtcgtgctctcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB900104_P_P-B Feature FT:CDS AB900104_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcytctacagtacctatctttaatcctgaatggcaaactccttcttttcca
gacattcatttacaggaggacattgttgatagatgtgagcaatttgtgggaccccttacagtaaatgaaaaaaggagact
aaaattaataatgcctgctagattttatcctaaggttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcaggtagttaatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatggggggttggtcttcca
aacctcgaaaaggcatggggacaaacctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcaaggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaacctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccgcaggaacatattgtacaaa
aaatcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtctttta
gggtttgctgccccttttacacaatgtggatatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttttcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacctcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB900105_P_P-B Feature FT:CDS AB900105_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctgtctttaatcctgaatggcaaactccctcttttcca
gacattcatttgcaggaagacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gaatcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggaat
aggagcattcggacccgggttcacccctccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagg
gacacccatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcagaaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
cgactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtgccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatc
rctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggatcatattgtacaaa
aaatcaaactatgttttagaaaacttcctgtaaacaggcctattgattggaaagtttgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgcatacaagcaaaacaggcttt
tactttttcgccaacttacaaggcctttctaagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tccccgctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacagcatttccatggctgctagggtgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB900106_P_P-B Feature FT:CDS AB900106_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttacaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaacgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttgcatactctgtggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttaactccaccgctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgttttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatctgcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcctcaaccaccagcacgggaccatgcaagacctgcacagc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aaggtggggatattcccttaacttcatgggatatgtgattgggagttggggcgcattgccacaggaacatattgtacaaa
aaatcaaactatgttttagaaaacttcctgtaaacaggcctattgattggaaagtttgtcaaagaattgtgggtcttttg
gggtttgctgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccg
cttctccgtctgccgttccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB900107_P_P-B Feature FT:CDS AB900107_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttccc
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaaggtatcaaaccttattatc
cggagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcaggtatcttatataaaaga
gagtcaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcaccagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccaaaaggtgggagt
gggagcattcgggccagggttcactcccccccatgggggactgttggggtggagccctcaggcccagggcatactcacaa
ctgtgccagcagctccacctcctgcctccaccaatcggcagtcaggaaggcagcctactcccctatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctaacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtccccaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttctttgttctttgggtatacatataaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtcattgggagttgggggacattgccacaagaacatattgttcaaa
aaatcaagtcatgttttcggaaacttcctgtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctcagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtacacctcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtagcatggagaccaccgtga
>gnl|hbvcds|AB900108_P_P-B Feature FT:CDS AB900108_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttrttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccgatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggaaaactccgtcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaaggttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagaatgtagttaatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgaccatcagttggacccagca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccagacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggaaccctcaggctcagggcatactcacat
ctgtgccagcagcgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttgtctccacctctaagg
gacactcatcctcaagccatgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagcaagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacaac
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggagttggggcacattaccacaggaacatattatacaaa
agatcaaattatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggcacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgtttggggctctaccgcccg
cttctccgcctgccgtaccgaccgaccacggggcgcacctctctttacgcggcctccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AB900110_P_P-B Feature FT:CDS AB900110_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaattttacgggactttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
aacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaaaggtaccaaatatttgcccttagagaaagggatcaaaccgtattatc
cagagcatgttgttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcttcattttgcgggtcgccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactccgaaaatccagattgggacctcaacccgcacaaggacaactggcaggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccacgggggactgttggggtggagccctcacgctcagggtctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaaggaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacc
cgtgtgtcctggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtatctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcagcggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacctcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB900111_P_P-B Feature FT:CDS AB900111_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2535 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggatcgatcccaatgttagtatcccttgga
ctcacaaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttctttt
ccagacattcatttgcaggaggatattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggag
actaaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttatt
atccagagcatgtggttaatcattacttccagacaagacattatttgcatactctttggaaggcgggtatcttatataaa
agagagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtctt
ccaaacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccct
gcattcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtggg
agtgggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactca
catctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctcta
agggacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctct
gtactttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatctcat
cgacgactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcgggg
tttttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaac
acccgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggtt
atcgctggatgtttctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctg
gactatcaaggtatgttgcccgtttgtcctctaattccaggatcatcraccaccagcacgggaccatgcaagacctgcac
aactcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattccca
tcccatcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcca
tttgttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagact
gtacaccatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcacaaaac
aaaaagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtac
aaaaaatcaaactatgttttagaaaacttcctgtaaacaggcctattgattggaaggtatgtcaacgaattgtgggtctt
ttggggtttgctgccccttttacgcaatgtggatatcctgctttaaagcctttatatgcatgtatacaagccaaacaggc
ttttactttctcgccaacttataaggcctttctacgtcaacagtatctgaccctttaccccgttgctcggcaacggcctg
gtctgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaaccttt
gtgtctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggrgcaaaactcatcgg
gactgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgc
gcgggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgc
ccgcttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtct
gccggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB900112_P_P-B Feature FT:CDS AB900112_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacggggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccgtggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
aacattcatttgcaggaagacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaacctgtctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccttatctccacctctaagg
gacacgcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtmtcagccayatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttggktctttgggtatacatttaaaccctcacaaaacaaa
aaggtggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactatgttttagraaacttcctgtaaacaggcctattgattggaaagtatgtcaacggattgtgggtcttttg
gggtttgctgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcayctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcgtggagaccaccgtga
>gnl|hbvcds|AB931168_P_P-B Feature FT:CDS AB931168_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1P_HB11-1417). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaaggaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattactttcagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaacctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgaagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtatcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttctctaggggtaccacc
cgtgtgtcctggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttctatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcccctgattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aaggtggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacgaa
aaatcaaactatgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgcatagtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttt
tactttctcgccaacttacaaggcctttctcagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacgtcctttccatggctgctaggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccg
cttctccgcctgccgttccgacctaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB931169_P_P-B Feature FT:CDS AB931169_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1S_HB11-1418). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatcccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaaggaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattactttcagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaacctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgaagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtatcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttctctaggggtaccacc
cgtgtgtcctggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcccctgattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaaatctgtg
caacatcttgagtccctttatgccgctgttaccaattttctgttgtctttgggtattcatttaaaccctcacaaaacaaa
aaggtggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgcctcaggaacatattgtacaaa
aaatcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaaagcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacgtcctttccatggctgctaggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccg
cttctccgcctgccgttccgacctaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AB976562_P_P-B Feature FT:CDS AB976562_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate AK8). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaacgaggcagggcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacatcgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaccaggagact
aaaattgatcatgcctgctaggttctatcctagggttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagactagacattatttacatactctttggaaggcgggtattttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggctgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggaagcctactcccctgtctccacctctaaga
gacactcatcctcaggccatgcagtggaattccaccacgttccaccaaactcttcaagatcctcgagtcagggctctgta
ctttcctgctggtggctccagttcaggaactgtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccggtgttacccattttcttttgtctttgggtatacatttaaatcctcataaaacaaa
aagatggggctactcccttaacttcatggggtatgtaattggaggttggggcaccttaccccaagaacatattgtgttga
aaatcaaacaatgttttagaaaaattcctgtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttataaggcctttctgaacaaacagtatctgaacctttaccccgttgcacggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggtcataggccatcagcgcatgcgtggaacctttggg
tctcctctgccgatccatactgcggaactcctagccgcctgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtatcgacctaccacggggcgaacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF100308_P_P-B Feature FT:CDS AF100308_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
taaattaactatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagtaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcacgctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatattctgctttaatgcctttatatgcatgcatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatgtgaacctttaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccataccgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccgaccgtccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF100309_P_P-B Feature FT:CDS AF100309_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctactgtaccttgctttaatcctaaagggcaaactccttcttttcct
gatattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttgatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccggggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccaacagcgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccgtgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctctgaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
acgatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtctattg
gggtttgccgccccttttacacaatgtggatatcctgctctaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggcgataggccatcagcgcatgcgtgggacctttctg
tctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtactctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctaccgcccg
cttctccgcctgttctaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF121243_P_P-B Feature FT:CDS AF121243_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/14611). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccatattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttgggaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttttaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtactctcccgcaagtatacagcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaraccaccgtga
>gnl|hbvcds|AF121244_P_P-B Feature FT:CDS AF121244_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/15122). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccatattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttgggaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttttaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtactctcccgcaagtatacagcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaraccaccgtga
>gnl|hbvcds|AF121245_P_P-B Feature FT:CDS AF121245_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/16091). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccatattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttgggaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttttaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtactctcccgcaagtatacagcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaraccaccgtga
>gnl|hbvcds|AF121246_P_P-B Feature FT:CDS AF121246_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/IK29902). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccatattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttgggaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttttaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtactctcccgcaagtatacagcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctgtaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaraccaccgtga
>gnl|hbvcds|AF121247_P_P-B Feature FT:CDS AF121247_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/719). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacattctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagacaatccagattgggacctcaacccgcacaaggacaactggccgaacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccacatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttgactccacctctaagg
gatactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacrrc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgyaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaagcttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgcccctttcacdcaatgtggatatcctgctttaatgcctctctatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttttacgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctcttgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF121248_P_P-B Feature FT:CDS AF121248_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/139-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctaaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagacaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttgtctccacctctaagg
gatactcatcctcaggccatgaagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaagcttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacacaatgtggatatcctgctttaatgcctctctatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctacgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF121249_P_P-B Feature FT:CDS AF121249_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/4014). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagacaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttgtctccacctctaagg
gatactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaagcttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctctctatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctacgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF121250_P_P-B Feature FT:CDS AF121250_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/6395). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctcaatggcaaacaccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcaaacaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttgtctccacctctaagg
gatactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtaccgaacatggagaacatcgcatcaagactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaagcttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctctctatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctacgtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF121251_P_P-B Feature FT:CDS AF121251_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV/9873). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtcagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatcttgctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagacaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccagtcggcagtcaggaaggcagcctactcccttgtctccacctctaagg
gatactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcga
agactggggaccctgtaccgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggcaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcactaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgtcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtg
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaagcttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctctctatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttttacgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF282917_P_P-B Feature FT:CDS AF282917_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaagacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcagtctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacgaccagcactggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggcatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgttcggcaacggcctggtc
tgtgccaagtgtttcgtgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaacttctagcagcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttcccggggccgcttggggctctaccgcccg
cttctccgcctcttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF282918_P_P-B Feature FT:CDS AF282918_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-B2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcacgctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctatgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtaagaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtacatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttcgtgacgcaacccccactggttggggcttgcctataggccatcagcgcatgcgtggaacctttgtt
gctcttctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctcttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF461360_P_P-B Feature FT:CDS AF461360_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FH14-2). Complete genome. [Hepadnaviridae] (length=2511 residues).
atgcccctatcttatcaacgcttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgaaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaacgaaaacaggagact
taaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacaaacctcgaaaaggcatgggga
caaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactcagaaaat
cccgattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggccagggtt
cacccctccccatgggggactgttggggtggaaccctcaggctcagggcatactcacaactgtgccagcagctcctcctc
ctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagggacactcatcctcaggtcatg
cagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggccctgtactttcctgctggtggctccag
ttcagaaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgacgactggggaccctgtaccga
acatggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggtttttctcgttgacaaaaatcctc
acaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacccgtgtgtcttggccaaaattc
gcagtcccaaatctccagtcactcaccaacttgttgtcctccaatctgtcctggttatcgctggatgtgtctgcggcgtt
ttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttgcccgtt
tgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctat
gtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaa
aatacctatgggagtgggcctcagtccgtttctcttggctcagttcactagtgccatttgttcagtggttcgtagggctt
tcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtacaacatcttgagtccctttat
gccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaa
cttcatgggatatgtaattgggggttggggaacattgccacaggaacatattgtacacaaaatcaaaatgtgttttagga
aacttcctgtgaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcaca
caatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttactttctctccaacttacaa
ggcctttctacgtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgacg
caacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatccatact
gcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggactgacaattctgtcgtgctctc
ccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctgtcgttccga
ccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttc
acctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AF479684_P_P-B Feature FT:CDS AF479684_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 3c). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacggagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtgaatgaaaataggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattactttcagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaggccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggatgccaacaaggtgggagt
gggagcattcgggccagggttcaccccttcccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtgggtatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcaccaacttacaaggcctttttaagtaaacagtgtctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctataccgcccg
cttctccgcctattgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AJ627225_P_P-B Feature FT:CDS AJ627225_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 19749). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgcttcaatcctaaatggcaaactccttcttttcct
aacattcatttgcaggaggacattgttgatagatgtaatcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtaattaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattggaacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccaggrttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatacttgcaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaagccatgcagtggaactccaccaccttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagacttgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagc
tcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacactgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcagcgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtc
tctccgctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtcctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccggccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011084_P_P-B Feature FT:CDS AP011084_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatctgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaagaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gttggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcacgggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggtccgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaaggaaacagtatctgaccctttaccccgttgctcggcaacggtctggac
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacagcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgattggggctctaccgccca
cttctccgcctggtgtaccaaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011085_P_P-B Feature FT:CDS AP011085_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctcaatggcaaactccttcctttcct
gacattcatttgcaggaggacatcattaataggtgtaaacaatttgtgggaccccttacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcccaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccaacagctcctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaaga
gacactcatcctcaggcaatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcattttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcagaaaacaaa
aagatggggctactcccttaacttcatggggtatgtaattggaagttggggcaccttaccccaagaacatattgtgttga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttttcgccaacgtataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaacttatcgggac
tgacaattctgtcgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011086_P_P-B Feature FT:CDS AP011086_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataasgtgggaaactttacggggctttattcttctacggtacctggctttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaggatattgttgataggtgtaaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttctatcctaatgttaccaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattactttcagacaagacattatttacatacgctttggaaggcgggtattttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aaccccgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggctgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggccgcctactcccctgtctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaacactgcatcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctatgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatatttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatctaaaccctcataaaacaaa
aagatggggctattcccttaacttcatgggatatgtaattggaagttggggcaccttaccccaagaacatattgtgttga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgcggctcctttcacacaatgtggttatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcaccaacttacaaggcctttctcaatcaacagtatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggcaataggccatcagcgcatgcgcggaacctttgtg
tctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaactcatcgggac
agacaattctgtcgtcctgtcccgtaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011087_P_P-B Feature FT:CDS AP011087_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctggctttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaggatattgttgataggtgtaaacaatttgtgggacccctcacagttaatgaaaacaggagact
aaaattgatcatgcctgctaggttctatcctaatgttaccaaatatttgcctttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattactttcagacaagacattatttacatactctttggaaggcgggtattttatataaaaga
gagacaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aaccccgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgactgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggctgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggccgcctactcccctgtctccacctctaagg
gacactcatcctcaggccatgcagtggaattccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaacactgcatcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggctatc
gctggatgtgtctgcggcgttttatcatcttcctatgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatctaaaccctcataaaacaaa
aagatggggctattcccttaacttcatgggatatataattggaagttggggcaccttaccccaggaacatattgtgttga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctctaatgcctttatatgcatgtatacaagcaaaacaggcgtt
tactttctcgccaacttacaaggcctttctcaatcaacagtatctgaacctttaccccgttgctcggcaacggccaggtc
tatgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcctgttttgctcgcagccggtctggagcgaaacttatcgggac
cgacaattctgtcgtcctgtcccgtaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011088_P_P-B Feature FT:CDS AP011088_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaataggtgtaaacaattcgtgggacccctcacagtgaatgaaaataggagact
aaaattgatcatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtggttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggacctcca
aacctcgacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacctacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactcccccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggaagcctactcccctgtctccacctctaaga
gacactcaccctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaatcctcataaaacaaa
acgatggggttactcccttaacttcatggggtatgtaattggaagttggggtaccttaccccaggaacatattgtgttca
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctctaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgcgaggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccattctgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattctgttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttatctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011089_P_P-B Feature FT:CDS AP011089_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctaactttaatcctrattggcaaaccccttcttttcct
gatattcatttgcaggaggacattgttgataggtgcaaacaatttgtgggacccctcacagtgaatgaaaacaggagact
aaaattgatcatgcctgctaggttttatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaaga
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaggatcccagagtcagggctctgta
ttttcctgctggtggctccagttcaggaacagtgaaccctgttcagagcactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggctactcccttcacttcatggggtatgtgattggaagttggggcaccttaccccaggaacatattgtgttga
aactcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgacttgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattctgtcgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccatccacggggcgcacctctctttacgcggactccccgtctgtgccttctcacctgcc
gggccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011090_P_P-B Feature FT:CDS AP011090_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttactcttctacggtacctagctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacatcgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaataggagact
aaaattgatcatgcctgctaggttttatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtggttaatcattacttccagacgagacattatttacatactctttggaaggcaggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccttattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactcccccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctctaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaaga
gacactcaccctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
cttccctgctggtggctccagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctctgggtatacatttaaaccctcataaaacaaa
acgatggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccccaagaacatattgcgttga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctctaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgcgcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattctgttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011091_P_P-B Feature FT:CDS AP011091_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacatcgttaataggtgtaaacaatttgtgggacccctcacagtgaatgaaaataggagact
aaaattgatcatgcctgctaggttttatcctaatgttactaaatatttgcccttggataaaggaattaaaccttattatc
cagagcatgtggttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactcccccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctctaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaaga
gacactcaccctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
cttccctgctggtggctccagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctctgggtatacatttaaaccctcataaaacaaa
acgatggggctactcccttaacttcatggggtatgtaattggaagttggggtwccttaccccaagaacatattacgttga
aaatcamacaatgttttaggaaacttcctgtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctctaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttataaggcctttctgaacaaacaatatctgaacctttaccccgttgcgcggcaacggccgggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattctgttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011092_P_P-B Feature FT:CDS AP011092_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacatcgttgataggtgtaaacaatttgtgggacccctcacagtgaatgaaaataggagact
aaaattgatcatgcctgctaggttttatcccaatgttactaaatatttgccattagataaaggaattaaaccttattatc
cagagcatgtggttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgacaaggcatggggacaaatctttcagtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactcccccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccgcctctaaga
gacactcaccctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcctgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
acgatggggctactcccttaacttcatggggtatgtaattggaagttggggtaccttaccccaggaacatattgtgttga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctctagtgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgcgcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttctcgggac
tgacaattctgttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacatcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011093_P_P-B Feature FT:CDS AP011093_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctggctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaatagatgtaaacaatttgtgggaccccttaccgtgaatgaaaacaggagact
aaaactgatcatgcctgctagattctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
ccgagcatgtagttaatcattacttccagacgaggcattatttacatactctttggaaggcgggcatcttatataaaaga
gagacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aaactcgaaaaggcatggggaaaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggatcctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaa
ctgtgccaacagctcctcctcctgcctccaccaatcggcagtcaggaaggaagcctactcccctgtctccacctctaaga
gattctcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatctcatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
attcagtggttcgtagggctttcccccactgtctggctttcagttctatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggctactcccttaacttcatgggatatgtaattggaagttggggcaccttgccccaggagcatattgtgttaa
aaatcaaacaatgctttaggaaacttcctgtaaacaggcctattgattggaaagtgtgtcaaagaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctttaatgccattatatgcatgtatacaagctaaacaggcttt
tacgttctcgccaacttacaaagcctttctaaacaaacagtatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttggg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttgtcgggac
tgacaattctgtcgtcctttcccgtaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctatcgcccg
cttctccgcctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011094_P_P-B Feature FT:CDS AP011094_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctggctttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaatagatgtgaacaatttgtgggacccctcacagtgaatgaaaaccggagact
aaaattgatcatgcctgctagattctatcctaaagttactaaatatttgcccttagataaaggaattaaaccttattatc
ccgagcatgtagttaatcattacttccagacgaggcattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggatcctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacagctggccggactccaacaaggtgggagt
gggagcattcgggacgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggtatgctcacaa
ctgtgccaacagctcctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccctgtctccacctctaaga
gactctcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatctaaaccctcataaaaccaa
aagatggggctactcccttaacttcatgggatatgtaattggaagttggggcaccttgccccaggaacatattgtgttaa
aaatccaacaatgctttagaaaacttcctgtaaacaggcctatcgattggaaagtgtgtcaaagaattgtgggtctttta
ggatttgctgctcctttcacacaatgtggttatcctgctttaatgccattatatgcgtgtattcaagctaaacaggcttt
tacgttctcgccaacttacaaggcctttctacacaaacagtatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattctgtcgttctttcccgtaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctatcgcccg
cttctccgcctgccataccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011095_P_P-B Feature FT:CDS AP011095_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctggctttaatcctgaatggcaaactccttctttccct
gacattcatttgcaggaggacattgttaatagatgtaaacaatttgtgggacccctcacagtgaatgaaaacaggagact
aaaattgatcatgcctgctagattctatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
ccgagcatgtagttaatcattacttccagacgaggcattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggatcctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacagctggccggactccaacaaggtgggagt
gggagcattcgggacgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaa
ctgtgccaacagctcctcctcctgcctccgccaatcggcagttaggaaggcagcctactcccctgtctccacctctaaga
gactctcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggctactcccttaacttcatgggatatgtaattggaagttggggcaccttgccccaggaacatattgtgttaa
aaatcaaacaatgctttaggaaacttcctgtaaacaggcctattgattggaaagwgtgtcaaagaattgtgggtctttta
ggatttgctgctcctttcacacaatgtggttatcctgctttaatgccattatatgcgtgtatacaagctaaacaggcttt
tacgttctcgccaacttacaaggcctttctaaacaaacagtatctgaccctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcgtgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattctgtcgttctttcccgtaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctatcgcccg
cttctccgcctgccataccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgcctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AP011096_P_P-B Feature FT:CDS AP011096_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctggctttaatcctgactggcaaactccctcttttcct
gacattcatttgcaggaggacattgttgataaatgtaaacaatttgtgggaaccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctagattctatcctaatgttactaaatatttgcccttagataaaggcatwaaaccttattatc
cagagcatgtagttaatcattacttccagacgaggcattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcatcagttggatcctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggacgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaa
ctgtgccaacagctcctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccctgtctccacctctaaga
gactctcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagaccccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgctcagaacactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatctaaaccctcataaaacaaa
aagatggggctactcccttcacttcatgggatatataattggaagttggggcactttgccccaggaacatattgtgtcaa
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaagtgtgtcaaagaattgtgggtctttta
ggatttgctgctcctttcacacaatgtggttatcctgctttactgccattatatgcatgtatacaagctaaacaggcttt
tacgttctcgccaacttacaaagcttttctaaacaaacagtatatgaacctttaccccgttgctcggcaacgaccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattctgtcgtcctgtcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY033072_P_P-B Feature FT:CDS AY033072_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaggacattgctgataggtgtaagcaatttgtgggacccctaacagtaaatgaaaacaggagatt
aaaattaattatgcctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaattaaaccctattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacgacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggacggaaactgcacatgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggagttggggctccttgccacaggaacatattgtacaaa
aaatcaaattatgttttagaaaacttcctgtcaacaggcctattgattggaaagtgtgtcaacgaattgtaggtcttttg
gggttcgctgccccttttacacaatgtggatttcctgctttaatgcctttatatgcatgtattcaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagcaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctccgctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgataattctgtcgtgctctcccgcaagtatacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccggccg
cttctccgtctcccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY033073_P_P-B Feature FT:CDS AY033073_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaggacattgctgataggtgtaagcaatttgtgggacccctaacagtaaatgaaaacaggagatt
aaaattaattatgcctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaattaaaccctattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacgacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgta
ttttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgcctctgccatatcgtcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggacggaaactgcacatgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatagtgatgatatggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggagttggggctccttgccacaggaacatattgtacaaa
aaatcaaattatgttttagaaaacttcctgtcaacaggcctattgattggaaagtgtgtcaacgaattgtaggtcttttg
gggttcgctgccccttttacacaatgtggatttcctgctttaatgcctttatatgcatgtattcaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagcaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctccgctgccgatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgataattctgtcgtgctctcccgcaagtatacgtcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccggccg
cttctccgtctcccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY163869_P_P-B Feature FT:CDS AY163869_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMClx-1). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatgttaatgttagtattccttggacac
ataaggtgggaaactttacggagctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttccc
gacattcatttgcaggaggacattgttgatagatgcaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattagttatgcctgctaggttttatcctaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggacccagca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtccggaaggcagccaactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccacgttccacaaaactcttcaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatc
gctggatgtatctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcatcaacaaccagcacgggaacatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaatttacaaggcctttctacgtcaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtg
tctcctctgccgatccatactgcggaacacctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattccgtcgtgctttcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggtctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY163870_P_P-B Feature FT:CDS AY163870_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate FMU001). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatgttaatgttagtattccttggacac
ataaggtgggaaactttacggagctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttccc
gacattcatttgcaggaggacattgttgatagatgcaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattagttatgcctgctaggttttatcctaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcatcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggacccagca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtccggaaggcagccaactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccacgttccacaaaactcttcaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatc
gctggatgtatctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctgattccaggatcatcaacaaccagcacgggaacatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgaatccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgctgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaatttacaaggcctttctacgtcaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtg
tctcctctgccgatccatactgcggaacacctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattccgtcgtgctttcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggtctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY167089_P_P-B Feature FT:CDS AY167089_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttgtcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgccaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttgcacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgcggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacaatatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatacgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcattgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY167093_P_P-B Feature FT:CDS AY167093_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIa). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaggaaggcgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggacggacgccaacaaggtgggagt
gggagcattcgggccaggggtcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagtagctcctcctcctgcctccaccaaccggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtaccgaatatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgactccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattgccttaactttatgggatatgtaattggaagttggggcacattgccacaggaacatattgtacaaa
aaattaagatgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctacgcacacagtatctgaacctttaccccgttgctcgacaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctccactgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggtctctaccgcccg
cttctccgcctcttgtaccgaccgtcaacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY167094_P_P-B Feature FT:CDS AY167094_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIb). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctnaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgnaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacacgcacaaggacaactggccggacgccaacaaggtgggagc
cggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggnaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacanc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcnccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcattcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctggtgtaccgaccgacaacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaggccaccgtga
>gnl|hbvcds|AY167097_P_P-B Feature FT:CDS AY167097_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IIIb). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctgtctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccgaacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccacttggtggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY167098_P_P-B Feature FT:CDS AY167098_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate IVa). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccgaacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggattgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcga
cgactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccattgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttatctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaagaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttgtatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctccgtacacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY167100_P_P-B Feature FT:CDS AY167100_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Va). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagtatgtagttaatcattacttccagacacgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcctcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacacgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccacatgggggattgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaaga
gacactcatcctcaggccatgcattggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcaggaacagtgagccctgctccgaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgtatcaggactcctaggacccctgctcgcgttacaggcggggttt
ttctcgttgacaaaaatccttacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccatttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaagaacatattgttcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctcagaaatcagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggac
tgacaattctgtcgtactctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY167101_P_P-B Feature FT:CDS AY167101_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vb). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctccatctcggggatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccctgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacactatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaa
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttctctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattggctgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaactccctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacgggcttt
tactttctcgcccacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY167102_P_P-B Feature FT:CDS AY167102_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Vc). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagact
taaattaattatgcctgctaggttttatcccaatgttactaaatatttgcctttagagaaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaaga
gagtccacacgtagcgcctcatttttcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaagnacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcccactcccttatctccacctctaagg
gacactcatccacaggccatacagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcagaaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggaaaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaatacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
gcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
cattatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagccaaaaaggcttt
tactttctcgccaacttacaaggcctttctacgtaaacagtatctggacctttaccccgttgctcggcagcggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctggccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggac
tgacaattctgtcgtactttcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
ctactccgcctattgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY206373_P_P-B Feature FT:CDS AY206373_P_P-B of [Viruses] Hepatitis B Virus genotype B. Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol). [Hepadnaviridae] (length=2505 residues).
aaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcgcctcgcagacgaaggtctcaatcgccg
cgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttggacacataaggtgggaaactttacggggcttt
attcttctacggtaccttgctttaatcctaactggcaaactccttcttttcctgacattcatttgcaggaggacattgtt
gatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagactaaaattgattatgcctgctaggtttta
tcccaatgtcactaaatatttgcccttagataaagggatcaaaccgtattatccagagcatgtagttaatcattacttcc
agacgcgacattatttacacactctttggaaggcgggtatcttatataaaagagagtccacacgtagcgcctcattttgc
gggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttccaaacctcgaaaaggcatggggacaaatc
tttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactcagaaaatccagat
tgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggccagggttcacccc
tccacatgggggactgttggggtggagcccccaggctcagggcctattcacaactgtgccagcagctcctcctcctgcct
ccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagggacactcatcctcaggccgtgcagtgg
aactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccagttcagg
aacagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcgaagactggggaccctgtaccgaacatgg
agaacatcacatcaggactcctaggacccctgctcgtgtcacaggcggggtttttcttgttgacaaaaatcctcacaata
ccacagagtctagactcgtggtggacttctctcaattttctagggggaacacccgtgtgtcttggccaaaattcgcagtc
ccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgttttatca
tcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttgtggactatcaaggtatgttgcccgtttgtcct
ctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaactcctgctcaaggaacctctatgtttcc
ctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaaaatacc
tatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgtagggctttccccc
actgtctggctttcagttatatggatgatgtggttttgggggccaagtctgtacaacatcttgagtctgtttatgccgct
gttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattcccttaacttcat
gggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaatgtgttttcggaaacttc
ctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgcccctttcacgcaatgt
ggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttaccttctcgccaacttacaaggcctt
tctaagtaaacagtacctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgtttgctgacgcaaccc
ccactggttggggcttggccataggccatcagcgcatgcgtgggacctttgtgtctcctctgccgatccatactgcggaa
ctcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggactgacaattctgtcgtgctctcccgaaa
gtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcccgtcgg
cgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttctccgcctcttgtaccgaccgacc
acggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttcacctct
gcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY206375_P_P-B Feature FT:CDS AY206375_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggatattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccctattatc
cagagtatgtagttgatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccggggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgcccgcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccacaactttccaccaaactcttcaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgtgggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaaccgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtcgggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattccctaaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattatacgaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggccgattgattggaaagtatgtcaacgaattgtgggtctcttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tgttttctcgccaacttacaagtcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgcggacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY206383_P_P-B Feature FT:CDS AY206383_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacgcttccggagactactgttgttagagcaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctgaatggcaacctccttcttttcct
gacattcatttgcgggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaaggttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtggttaatcattacttccagacgcgacattatttacacattctttggaaggcagggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacacgatctacagcatgggaggttggacttccc
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtaagagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagcccgcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccctatctccacctctaagg
gacactcatcctcaggccatgcagtggaactcaaccactttccaccacactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggggacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtatctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattccctgaacttcatgggatatgtaattggaagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcctttg
gggtttgccgcccccttcacgcaatgtggttatcctgctttaatgcctttatatgcatgtatacaagcgaaacgggcttt
tactttctcgccaacttacaaggcctttctacgtaaccagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggcacttggccatcagcgcgtgcgtggcacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggac
ggacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcttgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgctgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY206390_P_P-B Feature FT:CDS AY206390_P_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgtcagtattccttggacgc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctacatggcaaacaccttcttttcct
gacattcatttgaaggaggacattgtggatagatgtgagcaatttgtggggccccttacagtaaatgaaaaacgaagact
acaattaatcatgcctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgaggcattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcatttttcgggtcaccatattcttgggaacacgatctacagcatgggaggttggtcctcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgaccatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaaccaggtgggagt
gggagcattcgggccagggttcattccgccccatgggggactgttgggatggagccctcaggctcagggcatacttacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gagactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccaaagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacatgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacgtttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggtactttgccacaggaacatattgtacaaa
aaatcaaattgtgttttaagaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacacaatgtggatatcctgccttaatgcctttatctgcatgtatgcaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacttttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY206391_P_P-B Feature FT:CDS AY206391_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgcttcaatcctaattggcaaactccttcttttcct
aacattcatttgcaggaggacattgttgatagatgtaatcaatttgtggggcccctcacagtaaatgaaaccaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtgtcttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggccttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagagaatccggattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatacttgcaa
cagtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctgagg
gacacgcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ccctcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcga
agactggggaccctgtaccgaacatggagaacatcgcgtcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtatctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctattaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacactgccacaggaacatattgtacaaa
aaatcaaaatgtgttttcggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgccttaaagcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctacgcaaacagtatttgcacctttaccccgtttctcggcaacgggctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcctgttttgctcgcagccggtctggggcaaaactcatcgggac
tgacaattctgtcgtcctctcccgcaagtatacatcatttccatggctgctaggttgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY217355_P_P-B Feature FT:CDS AY217355_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A6-2). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagact
caaattaattatgcctgctagattttttcccaatgttactaaatatttgcccttagataaagggatcaaaccatattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacacctggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccacatgggggactgttggggtggaaccctcaggctcagggcctattcacaa
ccgtgccagcagctcctcctcctgccaccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggtcatgcagtggaactcccccactttccaccaaactcttcaggatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagc
tcctgctcaaggaacctctatgtttccctcatgttgctgtataaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaactaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacacgcgaaacaggcttt
tactttctcgccaacttacaaggcctttctacgtcaacaatatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaaccccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY217356_P_P-B Feature FT:CDS AY217356_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A9-2). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagact
caaattaattatgcctgctagattttttcccaatgttactaaatatttgcccttagataaagggatcaaaccatattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacacctggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccacatgggggactgttggggtggaaccctcaggctcagggcctattcacaa
ccgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactcccccactttccaccaaactcttcaggatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacacgcgaaacaggcttt
tactttctcgccaacttacaaggcctttctacgtcaacaatatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY217357_P_P-B Feature FT:CDS AY217357_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B1r-4). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gaaactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacagc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatgggggtattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtaggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccgacttacaaggcctttctgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY217358_P_P-B Feature FT:CDS AY217358_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate B8r-4). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gaaactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacagc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatgggggtattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtaggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccgacttacaaggcctttctgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY217359_P_P-B Feature FT:CDS AY217359_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Q6-5). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttccg
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaatcaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggattaaaccttattatc
cagagtatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagtgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacctgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttagggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcggggccctgta
ttttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgcttgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgctgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgttcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
aagatggggagattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaactgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttcttagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY217360_P_P-B Feature FT:CDS AY217360_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6-4). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcatcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttccg
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaatcaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggattaaaccttattatc
cagagtatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagtgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacctgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ttttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgctgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcacggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaactgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttcttagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY217361_P_P-B Feature FT:CDS AY217361_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 582-2). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctcaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggcccctgacagtaaatgaaaaaaggagact
aaaattgattatgcctgctaggttttatcccaatggtactaaatatttgcccttagataaagggatcaaaccctattatc
cagagcatgtagttaatcattactcccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaacctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggatctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagccttcgggccagggttcacccctccccatgggggactgttgggttggagccctcaagctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatacagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttaagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctacgtcaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcctgcggggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY217362_P_P-B Feature FT:CDS AY217362_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 582-4). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacgcttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttgggcac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctcaatggcaaactccttcttttcct
aacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagact
aaaattgattatgcctgctaggttttatcccaatggtactaaatatttgcccttagataaagggatcaagccctattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggacccagca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatacttacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactctgcaagatcccagagtcagggccctgta
cgttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacagc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctgcgtcaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcggggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtactctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY217368_P_P-B Feature FT:CDS AY217368_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 21949). Partial genome (Contains: HBx, LHBs, MHBs, SHBs, Pol, HBSP). [Hepadnaviridae] (length=2511 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaagacattgttgataggtgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtactatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaaaaggcatgggga
caaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcattcaaagccaactcagaaaat
ccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagtgggagcattcgggccagggtt
cacccctcctcatgggggactgttggggtggagccctcacgctcagggcctactcacaactgtgccagcagcttctcctc
ctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagggacactcatcctcaggccatg
cagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtggctccag
ttcaggaacagtgagccctgctcagaatattgtctcggccatatcgtcaatcttatcgaagactggggaccctgtaccga
acatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttctcgttgacaaaaatcctc
acaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacccgtgtgtcttggccaaaattc
gcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgctggatgtgtctgcggcgtt
ttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaagctatgttgcccgtt
tgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgactcctgctcaaggaacctctat
gtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctttcgcaa
aattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccatttgttcagtggttcgtagggctt
tcccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgtacaacatcttgagtccctttat
accgctgttaccaattttcttttttctttgggcatacatttaaaccctcacaaaacaaaaagatggggatattcccttaa
cttcatgggatatgtgattgggagttggggcacattgccacaggaacatattgtacataaaatcaaaatgtgttttagga
aacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgccgccccttttacg
caatgtggctatcctgcgttgatgcctttatatgcatgtatacaagcaaaacaggcttttactttctcgccaacttacaa
ggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgtgccaagtgtttgctgatg
caacccccactggttggggcttggccataggccatcagcgcatgcgtggaaactttgtgtctcctctgccgatccatact
gcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacctcattgggactgacaattctgtcgtgctctc
ccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtttacgtcc
cgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccgcttctccgcctgttctaccga
ccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcacttcgcttc
acctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY220697_P_P-B Feature FT:CDS AY220697_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggacac
acaaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagact
taaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttgatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgtacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttgggttggagccctcaggctcagggtctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatacagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttaccggcggggttt
tccttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcgtggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatttggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tattttctcgccaacttacaaggcctttctgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY220698_P_P-B Feature FT:CDS AY220698_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
acaaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
taaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagttaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcaaaatactgtctctgccatatcgtcaatcttatcga
aaactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtatctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatttggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaactttatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatatgttttaggaaacttcctgtaaacaggcctattgattggaaagtctgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tattttctcgccaacttacaaggcctttctgagtaaacagtatttgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggcacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY220703_P_P-B Feature FT:CDS AY220703_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgttttaatcctaactggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacaataaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctatctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggaagccaacaaggtgggagt
gggaacattcgggccagggttcacccctccccatggggggctgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gagactcatcctcaggccatgaagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcagaaatagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggcatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaagaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccacgggttggggcttggccattggccatcagcgcatgcgtgggacctttgtg
tcaccactgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcggaac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY220704_P_P-B Feature FT:CDS AY220704_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgttttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaagcggggatcttatataaaaga
gagtccactcgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatggggggctgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgaagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcagaaatagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatcgatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaagaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY293309_P_P-B Feature FT:CDS AY293309_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaagg
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacacctggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttgaggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggat
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgtccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY518556_P_P-B Feature FT:CDS AY518556_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 57-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggaagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agattggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
gcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtgtgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaagctcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY596102_P_P-B Feature FT:CDS AY596102_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaa
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcgggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcacggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgttggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY596103_P_P-B Feature FT:CDS AY596103_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcaactcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgcgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtacacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY596104_P_P-B Feature FT:CDS AY596104_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-4). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacacgcacaaggacaactggccggacgccaacaaggtgggagc
cggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatctccttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcattcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctggtgtaccgaccgacaacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaagccaccgtga
>gnl|hbvcds|AY596105_P_P-B Feature FT:CDS AY596105_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-5). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcaggccagggttcacccctccccatgggggattgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaagaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctccgtacacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY596106_P_P-B Feature FT:CDS AY596106_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-6). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatccacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctctattcttctacggcaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttaccccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtcgcgcctcattatgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcaa
aacctcgaaaaggcatggtgacaaatctttctgtccgcaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacgaa
aagatggggatattcccttaacttcatgggatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggatttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggcacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatcttcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY596109_P_P-B Feature FT:CDS AY596109_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate II-1). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttgtcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcttaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggcaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgccaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttgcacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
ttctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattggatgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgcggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacaatatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatacgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgtttgttttgctcgcagcaggtctggggcaaaactcattgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY596110_P_P-B Feature FT:CDS AY596110_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate II-2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgaccaccagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggactccaacaaggtgggaat
aggagcattcgggccagggttcgtccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcaacctactcccatatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttcatttcatgggatatgtaattgggagttggggcacattgcctcaggaacatattgtacaaa
aaatcaaaacgtgttttagaaaacttcctgtaaataggcctattgattggaaagtatgtcaacgacttgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctctaatgcctttatatgcatgtattcaagcaaaacaggcttt
tactttctcaccaacttacaaggcctttctacgtcaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcagggaacctttgtg
tctcctctaccgatccatactgcggaactcctagccgcttgctttgcccgcagccggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgacctaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY596111_P_P-B Feature FT:CDS AY596111_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-3). Non-functional genomic sequence. [Hepadnaviridae] (length=2529 residues).
atgcccctatcttatcaacacttccggaaactgctgttattagacaacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcct
gacattcacttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagctctcagactcagggcctactcacaa
ctggagcagctcctcctcctgccttcaccaaccgggagtaaggaaggcagcctactcccttaactccacctctaagggac
actcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgtactt
tcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcgaaga
ctggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggtttttc
tcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggaaacacccgt
gtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatcgct
ggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactat
caaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaacttc
tgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccat
catcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgtt
cagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgtacag
catcttgagtccctttatgccgctgttaccaattttcttttgtctttgggcatacatttaaaccctcacaaaacaaaaag
atggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccgcaagaacatattgtacaaaaaa
tcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttgggg
tttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttttac
tttctcgccaacttacaaggcctttctaagtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtctgt
gccaagtgtttgcggatgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtct
cctctgccgatccatactgcggaactcctagccgtttgttttgctcgcagcaggtctggggcaaaactcatcgggactga
caattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcggga
cgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggcctctaccgcccgctt
ctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccgga
ccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY596112_P_P-B Feature FT:CDS AY596112_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Ia-7). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtatcccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggacggacgccaacaaggtgggagt
gggagcattcgggccaggggtcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaaccggcagtcaggaaggcaacctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttcatttcatgggatatgtaattgggagttggggcacattgcctcaggaacatattgtacaaa
aaatcaaaacgtgttttaaaaaacttcctgtaaataggcctattgattggaaagtatgtcaacgacttgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctctaatgcctttatatgcatgtattcaagcaaaacaggcttt
tactttctcaccaacttacaaggcctttctacgtcaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcggggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgctttgcccgcagccggtctggggcaaagctcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgacctaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY766463_P_P-B Feature FT:CDS AY766463_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
cacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaagttaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaggggatcaaaccatattatc
cagagcatgtagttaatcattacttccagacaagacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcaaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcgggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggcactata
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctccaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcaccttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccaccgtctggctttcagttatatggatgatgtggttttggggaccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaggtaaacagtatatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcagcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccaaccgaccacggggcgcacctctccttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY800389_P_P-B Feature FT:CDS AY800389_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041024). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacccttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcgggaatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccccgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
agtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatattgatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttcacttcatgggatatgtaattgggggttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgtgtgcaaggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggacgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|AY800391_P_P-B Feature FT:CDS AY800391_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041026). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgc
ataaggtgggaaattttacggggctttattcttctacggtacctggctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcatgaggacattattaataggtgtaaacaatttgtgggacccctcacagtaaatgaaaccaggagact
gaaattgattatgcctgctaggttctatcctaatgttactaaatatctgcccttagataaaggaattaaaccttattatc
cagaacacgtagttaatcattacttccagacgagacattatttacataccctttggaaggcggggatattatataaaaga
gagacaacacatagcgcctcatttttcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaa
aacctcgaaaaggcatggggacgaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggatctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccacgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagctgcgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccctgactccgcctctaaga
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagggtcagggctctgta
ctttcctgctggtggctccagttcaggaactgtgaaccctgttcagagcactgcctcttccaaatcgtcaatctcatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcatggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
gcctgctcaaggaaactctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacaccttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcctcataaaacaaa
aagatggggctactcccttaacttcatgggatatgtgattggcagttggggcaccttaccccaagaacatattgtgttga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttg
gggtttgctgctcctttcacacaatgtggttatcctgctttaatgcctttatatgcatgtattcaagcgaaacaggcttt
cactttctcgccaacttacaaggcctttctatacaaacagtatgtgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgatgcaacccccactggctggggcttggccataggctatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagctgcctgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattctgtcgttctttcccgcaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggtctctaccgaccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|AY800392_P_P-B Feature FT:CDS AY800392_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate ZY041027). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacgc
ataaggtgggaaattttacggggctttattcttctacggtacctggctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcatgaggacattattaataggtgtaaacaatttgtgggacccctcacagtaaatgaaaccaggagact
gaaattgattatgcctgctaggttctatcctaatgttactaaatatctgcccttagataaaggaattaaaccttattatc
cagaacacgtagttaatcattacttccagacgagacattatttacataccctttggaaggcggggatattatataaaaga
gagacaacacatagcgcctcatttttcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcaa
aacctcgaaaaggcatggggacgaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggatctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccacgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagctgcgcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccctgactccgcctctaaga
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagggtcagggctctgta
ctttcctgctggtggctccagttcaggaactgtgaaccctgttcagagcactgcctcttccaaatcgtcaatctcatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcatggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
gcctgctcaaggaaactctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacaccttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaatcctcataaaacaaa
aagatggggctactcccttaacttcatgggatatgtgattggcagttggggcaccttaccccaagaacatattgtgttga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttg
gggtttgctgctcctttcacacaatgtggttatcctgctttaatgcctttatatgcatgtattcaagcgaaacaggcttt
cactttctcgccaacttacaaggcctttctatacaaacagtatgtgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgatgcaacccccactggctggggcttggccataggctatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagctgcctgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattctgtcgttctttcccgcaaatatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttgggtctctaccgaccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|D00329_P_P-B Feature FT:CDS D00329_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctacagtacctgtctttaatcctgaatggcaaactccttcttttcca
gacattcatttacaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcccaatgttaccaaatatttgcccttagataaaggtatcaaaccttattatc
cagagcatgtagttaatcattacttccagactagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccttattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccaggattcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccctatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctatggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctaacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacatggccacaggatcatattgtacaaa
acttcaaactatgttttagaaaacttcctgtaaacaggcctattgattggaaagtttgtcaacgaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctcagtaaacagtatatgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacctcatcgggac
cgacaattctgtcgtactctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|D00330_P_P-B Feature FT:CDS D00330_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcccgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgaacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatccccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccggagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagctggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtggtttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaactaaacagtatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccttcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|D00331_P_C-B Feature FT:CDS D00331_P_C-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctcaatggcaaactccttcatttcct
gacattcatttgcaggaggacatcattaataagtgtaaacaatttgtgggaccccttacagtgaatgaaaaaaggagact
aaaattgattatgcctgctaggttctatcccaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccaacagctcctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaaga
gacactcatcctcaggcaatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgttcagaacactgcctcttccatatcgtcaatcttatcga
cgactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaatacctctgagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacaggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcagaaaacaaa
aagatggggctactcccttaacttcatggggtatgtaattggaagttgggggaccttaccccaagaacatattgtgttga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttttcgccaacgtataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgtggaactcctagcagcttgttttgctcgcagcaggtctggagcaaaacttatcgggac
tgacaattctgtcgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|D23678_P_P-B Feature FT:CDS D23678_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A2-HBVYS2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctatctttaatcctgaatggcaaactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcacgtagttaatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaacctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaatccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggattgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtgacgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcccttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactatgttttaggaaactgcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtctttta
gggtttgctgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatactgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttagggctctaccgcccg
cttctccgtctgccgtaccgtccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|D23679_P_P-B Feature FT:CDS D23679_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate A3-HBVMS2). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtatcccttggactc
ataaggtgggaaactttacggggctctattcttctacagtacctgtctttaatcctgaatggcagactccttcttttcca
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgccagattttatcctactgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctgtctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccgtgcagtggaactccgccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacggggccatgcaagacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatactcccttaacttcatgggatatgtaattggaagttggggtacattgccacaggaacatattgtacaaa
aaatcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtttgtcaaagaattgtgggtcttttg
gggtttgctgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctttcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|D50521_P_P-B Feature FT:CDS D50521_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcggtctagggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctacagtaccggtctttaatcctgaatggcaaactccctcctttcca
aacattcatttgcaggaggaccttattgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagagaaaggaatcaaaccctattatc
cagagcatgtagttaatcattacttccaggcgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacgtagcgcctcgttttgcgggtcaccatattcttgggaacaagatctacagcatgggaggtccgtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcg
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcactcctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgaccaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttccagggggcacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttggccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcgaaacacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacaccttgagtccctttatgccgctgttacccattttcttttgtctttgggcatacatttaaaccctcataaaaccaa
aagatggggatattcccttaacttcatgggatatgtaattgggagctggggttcattgccacaggaacatattgtaccaa
aaatcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtttgtccacgcattgtgggtcttttg
ggatttgctgccccatttacgcaatgtggttatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctgagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctctacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|D50522_P_P-B Feature FT:CDS D50522_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcggtctagggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctacagtaccggtctttaatcctgaatggcaaactccctcctttcca
aacattcatttgcaggaggaccttattgatagatgtaagcaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattaataatgcctgctagattttatcctaatgttaccaaatatttgcccttagagaaaggaatcaaaccctattatc
cagagcatgtagttaatcattacttccaggcgagacattatttgcatactctttggaaggcgggtatcttatataaaaga
gagtcaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggtccgtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgcg
ttcaaagccaactcagaaaatccagattgggacctcaacccacacaaggacaactggccggacgcccacaaggtgggagt
gggagcattcgggccagggttcactcctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggattcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgaccaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttggccgtttgtcccctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacaccttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaaccaa
aagatggggatattcccttaacttcatgggatatgtaattgggagctggggttcattgccacaggaacatattgtaccaa
aaatcaaactatgttttaggaaacttcctgtaaacaggcctattgattggaaagtttgtccacgcattgtgggtcttttg
ggatttgctgccccatttacgcaatgtggttatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacctcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctctacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ377158_P_P-B Feature FT:CDS DQ377158_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate WJT31). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagact
aaaattaattatgcctgctaggttttatcccaatgttaccaaatatctgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactaacaa
ctgtgccagcaactcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtctgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattaccgcaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggccttcctaagtaaacagtatctgaacctttaccctgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggac
tgacaattctgtcgtgctttcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccaaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ448619_P_P-B Feature FT:CDS DQ448619_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-DYH). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacagaagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggtgcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctcta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggggttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggccaattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaagcctttctaagtaaacagtatatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagcagcttgttttgctcgcagcaggtctggggcaaaactcatcggaac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctcggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ448620_P_P-B Feature FT:CDS DQ448620_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-DYF). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctgggacac
ataaggtgggaaactttacggggctttattcgtctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
acgatggggatattcccttaacttcatgggatatgtaattgggtgttggggcacattaccacaggaacatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatagggac
tgacaattctgtcgtgctctcccgcaagtatacatcattcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctggtgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatcttcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ448621_P_P-B Feature FT:CDS DQ448621_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-HQY). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgctttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcacctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctaccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattccgtcgtgctttcccgcaagtatacatcatttccatggctgctaggatgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ448622_P_P-B Feature FT:CDS DQ448622_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-JSM). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacaataaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttacaaaatatttgcccttagataaaggaatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggactctgtaccgaacatggagaacatcgcatccggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
acgatggggatattcccttaacttcatgggatatgtaattggaagttgggggacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcgtgtatacaagcgaaacaggcttt
tactttctcgccaacttacaaggcctttctgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggatcctttatg
tctccactgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacctcatcgggac
tgacaattctgtcgtactctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ448623_P_P-B Feature FT:CDS DQ448623_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-LMX). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacagaagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaaccaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagtcctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaacccgcataaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ448624_P_P-B Feature FT:CDS DQ448624_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-QSA). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaattttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgcttctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctttcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ448625_P_P-B Feature FT:CDS DQ448625_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-TXB). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacggcatgggagtttggccttccc
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaacttcaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttatttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccggccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ448626_P_P-B Feature FT:CDS DQ448626_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-XLB). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctgggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
atgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgcgttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctcagtaaacagtatctaaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ448627_P_P-B Feature FT:CDS DQ448627_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-ZFL). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaactcgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggccaactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattatacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacacaatgtggatatcctgctttaatgcctttatacgcatgtatacaagccaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttatttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ448628_P_P-B Feature FT:CDS DQ448628_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate GZ-ZX). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaagctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaaccctgaatggcaaactccttcttttcct
gatattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccttgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaagctcagggcctactcacaa
ctatgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatccaagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggatggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtcaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccca
cttctccgccttgtgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463787_P_P-B Feature FT:CDS DQ463787_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_1979). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactc
ataaggtggggaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttccc
aacatacatttgcaggaggacattattaataggtgtcaacaatttgtgggacccctcacagtaaatgaaaaaaggagact
aaaattgatcatgcctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatc
ccgagcatgtagttaatcattatttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctgtctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctctccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaaga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgagtgtcttggccaaaattcgcagttccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtg
caacatcttgagtccctttataccgctgttaccaattttcttatgtctttgggtatacatttgaaccctcagaaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattaccgcaagaacacatcgtgtcaa
aaatcaaacaatgttttagaaaacttcctgtaaacagacctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaatctaaacaggcttt
tactttctcgccaacttataaggcctttctacacaaacaatatttgaacctttaccccgttgctcggcaacggccaggtc
tatgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgcctgccgttccgaccgaccacggggcgtacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463788_P_P-B Feature FT:CDS DQ463788_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 739-11_1979). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcct
aacatacatttgcaggagaacattattaataggtgtcaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatc
ccgagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaaga
gacactcatcctcaagccatgcaatggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattaccgcaagaacacattgtgtcaa
aaatcaaacaatgttttaggaaacttcctgtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaatctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatatttgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgcctgccgtaccgaccgaccacggggcgtacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463789_P_P-B Feature FT:CDS DQ463789_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 650-15_1979). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttgcgggtctttactcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcct
aacatacatttgcaggagaacattattgatagatgtgaacaatttgtgggacccctcacagtaaatgaaaaaaggagact
aaaattgatcatgcctgctaggttttatcctaatactactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaacagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcattctcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcctctttctccgcctctaaga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgctcaaaatactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatccggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgtkgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccaatcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttctatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattacctcaagaacacatcgtgtcaa
aaatcaaacaatgttttagaaaacttcctgttaacagacctattgattggaaggtgtgtcaacgaattgtgggccttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatccaagctaaacaggcttt
tactttctcgccaacttataaggcctttctacgcaaccaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcggaac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgtatcgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463790_P_P-B Feature FT:CDS DQ463790_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 621-14_1979). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcct
aacatacatttgcaggagaacattattaataggtgtgaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatc
ccgagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctgcctccaccaatcggaaggtaggaaggcagcctactcccctttctccgcctctaaga
gacactcatcctcaagccatgcaatggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcctcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattaccgcaagaacacatcgtgtcaa
aaatcaaacaatgttttagaaaacttcctgtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaatctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatatttgaacctttaccccgttgctcggcagcggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatttacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcgaagctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgcctgccgttccgaccgaccacggggcgtacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463791_P_P-B Feature FT:CDS DQ463791_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 539-16_1979). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaacctcccgcttttcct
aacatacatttgcaggagaacattattgataggtgtgaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttttttcctaatactactaaatatttgcccttagagaaaggaatcaaaccttattatc
ctgagcatgtagttaatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataagaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcctctttctccacctctaaga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggacacacc
cgtgtgtcctggccaaaattcgcagtcccaaatctgcagtcactcaccaacctgttgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggctcttctggac
tatcagggtatgttgcccgtttgtcctctaattccaggatcatcgaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggcttttagttatatggatgatgtggtcttgggggccaaatctgtg
caacaccttgagtccctttatgccgctgttaccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattaccgcaagaacatatcgtgtcta
aaatcaaacaatgttttagaaaacttcctgtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaatctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatatttgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcgccgctgaatcccgcggacgacccctctcggggacgcttggggctgtaccgcccg
cttctccgcctgccgtaccgaccgaccacggggcgtacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463792_P_P-B Feature FT:CDS DQ463792_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 524-3_1979). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaccgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactc
ataaggtgggaaactttacggggctgtattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcct
aacatacatttgcaggagaacattattgataggtgtcaacaatttgtgggaccccttacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatc
ccgagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggacaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccatttctccacctctaaga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggagacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattaccgcaagaacacatcgtgtcaa
aaatcaaacaatgttttagaaaacttcctgtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaatctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatattcgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcgccgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgcctgccgtaccgaccgaccacggggcgtacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463793_P_P-B Feature FT:CDS DQ463793_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 462-4_1979). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcctaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcct
aacatacatttgcaggagaacattattaataggtgtcaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatc
ccgagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatcctcacat
ctctgccagcagctcctcctcctgcctccgccaatcggcaggtaggaaggcagcctactcccctttctccaccgctaaga
gacactcatcctcaagccgtgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagattactgcctctcccatatcgtcaatcttaccga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacttgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattaccgcaagaacacatcgtgtcaa
aaatcaaacaatgttttagaaaacttcctgtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgcagccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaatctaaacaggcttt
tactttctcgccaacttataaggcctttctacacaaactatatttgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgcctgccgttccggccgaccacggggcgtacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463794_P_P-B Feature FT:CDS DQ463794_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 234-6_1979). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcggggatcccaatgttagtattccttggactc
ataaggtgggaaactttacgggtctttactcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcct
aacatacatttgcaggagaacattattgatagatgtgaacaatttgtgggacccctcacagtgaatgaaaaaaggagact
aaaattgatcatgcctgctaggttttatcctaatactactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacacgtagcgcctcattctgtgggtcaccatattcttgggaacaacagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaaga
gactctcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcagggacagtgaaccctgctcaaaatactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcagttttctaggggaaccacc
cgtgtgtcctggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattaccgcaagaacacatcgtggcaa
aaatcaaacaatgttttagaaaacttcctgtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaatctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatatttgaacctttaccccgttgctcggcagcggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgcctgccgtaccgaccgaccacggggcgtacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463795_P_P-B Feature FT:CDS DQ463795_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 928-9_2004). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttccc
aacatacatttgcaggaggacattattaataggtgtcaacaatttgtgggacccctcacagtaaatgaaaccaggagact
aaaattgatcatgcctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatc
ccgagcatgtagttaatcattatttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctgtctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaagacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctctccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaaga
gacactcatcctcaagccatgcagtggaattccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaacaccgcagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgagtgtcttggccaaaattcgcagttccaaatctccaatcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcaccttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccgtgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgtg
caacaccttgagtcgctttgtaccgctgtttccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggtacattaccgcaagaacacatcgtgtcaa
aaatcaaacaatgttttagaaaacttcctgtaaacagacctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatccaatctaaacaggcttt
tactttctcgccaacttataaggcctttctacacaaacaatatttgaacctttaccccgttgctcggcaacggccaggtc
tttgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatccggcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcgcggggccgcttggggctctaccgcccg
cttctccgcctgccgttccgaccgaccacggggcgtacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463796_P_P-B Feature FT:CDS DQ463796_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 739-11_2004). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcct
aacatacatttgcaggagaacattattaataggtgtcaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatc
ccgagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcaactcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccatttctccacctctaaga
gacactcatcctcaagccatgcaatggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ccttcctgctggtggctccagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatc
actggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattaccgcaagaacacattgtgtcaa
aaatcaaacaatgttttaggaaacttcctgtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgccccctttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaatctaaacaggcttt
tactttctcgccaacttataaggcctttctacacaaacaatatttgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcctgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtactgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcgaagctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgcctgccgttccgaccgaccacggggcgtacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463797_P_P-B Feature FT:CDS DQ463797_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 650-15_2004). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgacgatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactc
ataaggtgggaaactttgcgggtctttactcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcct
aacatacatttgcaggagaacattattgatagatgtgaacaatttgtgggacccctcacagtaaatgaaaaaaggagact
aaaattgatcatgcctgctaggttttatcctaatactactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaacagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcattctcacat
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcctctttctccacctctaaga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgctcagaatactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatccggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgtkgacaaaaatcctcacaataccgcagagtctagacttgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatacctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggcttttagttatatggatgatgtggtattgggggccaagtctgcg
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattacctcaagaacacattgtgtcaa
aaatcaaacaatgttttagaaaacttcctgttaacagacctattgattggaaggtgtgtcaacgaattgtgggccttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatccaagctaaacaggcttt
tactttctcgccaacttataaggcctttctacgcaaccaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcggaac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgtatcgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463798_P_P-B Feature FT:CDS DQ463798_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 621-14_2004). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcgggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcct
aacatacatttgcaggagaacattattaataggtgtgaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttttttcctaatactactaaatatttgccattagataaaggaatcaaaccttattatc
ccgagcatgtagttaatcattacttccagacaagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggacccagcg
ttcaaagccaactccgacaatccagattgggacctcaacccacacaacgacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctccgcctgcctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaaga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtactgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattaccgcaagaacacatcgtgtcaa
aaatcaaacaatgttttagaaaacttcctgtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatccaagctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatatttgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatattcatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggatgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
attctccgccagccgttccgaccgaccacggggcgtacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463799_P_P-B Feature FT:CDS DQ463799_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 539-16_2004). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcct
aacatacatttgcaggagaacattattgataggtgtacacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttttttcctaatactactaaatatttacccttagagaaaggaatcaaaccttattatc
ccgagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaatcaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactaacat
ctctgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaaga
gacactcatcctcaagccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgctcagattactgcctcttccatatcgtcaatcttaccga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggacacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcagggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggcttccgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccatttatgccgctgttacccattttcttctgtctttgggtatacatttaaaccctcagaaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattaccgcaagaacacattgtgtcca
aaatcaaacaatgttttagaaaacttcctgtaaacagacctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaatctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatatttgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgctccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcgccgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgcctgccgtaccgaccgaccacggggcgtacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463800_P_P-B Feature FT:CDS DQ463800_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 524-3_2004). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagactccgacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggactc
ataaggtgggaaactttacggggctgtattcttctacggtacctgtctttaatcctgaatggcaaactccttctttccct
aacatacatttgcaggagaacattattgataggtgtaaacaatttgtgggacctctcacagtaaatgaaaacaggagact
aaaattgatcatgcctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatc
ccgagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggacaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaaga
gacactcatcctcaagcaatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggagacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggtattgggggccaagtctgtg
caacaccttgagtccctttatgccgctgttaccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattaccgcaagaacacatcgtgtcaa
aaatcaaacaatgttttagaaaacttcctgtaaacaggcctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggctttgctgccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaatctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatattcgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgcctgccgtaccgaccgaccacggggcgcacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463801_P_P-B Feature FT:CDS DQ463801_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 462-4_2004). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatctccgcgtcgcagaagatctcaatctcgggaatcctaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcct
aacatacatttgcaggagaacattattaataggtgtcaacaatttgtgggacccctcacagtaaatgaaaacaggagact
aaaaatgatcatgcctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatc
ccgagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatcctcacat
ctctgccagcagctcctcctcctgcctccgccaatcggcaggtaggaaggcagcctactcccctttctccaccgctaaga
gacactcatcctcaagccgtgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagattactgcctctcccatatcgtcaatcttaccga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctaggggaaaaacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacttgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgttgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggcacattaccgcaagaacacatcgtgtcaa
aaatcaaacaatgttttagaaaacttcctgtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgcagccccttttacacaatgtgggtatcctgctttaatgcctttatatgcatgtatacaatctaaacaggcttt
tactttctcgccaacttataaggcctttctacacaaactatatttgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgcctgccgttccggccgaccacggggcgtacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ463802_P_P-B Feature FT:CDS DQ463802_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 234-6_2004). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcaccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggacgc
ataaggtgggaaactttacggggctttattcttctacggtacctgtctttaatcctgaatggcaaactccttcttttcct
aacatacatttgcaggagaacattattgataggtgtcaacaatttgtgggacccctcacagtaaatgaaaccaggagact
aaaattgatcatgcctgctaggttttttcctaatactactaaatatttgcccttagataaaggaatcaaaccttattatc
ccgaacatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtgtcttatataaaaga
gaatcaacgcgtagcgcctcattttgtgggtcaccatattcttgggaacaagagctacatcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtcccaaatcctctgggattctttcccgatcaccagttggaccctgcg
ttcaaagccaactccgacaatccagattgggacctcaacccacacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactattggggtggagccctcaggctcagggcatactcacat
ctctgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctttctccacctctaaga
gactctcatcctcaagccatgcagtggaattccaccacgttccaccaaactcttcaagattccacagtcaggactctgaa
ccttcctgctggtggctccagttcaggaacagtgaaccctgctcagattactgcctcttccatatcgtcaatcttaccga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgccacatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaagacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttctgtctttgggtatacatttgaaccctcagaaaacaaa
acgttggggttactcccttaacttcatgggatatgtaattggaagttggggaacattaccgcaagaacacatcgtggcaa
aaatcaaacaatgttttagaaaacttcctgtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgccccttttacacaatgtgggtatcctgctttaatgcctttgtatgcatgtatacactctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatatttgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggctattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattcggttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgcctgccgtaccgaccgaccacggggcgtacctctctttacgcggcctccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ904357_P_P-B Feature FT:CDS DQ904357_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagacttgtgttgttagacgaagaggcaggtcccctagaagaagagctccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgccattggataaagggatcaaaccgtattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgagattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacagctggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaacgcttcaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtatctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagactgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtgtacatataaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacgagcttt
tactttctcgccaacttacaaggcctttctaagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacgtcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ975271_P_P-B Feature FT:CDS DQ975271_P_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagatt
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcggctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccagactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctgaatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgtaggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcctttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatttgaacctttaccccgttgctcggcaacggcctggtt
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatctccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993680_P_P-B Feature FT:CDS DQ993680_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 268). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatgaagacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggaccc
ataaggtgggaaactttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaagacattgttgataggtgtaagcaatttgtaggacccctaacagtaaatgaaatcaggagact
aaaattaataatgcctgctagattttatcccaaggttaccaaatacttgcccttagataaaggaatcaaaccctattatc
ccgagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagwcaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacttcaatccacacaaggacaattggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaatagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatc
gctggatgtatctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggagttggggatctttgccacaggaacatattgtacaaa
aaatcaaattatgttttagaaaacttccagtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggttcgctgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgcgggacctttgtg
tctcctttgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993681_P_P-B Feature FT:CDS DQ993681_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 290). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttaatattccttggactc
ataaggtgggagactttgcggggctttattcttctatggtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttgcaagaagacattgttgataggtgtaagcactttgtgggacccctaacagtaaatgaaatcaggagact
aaaattaattatgcctgctagattttatcccgatgttaccaaatacttgccgttagatagaggaatccaaccctattatc
ccgggcatgtaggtgatcattacttccagacgagacatcatttacatactctttgggaggtgggtatcttatataaaaga
gagwcaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacttcaatccacacaaggacaattggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaatagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatc
gctggatgtatctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttatctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggagttggggttccttgccacaggaacatattgtacaaa
aaatcaaattatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttctg
gggttcgctgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgcggaacctttgtg
tctcctctgccaatccatactgcggaactcctagcagcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattctgtcgtgctatcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcctgcggacgacccctcccggggccgcttggggctctaccgccct
ctcctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993682_P_P-B Feature FT:CDS DQ993682_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 479). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
aggccaatatcttatcaacacttccggaaaataccgctgttagacgaatatgcaggtcccctataagaagaactccctcg
cctcgcagactaagggctcattcgccgcgacggagaagatctcaatctcgggaagcttaatgtcattattccttggactc
acaaggggggaaactttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaagacattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaatcaggagact
aaaattaatcatgcctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatc
ccgaacatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgacaaggcatggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaatccacacaaggacaattggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagg
gacactcatcctcaggccgtgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgcctctgccatatcatcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcgtggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatc
gctggatgtatctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggagttggggttccttgccacaggaacatattgtacaaa
aaatcaaattatgttttaggaaacttcctgtaaataggcctattgattggaaagtatgtcaacgaattgtgggtcttctg
gggttcgctgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattctgtcgtgctatcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
ctcctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaraccaccgtga
>gnl|hbvcds|DQ993683_P_P-B Feature FT:CDS DQ993683_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 82). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaagaccttgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaaacaggagaat
aaaattaattatgcctgccagattttatcccagtgttaccaaatacttgcccttagataaaggaatcaacccctattatc
cagagcgtgtggtaaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagwcaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacttcaatccacacaaggacaattggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaatagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatc
gctggatgtatctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctgtgggtatacatttaaaccctcacaaaacaaa
aagatggggttattcccttaatttcatgggatatgtaattgggagttggggctccttgccacaggaacatattgtacaaa
aaatcaaattatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggttcgctgccccttttacacaatgtggatatcctgcattaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaacttatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgtccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993684_P_P-B Feature FT:CDS DQ993684_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 336). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaagacattgttgatgggtgtaagcaatttgtgggacccctaacagtaaatgaaaacaggagact
aaaattaatcatgcctgctagattttatcccaatgttaccaaatacttgcctttagataaaggaatcaaaccctattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaatccacacaaggacacttggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcttgcctccaccaatcggcagtccggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgta
ttttcctgctggtggctccagttcaggaacagtgagtcctgctcagaatactgcctctgccatatcgtcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactccaaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaatccctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcccagtcccaaatctccagtcactcaccaacttgttgtcctcccgattgtcctggttatc
cccggatgtgtctgcggggttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggggttggggctccttgccacaggaacatattgtacaaa
aaatcaaatcatgttttaggaaacttcctgtaaacaggcctatagattggaaagtatgtcaacgaattgtgggtcttttg
gggttcgctgccccttttacacaatgtggatatcctgctttaatgcctttgtatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcggcgcatgcgcggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
ctcctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993685_P_P-B Feature FT:CDS DQ993685_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 554). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctggggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctaactttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaagacattgttgataggtgtaagcaatttgtaggacccctaacagtaaatgaaatcaggagact
aaaattaataatgcctgctagattttatcccaaggttaccaaatacttgcccttagataaaggaatcaaaccctattatc
ccgagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagwcaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacttcaatccacacaaggacaattggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccatcaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaatagtaaaccctgctcagaatactgcctctgccatatcatcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaacttgtcctggttatc
gctggatgtatctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccctgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaaatctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggagttggggttctttgccacaggaacatattgtacaaa
aaatcaaattatgttttagaaaacttcctgtaaataggcctattgattggaaagtatgtcaacgaattgtgggtcttctg
gggttcgctgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattctgtcgtgctttcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
ctcctccgtctgccgtaccggccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993686_P_P-B Feature FT:CDS DQ993686_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 342). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaggagattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaatcaggagact
aaaattaataatgcctgctagattttatcccaaggttaccaaatacttgcccttagataaaggaatcaaaccctattatc
ccgagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagwcaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacttcaatccacacaaggacaattggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggcctgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgcctctgccatatcgtcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacc
cgtgtgtcctggccaaaattcgcagtcccaaatcttcagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacgggaccatgcaagacctgcacaac
tcctgctcgaaacccctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggggttggggctccttgccacaggaacatattgtacaaa
aaatcaaaacatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggttcgctgccccttttacacaatgtggatatcctgctttaatgcctttgtatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tatgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctccgctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattctgtcgtgctatcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
ctcctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993687_P_P-B Feature FT:CDS DQ993687_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 700). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggggggaaactttacggggctttagtcttctacggcacctaacttcactcctgattgggaaactccctcttttccg
gacattcagttgaaggaagacattgctgataggtgtaagcagtttgtgggacccctaacagtaaatgaaaataggagatt
aaaattaattatgcctgctagattttatcccaatgttaccaaatacttgcctttagataaaggaatcaaaccctattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacgacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaatccatacaaggacaactggccggatgccaacaaggtgggagt
gggagcattcgggctagggttcacccctccccatgggggcttgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccatcaaactcttcaagatccaagagtcagggctctgta
ctttcctgctggtggctccagttcaggaaccgtgagccctgctcakaakactgcctctgccatatcgkcaaccttctyga
agactggggaccctgtacckaacatggagaacatcrcatcaggactcctrggacccctgctcgtgttacargcggggttt
ttctcgttgacaaaaatcctcacaataccacagagkctagactcgtggtggacttctctcaattttccagggggaacacc
cgtgtgtcttggccaaaattcrcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcgcatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactattgccattt
gttcagtggttcgtaaggctttcccccactgtctggttttcagttatatggatgatgtggaattgggggccaagtctgta
caaaatcgggagtccctttatgccgctgttacccattttcttttgtcyttsggwattcatttaaaccytcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattgggagttggggctccttgccacaagaacatattgtacaaa
aaatcaaattatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtctttta
gggttcgctgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctccgctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattctgtcgtactctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctttaccgcccg
cttctccgcctaccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993694_P_P-B Feature FT:CDS DQ993694_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 234). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttgcaggaggatattgttgataggtgtaagcaatttgtgggacccctaacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttaccaaatacttgcccttagataaaggaatcaaaccctattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatattatataaaaga
gagacgacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatccactgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaatccacacaaggacaactggccggatgccaacaaggtgggagt
gggagcattcggcccagggttcacccctccccatgggggcttgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagcacctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaacactttccatcaaactcttcaagatccaagagtcagggctctgta
ctttcctgctggtggctccagttcaggaaccgtgagccctgctcagactactgcctctgccatatcgtcaaccttctcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcstcacaataccacagagkctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcrcagtcccaaatctccagtcactcaccaacttgttgtcctcccatttgtcctggatatc
gctggatgtgtctgcggcgttctatcatcttcctctgcatcctgctgctatgcctcatcttggtgttggttcttctggac
tatcaaggtatgttgctcgtttgtcctctaattcccggatcatcaaccacctacaccggaccatggagaacctgcatgac
tcctggtgaaggaacctctatgtttccctcatgttgctgtacaaaacctaccaacggaaactgcacctgtagtcccatct
catcatcatggactttcgcaaaatacctatggtagtgggccaccgtccgtttctctaggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaatttcatgggatatgtaattggcagttggggctccttgccacaggaacatattgtacaaa
aaatcaaattatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggttcgctgccccttttacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgcggaacctttgtg
tctccgctgcccatccattctgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaacttatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggacgcttggggctttaccgcccg
cttctccgcctgccgtaccgaccgaccacggggcgcacctctctttacgcggtctccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993696_P_P-B Feature FT:CDS DQ993696_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 452b1). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattcctgggacac
ataaggtgggaaactttacggggctttattcgtctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtgggggacttctctaaattttctggtgggagcacc
cgtgtgtcttgaccaaaattcgcagtccccaatctccagtcactcaccaacctgttgtcctcccatttgtcctgattatc
cctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgatggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatggaatacctgcacagc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcgcctgtattcccgtcc
catcatcttgggctttcccaaaatacctatgggagtgggcctcagttcgtttctcttggctcggtttactagtgccattt
gttcagtggttcgtaaggctttccccccttgtctggctttcagttatatggatgatgtggtactgggggccaagtctgta
caacatcttgagtccctttatgccsctgttaccawttttcttttgtctttgggtatacatttaaaccctcacaaaacawa
wagatggggatattcccttawcttcwtgggatatgtawttgggtgttgggscacattrccacaggaacwtattgtrcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatacgcatgtatacaaacaaaacaggcttt
tactttctcgccaacttacaaaacctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacctcgttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993697_P_P-B Feature FT:CDS DQ993697_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 940b1). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgccattagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcggatcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgttcaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993698_P_P-B Feature FT:CDS DQ993698_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0327-ETCvs3TC-Naive). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcctatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgttttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttctctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcagaagctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttt
tactttctcgccaacttacaaagcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaaccagcgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993699_P_P-B Feature FT:CDS DQ993699_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0226-ETCvs3TC-Break). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgttttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttctctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcagaagctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgcataccagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcgacaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993700_P_P-B Feature FT:CDS DQ993700_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0725-ETC). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatatgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctcggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggatctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgcaattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggaagatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtctcttg
gggtttgccgcccctttcacgcaatgtggatatcctgcattaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctacgtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtacacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgacaacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|DQ993701_P_P-B Feature FT:CDS DQ993701_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0210-ETCvs3TC-Brack). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatatgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctcggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttgggaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggatctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtctcttg
gggtttgccgcccctttcacgcaatgtggatatcctgcattaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctacgcaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtacacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgacaacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993702_P_P-B Feature FT:CDS DQ993702_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate JMY-0919-ETCvs3TC-Naive). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctcggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttgggaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggatctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatggaatggaactccaccactttccaccaaactcttcaagatcccaaagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggagttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttccaccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttgtgtctttgggtatacctttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtctcttg
gggtttgccgcccctttcacgcaatgtggatatcctgcattaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctacgtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctggccgcttgttttgctcgcagcatgtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtacacatcatttctatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccatcggcgctgaatcccccgtactacccctcccggggctccttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993703_P_P-B Feature FT:CDS DQ993703_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 236-0526-Nature1.2-Sero). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggatattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatggtactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcaactcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctcagtaaacagtacctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctggccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993704_P_P-B Feature FT:CDS DQ993704_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-1127-Nature3.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatattatcaacacttccggaaactactgttgttagacgaacaggcaggtcccctagaaaaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccagacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggattgttgggatggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaagaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctcagaaatcagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaaactttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactaatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcgacgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993705_P_P-B Feature FT:CDS DQ993705_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-0625-Nature3.4-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgataatattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccagacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggattgttgggatggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggacctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttaccggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccatatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgccgcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaagaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctcagaaatcagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaaactttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaagtctggggcaaaactaatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993706_P_P-B Feature FT:CDS DQ993706_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-0402-Nature3.3-unSero). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccagacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggattgttgggatggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaagaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctcagaaatcagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaaactttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactaatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993707_P_P-B Feature FT:CDS DQ993707_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 239-O218-Nature3.2-unSero). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtacctaactttaatcctgattggcaaactccttcttttcct
gacattcatttggaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccagacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggattgttgggatggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcga
cgactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaagaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctcagaaatcagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaaactttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactaatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993708_P_P-B Feature FT:CDS DQ993708_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6136-1228-Naive). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggcccctgacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttaccaaatatttccccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacatagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgaaaggttggtcttcca
aacctcgaaaaggcatggggacaaatctgtctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcagcccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccaggattcacccctccccatgggggcctgttggggtggaaccctcaggctcagggcctactcccaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcagaaaggcaacctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggggttggggcacattgccacaggaacacattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgcgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaccaatatctgaacctttaccccgttgttcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccaaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993709_P_P-B Feature FT:CDS DQ993709_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6136-0127-ETCvs3TC-Break). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatggggggctgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagaccccaaagtcaaggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctcccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaagaacatattgttcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgcgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgtatgcatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctcagaaatcaatatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactgggtggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ993710_P_P-B Feature FT:CDS DQ993710_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 6144-0718-ETC). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacattctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaattccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttctctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccatttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggggttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttgatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatagcccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctggtgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|DQ993711_P_P-B Feature FT:CDS DQ993711_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 221-1120-Nature1.1-unSero). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagaagatctcaatctcgggactctcaatgttagaattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgnaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatggtactaaatatttgcccttagataaagggatcaaaccttattatc
cggagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagacatgaaggaaggctactcacttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggnaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgactcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattggatgttggggcacattgccacaggaacatattgtacaaa
aaatcaagatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgaggaacctttgtg
actcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggac
tgacaattctgtcgtgctttcccgcaagtatacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgccca
cttctccgcctgatgtaccaaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaggccaccgtga
>gnl|hbvcds|DQ995801_P_P-B Feature FT:CDS DQ995801_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H60-6). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcct
gacattcatttgaaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacagaagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagaaaaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggatgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactctccaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatctcatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatc
gctggatgtctctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgccctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacagc
tcctgctcaaggaacctctatgtttccctcatgttgctgtgcaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaactgtgttttaggaagcttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtctgttg
gggtttgccgcccctttcacgcaatgtggatatcctactttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacgggacgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgtttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ995802_P_P-B Feature FT:CDS DQ995802_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate H293-16). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggactctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttcgacggtaccttgctttaatcctaattggcaacctccttcttttctt
gacattcatttgcgggaggacattgttgatagatgtaagcaatttgtggggccccttacattaaatgaaaccaggagact
aaaattaattatgcccgctaggttttatcccaatgtcactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagaatgtagttaatcattacttccagacgcgacattatttacaaattctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacttcaacacgcacaaggacaactggccggaagccaacaaggtgggagt
gggagcatttgggccagggttcacccctcttcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacgggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaatacc
cgtgtgtcttggccaaaattcgcagtccccaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gccggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagc
tcctgctcaaggaatctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagttccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttcggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcacctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaagacaggcttt
cactttctcgccaacttacaaggcctttctccgtgaacagtatttgaacctttaccccgttgttcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtacacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctccaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|DQ995803_P_P-B Feature FT:CDS DQ995803_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C265-15). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccaagaggcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccccaatgttagtattccttggacac
ataaggtgggaaactttactgggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtgggaccccttacagtcaatgaaaacaggagact
aaaattaattatgcctgctgggttttatcccaatggtactaaatattttcccttagataaagggatcaaaccgcattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gaatccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagc
gggagcattcgggccaggggtcactcctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggagggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaggatcccagagtcagggccctgta
ctttcctgctggtggctccagttcagaaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagagcatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtttctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtgattcgtagggctttcccccactgtctggcttttagttatatggatgatgtggttttgggggccaaatctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgcgggtcttttg
gggttcgccgcccctttcacgcaatgtggctatcccgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaaccttacccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgcctgttgtgccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|DQ995804_P_P-B Feature FT:CDS DQ995804_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate C1691-11). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagaccaagagtcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagacgatctcaatctcgggaacctcaatgttagtatcccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
aacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggcccctcgcagtaaatgaaaaagggagact
aaaattaattatgcctgctaggttttatcccaatgttaccaaatatttgcccttagataaagggatcaaaccttattatc
cagaacatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatacaaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacttcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcactcctccccatgggggactgttgggggggagccctcaggcccagggcatattcacca
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccacgcagtggaactccaccaagttccaccaaactcttcaagatcccagagtcagggccctgta
cattcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgcaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcggttttccaggggggacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
taccaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagactgta
caacatcttgagtccctttatgccgctgttactcattctcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttcggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtctttta
gggtttgccgcccctttcacacaatgtggatatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttttcgccaacttataaggcctttctgagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcttagcagcttgttttgctcgcagccggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaaatatacgtcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttctaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EF134945_P_P-B Feature FT:CDS EF134945_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B3). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcagactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggcatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aaccgcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccaggtttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctctaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccccgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaagaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatacgtaattgggtgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctgagcaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttatttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EF134946_P_P-B Feature FT:CDS EF134946_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G247-B5). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcagactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggcatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aaccgcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccaggtttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaagaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacctcatgggatacgtaattgggtgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggctatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctgagcaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacatcctttatttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EF473971_P_P-B Feature FT:CDS EF473971_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2059Java). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcaccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcctttcct
gacattcatttgcaggaggacatcattaataggtgtgaacaatttgtgggaccccttacagtgaatgaaaacaggagact
aaaattggttatgcctgctaggttctatcccaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgacaaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagtcctcaagctcagggcatactcacaa
ctgtgccaacagctcctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaaga
gacactcatcctcaggcaatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggcacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcagaaaacaaa
aagatggggttactcccttaacttcatgggatatgtaattggaagttggggcaccttaccccaagaacatattctgttga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctttaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttttcgccaacgtataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattctgtcgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccggctgccgtaccgaccgaccacggggcgcacctctctttacgaggactccccggctgtgccttctcatctgcc
ggaccgggtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EF473972_P_P-B Feature FT:CDS EF473972_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1839Java). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcctttcct
gacattcatttgcaggaggacatcattaataggtgtgaacaatttgtgggacccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcccaatgttactaaatatttgcccttagataaaggaatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaacga
gagacaacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcctcca
aacctcgacaaggcatggggacaaatctttctgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
gtgtgccaacagctcctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccgcctctaaga
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcagaaacagtaaaccctgttcagaacactgtctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcagaaaacaaa
aagatggggctactcccttaacttcatggggtatgtaattggaagttggggcaccttaccccaagaacatattgtgttga
aaatcaaacaatgctttaggaaacttcctgtaaacagacctattgattggaaggtgtgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctttaatgcctttatatgcatgtatacaagctaaacaagcttt
tactttttcgccaacgtataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattctgttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EF473973_P_P-B Feature FT:CDS EF473973_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH45AChinese). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgcccggtcgcagacgatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctgattggcaaactccttcctttcct
gacattcatttgcaggaggacattgttgatagatgtgaacaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactcctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaaga
gacactcatcctcaggccatgcaatggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctccgaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctgttgattggaaagtatgtcaacgtattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctctccaacttacaaggcctttctaagtaaacagtatctaaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaaccttcgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctggtgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EF473974_P_P-B Feature FT:CDS EF473974_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate EIH21AChinese). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgtcgggtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcctcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccaggattcacccctccccatgggggactgttggggtggagccctcaggctcaggtcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgagggtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctgggtatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcatggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgttgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagctggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgtttggctcgcatcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgagtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EF473975_P_P-B Feature FT:CDS EF473975_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2061Chinese). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaagatctcaatcgccgcgtcgcagacgatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctaaggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacatcattaatagatgtgaacaatttgtggggccccttacagttaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattactttcagacgcgacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgatccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcctggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattggaagttggggcaccttaccccaggaacatattgtacaaa
aaatcaaaatgtgttttcggaaacttcctgttaacaggcctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttttaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctttcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EF473976_P_P-B Feature FT:CDS EF473976_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate Alr049East). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttactcttctacggtacctagctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacatcgttaataggtgtgaacaatttgtgggacccctcacagtgaatgaaaataggagact
aaaattgatcatgcctgctaggttttatcctaatgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtggttaatcattacttccagacgagacattatttacatactctttggaaggcaggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccttattcttgggaacaagagctacagcatgggaggttggtcctcca
aacctcgaccaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactcccccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagttaggaaggaagcctactcccctgtctccacctctaaaa
gacactcatcctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
cttccctgctggtggctccagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgaatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccgcagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggagttttatcatcttcctttgcatcctgctgctatgcctcatgttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatccaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctctgggtatacatttaaaccctcataaaacaaa
acgatggggctactcccttaacttcatgggatatgtaattggaagttggggtaccttaccccaagaacatattgcgttga
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctctaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgcgcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaacttatcgggac
tgacaattctgttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctacgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EF473977_P_P-B Feature FT:CDS EF473977_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate KD048East). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggagactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctacggtacctagctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacatcgttaataggtgcaaacaatttgtgggacccctcacagtgaatgaaaataggagact
aaaattgatcatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaaggaatcaaaccttattatc
cagagcatgtggttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gagacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggacctcca
aacctcgaccaggcatggggacaaatctttccgtccccaatcctctgggattctttcccgatcaccagttggaccctgca
ttcaaagccaattccgacaatcccgattgggacctcaacccacacaaggacaactggccggactccaacaaggtgggagt
gggagcattcgggccgggattcactcccccccatgggggactgttggggtggagccctcaagctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggaagcctactcccctgtctccacctctaaga
gacactcaccctcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatcccagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgttcagaccactgcctcttccatatcgtcaatcttatcga
agactggggaccctgtgccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtattacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacaac
tcctgctcaaggaatctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
acgatggggctactcccttaatttcatgggatatgtaattggaagttggggtaccttaccccaggaacatattgtgttca
aaatcaaacaatgttttaggaaacttcctgtaaacaggcctattgattggaaggtatgtcaacgaattgtaggtcttttg
ggatttgctgctcctttcacacaatgtggttatcctgctctaatgcctttatatgcatgtatacaagctaaacaggcttt
tactttctcgccaacttataaggcctttctaagcaaacaatatctgaacctttaccccgttgcgcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcgaaacttatcgggac
tgacaattctgttgtcctttcccgcaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcacggggccgcttggggctctaccgcccg
cttctccgtctgccgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EF494380_P_P-B Feature FT:CDS EF494380_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TW836). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctagggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctctattcttctaaggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggtcggtcttcaa
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttgggatggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcgacagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggagctccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ttttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttctatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcgcctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatggggtatgtaattggatgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggccttcctgagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaaccttcgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattccgtcgtgctctcccgcaagtatacgtccttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EF494381_P_P-B Feature FT:CDS EF494381_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TW936). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttgcggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttccc
aatattcatttgcaggaggacattgttgatggatgtaagcaatttgtggggcccctgacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcctaaggttacgaaatatttccctttagataaaggaatcaaaccttattatc
cagagcatgtagttaatcattacttccaaacaagacattatttacacactctttggaaggcaggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggagggtggtcttcaa
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcgcaaggacacctggccggacgccaacgaggtgggagt
aggagcattcgggcccgggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcagggagacagcctactcccgtatctccacctctaagg
gaaactcatcctcaggtcatacagtggaactcaaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctgccatatcgtcaatctcatcga
cgactggggaccctgtaccgaacatggagaacatagcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctcaaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatctgcttgttgggtcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacgggaactgcacctgtattcccatcc
catcatcttgggctttcgtaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttgaaccctcataaaactaa
aagatggggatattcccttaatttcatgggatatgtaattgggggttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttt
tactttctcgccaacttacaaggcctttctacgtcaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggtcgcttggggctctaccgcccg
cttctccgcctggtgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EF494382_P_P-B Feature FT:CDS EF494382_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate TWD347). Non-functional genomic sequence. [Hepadnaviridae] (length=2517 residues).
atgcccctatcttatcaacacttccggaaactactgttattagacaaagaggcaggacccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcaccgcgtcgcaaaagatctcaatctcgggactctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagact
gagattaattatgcctgctaggttttatcctaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcaggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcgcaaggacaactggccggacgccaacaaggtgggagc
gggagcattcgggccagggttcgtccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctatgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgactttccaccaaactcttcaagatcccagagtcagggccctgtactttcctgctggtgg
ctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaaccttatcgaagactggggaccctg
taccgaacatggagaacatcacatcaggactcctaggacccctgctcgtgtcacaggcagggtttttcttgttgacaaaa
atcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggagacacccgtgtgtcgtggcca
aaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatcgctggatgtgtctgc
ggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggactatcaaggtatgttg
cccgtttgtcctctaattccaggatcatcaacaaccggcacgggaccatgcaaaacctgcacgagtcctgctcaaggaac
ctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcccatcatcttgggctt
tcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtggttcgta
gggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctatacaacaccttgagtcc
ctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatggggatattc
ccttaacttcatgggatatgtaatagggtgttggggcacattgccacaggaacatattgtgcaaaaaatcaaaatgtgtt
ttaggaaacttcctgtaaacagacctattgattggaaggtatgtcaacgaattgtgggtcttttagggtttgccgcccct
ttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggctttcactttctcgccaac
ttataaggcctttttacgtcaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaagtgttcg
ctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtgtctcctctgccgatc
catactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaacctcatcgggactgacaattctgtcgt
gctctcccgcaagtatacatcattcccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgttt
acgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccgcttccccgcctgatg
taccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgccggaccgtgtgcactt
cgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU139543_P_P-B Feature FT:CDS EU139543_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcatgctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggggtgggcctcagtccgtttctcttggctcagttcactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcccattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcaaacctcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgtttggggctctaccgcccg
cttctccgcctgttgtaccatccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU158262_P_P-B Feature FT:CDS EU158262_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G116). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagatt
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacatagcgcctcattttttgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcgtcca
aacctcgaaaaggcatggggacaaatctctctgtccccaatcccctgggattcttccccgatcatcagttggaccccgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaattccaccactttccaccaaactcttcaagatcccaaagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtaagccctgctcagaatactgtctctaccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
tccttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtatctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctattaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggttattcccttaacttcatgggatatgtaattgggggttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgctcctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccgacttataaggcctttctaagtaaacagtatctgaacctttaccccgttgcccggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggracctttgtg
kctcctctgccgatccatactgcggaactcctagcmgcttgttttgctcgcagcaggtctggggcaaacctcatcgggac
ygacaaytctgtcgtgctctcycgcaaatayacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtytacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgyccg
cttctccgcctgccgtwccggccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU158263_P_P-B Feature FT:CDS EU158263_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate G108). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatcccaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgcttcaatcctgactggcaaactccttcttttccc
gacattcatttgcaggaggacattgttgatagatgtagtcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttaccaaatatttgcccttagataaagggatcaaaccttattacc
cagagcatgtagttaatcattactttcagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggaagccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatacttacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacagc
tcctgctcaaggcacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacactgccacaggaacatattgtacaaa
agatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaaagaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggctataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtcctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgcttggggctctaccgccca
cttctccgcctgttgtaccgaccgtccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU305547_P_P-B Feature FT:CDS EU305547_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M118-481). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgagaaggcatggggacaaatctttctgtccccaatcctctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcaaaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagaattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccggttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcgacgaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtgcaaaacctacgaacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttctttcgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttcacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccacactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgaaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU305548_P_P-B Feature FT:CDS EU305548_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M118-673). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcgacgaccagcatcggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttcacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatcggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccacactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgaaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306677_P_P-B Feature FT:CDS EU306677_P_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggtaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctgctcacaa
ctgtgccagcagcccctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgcctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtctgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacatc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttaggggcgaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcccattgattggaaagtatgtcaacgcattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctggacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctcttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306678_P_P-B Feature FT:CDS EU306678_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctgctcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacatc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcccattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctggacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctcttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306679_P_P-B Feature FT:CDS EU306679_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctgctcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacgtttaaaccctcacaagacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcccattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctggacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctcttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306680_P_P-B Feature FT:CDS EU306680_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctgctcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagaccccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacgtttaaaccctcacaagacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcccattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctggacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctcttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306681_P_P-B Feature FT:CDS EU306681_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagacgaagatgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctgctcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggacggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacatc
tcctgctcaaggaacctctatgtttccctcatgctgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcgaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtattttaggaaacttcctgtaaacaggcccattgattggaaagtatgtcaacgaatagtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctggacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tggcaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctcttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306695_P_P-B Feature FT:CDS EU306695_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttaccaaatatctgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactaacaa
ctgtgccagcaactcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctttaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtctgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattaccgcaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggccttcctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggac
tgacaattctgtcgtgctttcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccaaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306696_P_P-B Feature FT:CDS EU306696_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggcaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttaccaaatatctgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactaacaa
ctgtgccagcaactcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtctgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagagggcctcagtccgtttctcttggctcagtttactagtgccattc
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattaccgcaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgcctacttacaaggccttcctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggac
tgacaattctgtcgtgctttcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccaaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306697_P_P-B Feature FT:CDS EU306697_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagact
aaaattaattatgcctgctaggttttatcccaatgttaccaaatatctgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactaacaa
ctgtgccagcaactcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtctgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattaccgcaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggccttcctaagtaaacagtatctgaacctttaccctgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggac
tgacaattctgtcgtgctttcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccaaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306698_P_P-B Feature FT:CDS EU306698_P_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctca
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttaccaaatatctgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattgtttgcacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctatagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactaacaa
ctgtgccagcaactcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtctgtcctctcattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattaccgcaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaaccggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgccttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggccttcctaagtaaacagtatctgaacctataccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcgtgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaacctcatcgggac
tgacaattctgtcgtgctttcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccaaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306699_P_P-B Feature FT:CDS EU306699_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttacccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcagaaccagcacaac
tcttgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcggtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctcccagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctctgggtatacatttaaaccctcacaaaacaaa
aagatggggatattccctcaacttcatgggatatgtaattgggagttggggcacattaccacaagaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcacctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagccaaacaggcttt
tactttctcgccaacgtacaaggcctttctaagtaaacagtatctgaacctgtaccccgttgcacggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgcccgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306700_P_P-B Feature FT:CDS EU306700_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttgggcac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcacgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctttcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306701_P_P-B Feature FT:CDS EU306701_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306702_P_P-B Feature FT:CDS EU306702_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaaaggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaaacgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcggaac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306703_P_P-B Feature FT:CDS EU306703_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcggaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttgcaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggttgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306704_P_P-B Feature FT:CDS EU306704_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacgttatttacacactctttggaaggcggggatcttatataaaaga
gagtccacgcgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaagtctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcgaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgcgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctacccccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcagaaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatgcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacttattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatacgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306705_P_P-B Feature FT:CDS EU306705_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccgctgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306706_P_P-B Feature FT:CDS EU306706_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306707_P_P-B Feature FT:CDS EU306707_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgccgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggcttcattcttctacggtaccttgctttaatcctaaatggcaaactccctcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagttctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagcgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatgcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306708_P_P-B Feature FT:CDS EU306708_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcaccagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcttgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttggttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306709_P_P-B Feature FT:CDS EU306709_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggagcaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcacgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgcaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgcacctttaccccgttgttcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggctcggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306710_P_P-B Feature FT:CDS EU306710_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccaattcaggaacggtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgccaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306711_P_P-B Feature FT:CDS EU306711_P_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggaccccaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccatcactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaaccgtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcacttaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcaacaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU306712_P_P-B Feature FT:CDS EU306712_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctagattttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccgttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgtccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU330989_P_P-B Feature FT:CDS EU330989_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84-74). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaataggtgtaaacaatttgtaggtcccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtaattaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcga
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccatacaaggatacctggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaa
ctgtgccaacagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaaga
gatactcatccgcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcga
agactggggaccctgcaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcagccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcgtgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaacacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggcttttagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggctactcccttaacttcatggggtatataattggaggttggggcaccttaccccaagaacatattgtatgga
aaatcaaacaatgttttagaaaacttcctataaataggcctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggatttgctgctcccttcacacaatgtggttatcccgctttactgcctttatatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgttctttcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccg
cttctccgtctgctgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU330990_P_P-B Feature FT:CDS EU330990_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M84-146). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaataggtgtaaacaatttgtaggtcccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtaattaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcga
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccatacaaggatacctggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaa
ctgtgccaacagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaaga
gatactcatccgcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcga
agactggggaccctgcaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcagccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcgtgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaacacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggcttttagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggctactcccttaacttcatggggtatataattggaggttggggcaccttaccccaagaacatattgtatgga
aaatcaaacaatgttttagaaaacttcctataaataggcctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggatttgctgctcccttcacacaatgtggttatcccgctttactgcctttatatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgttctttcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccg
cttctccgtctgctgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU330992_P_P-B Feature FT:CDS EU330992_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-6). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaataggtgtaaacaatttgtaggtcccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcga
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccatacaaggatacctggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaaga
gatactcatccgcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcga
agactggggaccctgcaccgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcacctgaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggctactcccttaacttcatggggtatataattggaggttggggcaccttaccccaagaacatattgtataga
aaatcaaacaatgttttagaaaacttcctataaataggcctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggatttgctgctcccttcacacaatgtggttatcccgctttactgcctttatatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatacggcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgttctttcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccg
cttctccgtctgctgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU330994_P_P-B Feature FT:CDS EU330994_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-10). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaataggtgtaaacaatttgtaggtcccctcacagtgaatgaaaacaggggact
aaaattgattatgcctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcga
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccatacaaggatacctggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaa
ctgtgccagcagttcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaaga
gatactcatccgcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcga
agactggggaccctgcaccgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccggtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtaaggctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggctactcccttaacttcatggggtatataattggaggttggggcaccttaccccaagaacatattgtatgga
aaatcaaacaatgttttagaaaacttcctataaataggcctattgattggaaggtatgacaacgaattgtgggtcttttg
ggatttgctgctcccttcacacaatgtggttatcccgctttaaagcctttatatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgttctttcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccg
cttccccgtctgctgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgcctcctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU330995_P_P-B Feature FT:CDS EU330995_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-80). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaataggtgtaaacaatttgtaggtcccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcga
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccatacaaggatacctggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaaga
gatactcatccgcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcga
agactggggaccctgcaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacagaaatcctcacaataccacagagcctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatgtggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttgccaattttcttttgtctttgggcatacatttaaaccctcataaaacaaa
aagatggggctactcccttaacttcatggggtatataattggaggttggggcaccttaccccaagaacatattgtatgga
aaatcaaacaatgttttagaaaacttcctacaaataggcctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggatttgctgctcccttcacacaatgtggttatcccgctttactgcctttatatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgttctttcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccg
cttctccgtctgctgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU330996_P_P-B Feature FT:CDS EU330996_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-81). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctaactttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaataggtgtaaacaatttgtaggtcccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcga
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccatacaaggatacctggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaaga
gatactcatccgcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcga
agactggggaccctgcaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggctactcccttaacttcatggggtatataattggaggttggggcaccttaccccaagaacatattgtatgga
aaatcaaacaatgttttagaaaacttcctataaataggcctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggatttgctgctcccttcacacaatgtggttatcccgctttactgcctttatatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgttctttcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccg
cttctccgtctgctgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtacacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU330997_P_P-B Feature FT:CDS EU330997_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-216). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaataggtgtcaacaatttgtaggtcccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccaggcgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcga
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccatacaaggatacctggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaaga
gatactcatccgcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcga
agactggggaccctgcaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggctactcccttaacttcatggggtatataattggaggttggggcaccttaccccaagaacatattgtatgga
aaatcaaacaatgttttagaaaacttcctataaataggcctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggttttgctgctcccttcacacaatgtggttatcccgctttactgcctttatatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccgtaggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgttctttcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccg
cttctccgtctgctgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctccgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU330998_P_P-B Feature FT:CDS EU330998_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1043). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaataggtgtaaacaatttgtaggtcccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcga
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccatacaaggatacctggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaaga
gatactcatccgcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcga
agactggggaccctgcaccgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtc
gctggatgtgtctgcggctttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggctactcccttaacttcatggggtatataattggaggttggggcaccttaccccaagaacatattgtataga
aaatcaaacaatgttttagaaaacttcctacaaataggcctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggatttgctgctcccttcacacaatgtggttatcccgctttactgcctttatatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatacggcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgttctttcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccg
cttctccgtctgctgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU330999_P_P-B Feature FT:CDS EU330999_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1044). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaataggtgtaaacaatttgtaggtcccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcga
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccatacaaggatacctggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaaga
gatactcatccgcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcga
agactggggaccctgcaccgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtc
gctggatgtgtctgcggctttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggctactcccttaacttcatggggtatataattggaggttggggcaccttaccccaagaacatattgtataga
aaatcaaacaatgttttagaaaacttcctacaaataggcctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggatttgctgctcccttcacacaatgtggttatcccgctttactgcctttatatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatacggcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgttctttcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccg
cttctccgtctgctgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU331000_P_P-B Feature FT:CDS EU331000_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1045). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaataggtgtaaacaatttgtaggtcccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcga
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccatacaaggatacctggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaaga
gatactcatccgcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcga
agactggggaccctgcaccgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggctactcccttaacttcatggggtatataattggaggttggggcaccttaccccaagaacatattgtataga
aaatcaaacaatgttttagaaaacttcctacaaataggcctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggatttgctgctcccttcacacaatgtggttatcccgctttactgcctttatatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatacggcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgttctttcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccg
cttctccgtctgctgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU331001_P_P-B Feature FT:CDS EU331001_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate M85-1046). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgacgaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtacctagctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttaataggtgtaaacaatttgtaggtcccctcacagtgaatgaaaacaggagact
aaaattgattatgcctgctaggttctatcctaacgttactaaatatttgcccttagataaaggaattaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacatactctttggaaggcgggtatcttatataaaaga
gaaacaacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagagctacagcatgggaggttggtcttcga
aacctcgaaaaggcatggggacaaatctttctgtccccaatcctctgggattccttcccgatcaccagttggaccctgca
ttcaaagccaactccgacaatcccgattgggacctcaacccatacaaggatacctggccggacgccaacaaggtgggagt
gggagcattcgggccgggattcactccaccccatgggggactgttggggtggagccctcaagctcagggcatgctcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaggtaggaaggcagcctactcccctgtctccacctctaaga
gatactcatccgcaggccatgcagtggaactccaccacgttccaccaaactcttcaagatccaagagtcagggctctgta
ctttcctgctggtggctccagttcaggaacagtgaaccctgctcagaacactgcctcttccatatcgtcaatcttgtcga
agactggggaccctgcaccgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccgatttgtcctggttgtc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaaccaccagcaccggaccatgcagaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatatggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggctactcccttaacttcatggggtatataattggaggttggggcaccttaccccaagaacatattgtataga
aaatcaaacaatgttttagaaaacttcctacaaataggcctattgattggaaggtatgtcaacgaattgtgggtcttttg
ggatttgctgctcccttcacacaatgtggttatcccgctttactgcctttatatgcatgtatacaagctaaacaggcttt
cactttctcgccaacttataaggcctttctaaacaaacaatatctgaacctttaccccgttgctcggcaacggccaggtc
tgtgccaagtgtttgctgacgcaacccccactggctggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatacggcggaactcctagccgcttgttttgctcgcagcaggtctggagcgaaactcatcgggac
tgacaattctgtcgttctttcccggaaatatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtctacgtcccgtcggcgctgaatcccgcggacgacccctctcggggccgactggggctctaccgcccg
cttctccgtctgctgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU350409_P_P-B Feature FT:CDS EU350409_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate BTO5856). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggaccttgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattgattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacgaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgtgacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggggcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU439018_P_P-B Feature FT:CDS EU439018_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccctgctttaatcctatatggcaaactccttcctttcct
gacattcatttgcaggaggacattgttgacagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgtcactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcggaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacctacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcgacaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU439020_P_P-B Feature FT:CDS EU439020_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccctgctttaatcctatatggcaaactccttcctttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgtcactaaatatttgcccttagataaagggatcaacccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtggaagt
gggggcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgcgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccgctttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatacagtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcggttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtgcaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU439021_P_P-B Feature FT:CDS EU439021_P_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgctagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccctgctttaatcctatgtggcaaactccttcctttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgtcactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatgggggcaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtgaagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcagaaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagagcatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattctcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaagcttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatgtgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtcaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaagccaccgtga
>gnl|hbvcds|EU439022_P_P-B Feature FT:CDS EU439022_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccctgctttaatcctatgtggcaaactccttcctttcct
gacattcatttgcaggaggacattgttgatagatgcaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgtcactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgtttcatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaaccgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctatgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU439023_P_P-B Feature FT:CDS EU439023_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccctgctttaatcctatatggcaaactccttcctttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgtcactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcaggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctggaattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggctagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccatatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcctcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgctgcccgtttgtcctctaattccaggaccatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
taccttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcatggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctaccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU487256_P_P-B Feature FT:CDS EU487256_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient12). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
aacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcctcca
aaccgcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggacccagca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccaggggtcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctgagg
gacactcatcctcaggccatgcagtggaactccaccactttcctccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatc
gctggatgtatctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tactgctcaaggaacctctttgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatacagctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggttatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgcggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
cactttctcgccaacttataaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctccaggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU487257_P_P-B Feature FT:CDS EU487257_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient14). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttgcacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagactgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaaga
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
cgactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaagacccctgctcgggttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctttgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccattgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttgaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggtgttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcgaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacaatatctgaacctttaccccgttgctcggcagcggtctggcc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgacactcattgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctacc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU522067_P_P-B Feature FT:CDS EU522067_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 4T). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagcattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaattccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagact
aaaattaattatgcctgctaggttttatcccaatgttacgaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcatccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcaatcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctccaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttacatggatgatgtggtattgggggccaagtctata
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattggaagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgttaataggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
ggatttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcattcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctcttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU522072_P_P-B Feature FT:CDS EU522072_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8N). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagaggcaggtccactagaagaagaactccctcg
cctcgcagacgaaggactcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctactgtaccttgctttaatcctcaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagaaaatgaaaccaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcagggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcaagtggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggattgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
aacactcatcctcagatcatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcagggacagtgaaccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctttgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtgttcatttaaaccctcacaagacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaagaccatattgtacaaa
aaatcaaattgtgttttaggaaacttcctgtgaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctccgtgaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccacactgcggaactcctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU522074_P_P-B Feature FT:CDS EU522074_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient 8T). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaccaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagctaaagggatcaaaccttattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttacgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcaagtggatcctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggattgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcagggacagtgaaccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtgtacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaagaccatattgtacaaa
aaatcaaattgtgttttaggaaacttcctgtgaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctcagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccacactgcggaactcctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU547563_P_P-B Feature FT:CDS EU547563_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate MC06). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactgctgttgttagaccaagaggcaggtcccttagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaacctcaatgttagtattccttggacac
ataaggtgggaaactttacgggactttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
aacattcatttgcaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcccaacgttactaaatatttgcccttagataaagggatcaaaccatattatc
cagagcatgtagtcaatcattacttccagacgcgacattatttacacactctttggaaggcggggatattatataaaaga
gagtccacacgtagcgcctcattytgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggtgcattcgggccagggttcacccctccccatgggggattgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaacgccaccacgttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatctcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctaggggraacacc
cgtgtgtcytggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccgatttgtcctggttatc
gttggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacgac
tcctgctcgaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtttggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttacccattttcttttgtctttgggtatacatttaaaccctcataaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggggttggggcacattgccacaagaacatattgtacaaa
aaatcaaaatgtgttttcggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctcagtaaacagtatctgaccctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcytgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU564822_P_P-B Feature FT:CDS EU564822_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10TA). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccatcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagg
gaaactcatcctcaggccatgcagtggaacgccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcagaaacagtaagccctgctcagaatactgtctcagccatatcgtcaatcttatcga
cgactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggtaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcgtcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatatgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaacttctagcagcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtcctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU564823_P_P-B Feature FT:CDS EU564823_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10TB). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccatcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctattgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaacttctagcagcttgttttgctcgcagcaggtctggggcgaaactcatcgggac
tgacaattctgtcgtcctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccaaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU564824_P_P-B Feature FT:CDS EU564824_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-10N). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacaaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatcccaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccatcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacgaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgctgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaacttctagcagcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtcctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctattgtaccaaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU564826_P_P-B Feature FT:CDS EU564826_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-11N). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctggaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaaccctaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgcttcaatcctacttggcaaactccttcttttcct
gacattcatttgaaggaggacattgttgatagatgtgagcaatttgtggggccccttacagtaaatgaaagaaggagact
aaaattaattatgcctgctaggttttatcccaaggttactaaatatttgcccttggataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcgtccctccccatgggggactgttggggcggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccacaaaactcttcaagatcccagagtcagggccctgaa
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggggacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctacttccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggggttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacagacctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatccttcccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgatgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggcccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU570069_P_P-B Feature FT:CDS EU570069_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 1-B24). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttggacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaactgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagtgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacgggaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgagtatacatttaaaccctcacaaaacaaa
acgatggggatattcccttaacttcatgggatatgtaattggtagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagtaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtgggacctttgtg
tcccctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgtatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgacctcggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU570070_P_P-B Feature FT:CDS EU570070_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 2-B24). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagtgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
acgatggggatattcccttaacttcatgggatatgtaattggtagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagtaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgttaacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgacctcggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU570071_P_P-B Feature FT:CDS EU570071_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 4-B24). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagtgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcagggaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcgacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
acgatggggatattcccttaacttcatgggatatgtaattggtagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagtaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatccgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccatgggccatcagcgcatgcgtgggacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgacctcggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU570075_P_P-B Feature FT:CDS EU570075_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 11-S142). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaacatactgttgttagacaaagacgcaggtcccctggaagaagaactccctcg
cctcgcagaccaaggtctaaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccgtgctttaatcctaattggcaaactccttcttttcct
aacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaaaaggagact
aaaattaattatgcctgctaggttttatcccaaggctactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgagaaggcatggggacaaatctttctgtccccaatcccctgggattcttcccttatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggcgggagt
gggagcattcgggccagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctgctcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccattcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttccagggggaacacc
cgcgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcgtcgacaacgagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcccttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcaaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggttatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcagaatgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgcattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctgagtcaacagtatctgcacctttaccccgctgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggcaataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacccctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU579441_P_P-B Feature FT:CDS EU579441_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 12). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaaatactgttgttagaccaagacgcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctaaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggaaact
aagattaattatgcctgctaggttttatcccaatgctactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgagaaggcatggggacaaatctttctgtccccaatcccctgggattcttcccttatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccattcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctcccaattttccagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcctgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcgtcgacaacgagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcccttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcaaaatctgta
caccatcttgagtccctttatgccgctgttaccacttttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaagaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaaccggcctattgattggaaagtatgtcaacgcattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctgagtcaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggcaattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU589335_P_P-B Feature FT:CDS EU589335_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate S142-5). Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaacatactgttgttagataaagacgcaggtcccctggaagaagaactccctcg
cctcgccgaccaaggtctaaatcgccgcgtcgcagaagatctcggtctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccgtgctttaatcctaattggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaaaaggagact
aaacttaattatgcctgctaggttttatcccaatgatactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggattttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttcccttatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccattcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ccttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttccagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcgtcgacaacgagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgcccttt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggcaaaatctgta
caccatcttgagtccctttatgccgctgttaccacttttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaagaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaaccggcctattgattggaaagtatgtcaacgcattgtgggtctgttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctgagtcaacagtatctgcacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggcaataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU595031_P_P-B Feature FT:CDS EU595031_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate 7). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgttttaatcctacatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttaatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattctttcccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccgcctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatattcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagtaccggaccatgcaaaacctgcacgac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccattgtctggctttcagttatattgatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtctgtta
gggtttgccgcccctttcacgcaatgtggctatcctgctttaatgcctttatatgcatgcatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccagctggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU660224_P_P-B Feature FT:CDS EU660224_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate HBV-12N). Non-functional genomic sequence. [Hepadnaviridae] (length=2523 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggccccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaattttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
aacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaaggaatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aaccgcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgctcaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccactcggcagtcaggaaggcagcctactcccttatctccacctctgagg
gacactcatcctcaggccatgcagtggaactccaccactttcctccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcagttttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaacttgtcctggttatc
gctggatgtatctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtacgttgcccgtttgtcctctaacaaacagaaccagcaccggaccatgcaaaacctgcacaactactgctca
aggaacctctttgtttccctcatgttgctgttccaaacctacggacggaaactgcacctgtattcccatcccatcatctt
gggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccatttgttcagtgg
ttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgtatgccatctt
gagtccctttatacagctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaaaagatgggg
atattcccttaacttcatgggttatgtaattgggagttggggcacattgccacaggaacatattgtacaaaaaatcaaaa
tgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttggggtttgcc
gcccctttcacgcaatgcggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggctttcactttctc
gccaacttataaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggtctggtctgtgccaag
tgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtgtctcctcta
ccgatccatactgcagaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggactgacaattc
tgtcgtgctctcccgcaagtatacatcctttccatggctgctaggctgtgctgccaactggatcctgcgcgggacgtcct
ttgtttacgtcccgtcggcgctgaatcccgcggacgacccctccaggggccgcttggggctctaccgcccgcttctccgc
ctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcgtctgccggtccgtgt
gcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU796066_P_P-B Feature FT:CDS EU796066_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcggggatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaactggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcatttgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctaggggaaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccgacttataaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccttaggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgccgcatggaaaccaccgtga
>gnl|hbvcds|EU796067_P_P-B Feature FT:CDS EU796067_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatgttactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcatttgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttaactccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttattgg
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggctt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccgacttataaggcctttctaagtaaacagtatatgaacctttaccccgttgcctggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccttaggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatggctgctaggctgtgctgccaactgggtcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgctgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU796068_P_P-B Feature FT:CDS EU796068_P_P-B of [Viruses] Hepatitis B Virus genotype B. Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctgaatggcaaactccttcttttcct
gacattcatttgcaggagaacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaataggagact
aaaattaattatgcccgctaggttttatcccaatgttactaaatatttgcccttagataaaggaatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagtcggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatattcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagcctactcccttgtctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggcactgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctaccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggtgaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaactttatgggatatgtaattgggagttggggcacattgccacaagaacatattgtacaaa
aaatcaaaatgtgttttaggaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgcccctttcacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacagtatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccataggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagccggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcgtttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcgggcgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU796071_P_P-B Feature FT:CDS EU796071_P_P-B of [Viruses] Hepatitis B Virus genotype B. Non-functional genomic sequence. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctaaatctcgggaatctcaatgttagtattccttggactc
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gacattcatttgcaggaggacactgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaaacaggagact
aaaattaattatgcctgctaggttttatcccaatattactaaatatttgcccttagataaagggatcaaaccttattatc
cagagcatgtagttaatcattacttccagacgagacattatttacacactctttggaaggcgggtatcttatataaaaga
gagtccacacgtagcgcctcattttgtgggtcaccatattcttgggaacaagatctacagcatgggaggttggtcttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacgactggccggacgccaacaaggtgggagt
gggagcatttgggccagggttcacccctccccatgggggactgttggggtggagccctcaggctcagggcatactcacaa
ctgtgccagcagctcctcctcctgcctccaccaatcggcagtcaggaaggcagccaactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ccatcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacctgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgtaggttcttctggac
tatcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtaccaaacctacggacggaaactgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatattgatgatgtggtattgggggccaagtctgta
caacatcttgagtccctttataccgctgttaccaattttcttttttctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtatgtcaacgaattgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccgacttataaggcctttctaagtaaacagtatatgaacctttaccccgttgcccggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccttaggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctagccgcttgttttgctcgcagcaggtctggggcgaaactcatcgggac
tgacaattctgtcgtgctctcccgcaagtatacatcatttccatagctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgaccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggaaaccaccgtga
>gnl|hbvcds|EU881997_P_P-B Feature FT:CDS EU881997_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient18). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gatattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaagccggagact
aaaattaattatgcctgctaggttctatcccaatcttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttgatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggacttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgccgccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccgctttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcgcatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttcttgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcactaacttgttgtcctccaatttgtcctggttatc
gctggatgtgtctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgtcgaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaagacctgcacagc
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaattcctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttcacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacagacctattgattggaaagtctgtcaacgaatcgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctggccgcttgttttgctcgcagcaggtctggagcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgcccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggtccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU881998_P_P-B Feature FT:CDS EU881998_P_P-B of [Viruses] Hepatitis B Virus genotype B (isolate patient18). Complete genome. [Hepadnaviridae] (length=2532 residues).
atgcccctatcttatcaacacttccggaaactactgttgttagacgaagaggcaggtcccctagaagaagaactccctcg
cctcgcagacgaaggtctcaatcgccgcgtcgcagaagatctcaatctcgggaatctcaatgttagtattccttggacac
ataaggtgggaaactttacggggctttattcttctacggtaccttgctttaatcctaaatggcaaactccttcttttcct
gatattcatttgcaggaggacattgttgatagatgtaagcaatttgtggggccccttacagtaaatgaaagccggagact
aaaattaattatgcctgctaggttctatcccaatcttactaaatatttgcccttagataaagggatcaaaccgtattatc
cagagtatgtagttgatcattacttccagacgcgacattatttacacactctttggaaggcggggatcttatataaaaga
gagtccacacgtagcgcctcattttgcgggtcaccatattcttgggaacaagatctacagcatgggaggttggacttcca
aacctcgaaaaggcatggggacaaatctttctgtccccaatcccctgggattcttccccgatcatcagttggaccctgca
ttcaaagccaactcagaaaatccagattgggacctcaacccgcacaaggacaactggccggacgccaacaaggtgggagt
gggagcattcgggccagggttcacccctcctcatgggggactgttggggtggagccctcaggctcagggcctactcacaa
ctgtgccagcagctcctcctcctgccgccaccaatcggcagtcaggaaggcagcctactcccttatctccacctctaagg
gacactcatcctcaggccatgcagtggaactccaccactttccaccaaactcttcaagatcccagagtcagggccctgta
ctttcctgctggtggctccagttcaggaacagtgagccctgctcagaatactgtctctgccatatcgtcaatcttatcga
agactggggaccctgtaccgaacatggagaacatcacatcaggactcctaggacccctgctcgtgttacaggcggggttt
ttctcgttgacaaaaatcctcacaataccacagagtctagactcgtggtggacttctctcaattttctagggggaacacc
cgtgtgtcttggccaaaattcgcagtcccaaatctccagtcactcaccaacttgttgtcctccaatttgtcctggttatc
gctggatgtatctgcggcgttttatcatcttcctctgcatcctgctgctatgcctcatcttcttgttggttcttctggac
tgtcaaggtatgttgcccgtttgtcctctaattccaggatcatcaacaaccagcaccggaccatgcaaaacctgcacaac
tcctgctcaaggaacctctatgtttccctcatgttgctgtacaaaacctacggacggaaattgcacctgtattcccatcc
catcatcttgggctttcgcaaaatacctatgggagtgggcctcagtccgtttctcttggctcagtttactagtgccattt
gttcagtggttcgtagggctttcccccactgtctggctttcagttatatggatgatgtggttttgggggccaagtctgta
caacatcttgagtccctttatgccgctgttaccaattttcttttgtctttgggtatacatttaaaccctcacaaaacaaa
aagatggggatattcccttaacttcatgggatatgtaattgggagttggggcacattgccacaggaacatattgtacaaa
aaatcaaaatgtgttttagaaaacttcctgtaaacaggcctattgattggaaagtctgtcaacgaatcgtgggtcttttg
gggtttgccgccccttttacgcaatgtggatatcctgctttaatgcctttatatgcatgtatacaagcaaaacaggcttt
tactttctcgccaacttacaaggcctttctaagtaaacaatatctgaacctttaccccgttgctcggcaacggcctggtc
tgtgccaagtgtttgctgacgcaacccccactggttggggcttggccattggccatcagcgcatgcgtggaacctttgtg
tctcctctgccgatccatactgcggaactcctggccgcttgttttgctcgcagcaggtctggggcaaaactcatcgggac
tgacaattctgtcgtgctctcccgcaaatatacatcatttccatggctgctaggctgtgctgccaactggatcctgcgcg
ggacgtcctttgtttacgtcccgtcggcgctgaatcccgcggacgacccctcccggggccgcttggggctctaccgcccg
cttctccgcctgttgtaccgcccgaccacggggcgcacctctctttacgcggactccccgtctgtgccttctcatctgcc
ggaccgtgtgcacttcgcttcacctctgcacgtcgcatggagaccaccgtga
>gnl|hbvcds|EU882002_P_P-B Feature FT:CDS EU882002_P_P-B of [Viruses] Hepatitis B Virus genotype B (isola